Antifungal Activity of 1,4-Dialkoxynaphthalen-2-Acyl Imidazolium Salts by Inducing Apoptosis of Pathogenic Candida spp.
Abstract
1. Introduction
2. Materials and Methods
2.1. General Remarks
2.2. Synthetic Procedures and Analytical Data
2.2.1. Synthesis of 3-acetyl-4-hydroxynaphthalen-1-yl acetate (2a)
2.2.2. Synthesis of 3-acetyl-4-hydroxy-5-methoxynaphthalen-1-yl acetate (2b)
2.2.3. Synthesis of 3-acetyl-4-alkyloxynaphthalen-1-yl acetate (3a–3d)
3-Aetyl-4-methoxynaphthalen-1-yl acetate (3a)
3-Aetyl-4-(isoamyloxy)naphthalen-1-yl acetate (3b)
3-Acetyl-4-isopropoxynaphthalen-1-yl acetate (3c)
3-Acetyl-4-(isoamyloxy)-5-methoxynaphthalen-1-yl acetate (3d)
2.2.4. General Synthesis of 2-acetyl-1,4-dialkoxynaphthalene (4)
2-Acetyl-1,4-dimethoxynaphthalene (4a; CAS Registry Number 65131-13-7)
2-Acetyl-1,4-diisoamyloxynaphthalene (4b)
2-Acetyl-1,4-diisopropoxynaphthalene (4c)
2-Acetyl-1,4-diisoamyloxy-8-methoxynaphthalene (4d)
2.2.5. General Synthesis of naphthalenacyl bromide (5a–5e)
2-Bromoacetyl-1,4-dimethoxynaphthalne (5a)
2-Bromoacetyl-1,4-diisoamyloxynaphthalene (5b)
2-Bromoacetyl-1,4-diisopropoxynaphthalene (5c)
2-Bromoacetyl-1,4-diisoamyloxy-8-methoxynaphthalene (5d)
2-Bromoacetyl-1-methoxynaphthalene (5e)
2.2.6. General Synthesis of 1-substituted benzylimidazoles (6c and 6d)
1-(4-Methoxybenzyl)-1H-imidazole (6c)
1-(4-Nitrobenzyl)-1H-imidazole (6d)
2.2.7. General Synthesis of NAIMSs (7a–7i, 10, 11)
3-(2-(1,4-Dimethoxynaphthalen-2-yl)-2-oxoethyl)-1-methyl-1H-imidazol-3-ium bromide (NAIMS 7a)
3-(2-(1,4-Bis(isoamyloxy)naphthalen-2-yl)-2-oxoethyl)-1-methyl-1H-imiazol-3-ium bromide (NAIMS 7b)
1-Benzyl-3-(2-(1,4-bis(isoamyloxy)naphthalen-2-yl)-2-oxoethyl)-1H-imiazol-3-ium bromide (NAIMS 7c)
3-(2-(1,4-Bis(isoamyloxy)naphthalen-2-yl)-2-oxoethyl)-1-(4-methoxybenzyl)-1H-imidazol-3-ium bromide (NAIMS 7d)
3-(2-(1,4-Bis(isoamyloxy)naphthalen-2-yl)-2-oxoethyl)-1-(4-nitrobenzyl)-1H-imidazol-3-ium bromide (NAIMS 7e)
1-Benzyl-3-(2-(1,4-diisopropoxynaphthalen-2-yl)-2-oxoethyl)-1H-imidazol-3-ium bromide (NAIMS 7f)
3-(2-(1,4-Bis(isoamyloxy)-8-methoxynaphthalen-2-yl)-2-oxoethyl)-1-methyl-1H-imidazol-3-ium bromide (NAIMS 7g)
1-Benzyl-3-(2-(1,4-bis(isoamyloxy)-8-methoxynaphthalen-2-yl)-2-oxoethyl)-1H-imidazol-3-ium bromide (NAIMS 7h)
3-(2-(1,4-Bis(isoamyloxy)-8-methoxynaphthalen-2-yl)-2-oxoethyl)-1-(4-nitrobenzyl)-1H-imidazol-3-ium bromide (NAIMS 7i)
1-Benzyl-3-(2-(naphthalen-2-yl)-2-oxoethyl)-1H-imidazol-3-ium bromide (NAIMS 10)
1-Benzyl-3-(2-(1-methoxynaphthalen-2-yl)-2-oxoethyl)-1H-imidazol-3-ium bromide (NAIMS 11)
2.3. Fungal Strains and Culture
2.4. Antifungal Susceptibility Microdilution Assay
2.5. Cell Viability Assay
2.6. Fungal Cell Growth Test
2.7. ROS Detection
2.8. Measurement of Mitochondrial Membrane Potential (△Ψm)
2.9. Detection for Release of UV Absorbing Materials at 260 and 280 nm
2.10. Quantitative Reverse Transcriptase PCR (qRT-PCR) analysis
2.11. Statistical Analysis
3. Results
3.1. Chemistry
3.2. Antifungal Activity of NAIMS 7c Against Candida spp.
3.3. Inducing ROS Level and the Loss of Mitochondria Membrane Potential by NAIMS 7c.
3.4. The Cell Lysis and the Apoptosis of C. albicans by NAIMS 7c
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Tangarife-Castaño, V.; Correa-Royero, J.; Zapata-Londoño, B.; Durán, C.; Stanshenko, E.; Mesa-Arango, A.C. Anti-Candida albicans activity, cytotoxicity and interaction with antifungal drugs of essential oils and extracts from aromatic and medicinal plants. Infectious 2011, 15, 160–167. [Google Scholar] [CrossRef] [Scilit]
- Cornely, O.A.; Lass-Flörl, C.; Lagrou, K.; Arsic-Arsenijevic, V.; Hoenigl, M. Improving outcome of fungal diseases - Guiding experts and patients towards excellence. Mycoses 2017, 60, 420–425. [Google Scholar] [CrossRef] [Scilit]
- Pfaller, M.A.; Pappas, P.G.; Wingard, J.R. Invasive Fungal Pathogens: Current Epidemiological Trends. Clin. Infect. Dis. 2006, 43, S3–S14. [Google Scholar] [CrossRef] [Scilit]
- Pal, M. Morbidity and Mortality Due to Fungal Infections. J. Appl. Microbiol. Biochem. 2018, 1, 1–3. [Google Scholar] [CrossRef] [Scilit]
- Chandra, J.; Long, L.; Isham, N.; Mukherjee, P.K.; Disciullo, G.; Appelt, K.; Ghannoum, M.A. In Vitro and In Vivo Activity of a Novel Catheter Lock Solution against Bacterial and Fungal Biofilms. Antimicrob. Agents Chemother. 2018, 62, e00722-18. [Google Scholar] [CrossRef] [Scilit]
- Zida, A.; Bamba, S.; Yacouba, A.; Ouedraogo-Traore, R.; Guiguemdé, R. Anti- Candida albicans natural products, sources of new antifungal drugs: A review. J. Mycol. Méd. 2017, 27, 1–19. [Google Scholar] [CrossRef] [Scilit]
- Whaley, S.G.; Berkow, E.L.; Rybak, J.M.; Nishimoto, A.T.; Barker, K.S.; Rogers, P.D. Azole Antifungal Resistance in Candida albicans and Emerging Non-albicans Candida Species. Front. Microbiol. 2017, 7, 2173. [Google Scholar] [CrossRef] [Scilit]
- Björnsson, E.; Jerlstad, P.; Bergqvist, A.; Olsson, R. Fulminant drug-induced hepatic failure leading to death or liver trans-plantation in Sweden. Scand. J. Gastroenterol. 2005, 40, 1095–1101. [Google Scholar]
- Kyriakidis, I.; Tragiannidis, A.; München, S.; Groll, A.H. Clinical hepatotoxicity associated with antifungal agents. Expert Opin. Drug Saf. 2016, 16, 1–17. [Google Scholar] [CrossRef] [Scilit]
- Ribas, A.; Del Ponte, E.; Dalbem, A.; Dalla-Lana, D.; Bündchen, C.; Donato, R.; Schrekker, H.; Fuentefria, A. Imidazolium salts with antifungal potential for the control of head blight of wheat caused by Fusarium graminearum. J. Appl. Microbiol. 2016, 121, 445–452. [Google Scholar] [CrossRef] [Scilit]
- Cornellas, A.; Perez, L.; Comelles, F.; Ribosa, I.; Manresa, A.; Garcia, M.T. Self-aggregation and antimicrobial activity of im-idazolium and pyridinium based ionic liquids in aqueous solution. J. Colloid Interface Sci. 2011, 355, 164–171. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mercs, L.; Albrecht, M. Beyond catalysis: N-heterocyclic carbene complexes as components for medicinal, luminescent, and functional materials applications. Chem. Soc. Rev. 2010, 39, 1903–1912. [Google Scholar] [CrossRef] [Scilit]
- Vasan, S.; Zhang, X.; Kapurniotu, A.; Bernhagen, J.; Teichberg, S.; Basgen, J.; Wagle, D.; Shih, D.; Terlecky, I.; Bucala, R.; et al. An agent cleaving glucose-derived protein crosslinks in vitro and in vivo. Nature 1996, 382, 275–278. [Google Scholar] [CrossRef] [Scilit]
- Domininanni, S.J.; Yen, T.T. Oral hypoglycemic agents. Discovery and structure-activity relationships of phenacylimidazolium halides. J. Med. Chem. 1989, 32, 2301–2306. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cooper, M.E.; Thallas, V.; Forbes, J.; Scalbert, E.; Sastra, S.; Darby, I.; Soulis, T. The cross-link breaker, N-phenacylthiazolium bromide prevents vascular advanced glycation end-product accumulation. Diabetologia 2000, 43, 660–664. [Google Scholar] [CrossRef] [Scilit]
- Phillips, A.J.; Sudbery, I.; Ramsdale, M. Apoptosis induced by environmental stresses and amphotericin B in Candida albicans. Proc. Natl. Acad. Sci. USA 2003, 100, 14327–14332. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hwang, J.; Choi, H.; Kim, A.; Yun, J.; Yu, R.; Woo, E.-R.; Lee, D. Hibicuslide C-induced cell death in Candida albicans involves apoptosis mechanism. J. Appl. Microbiol. 2014, 117, 1400–1411. [Google Scholar] [CrossRef] [Scilit]
- Jia, C.; Zhang, J.; Yu, L.; Wang, C.; Yang, Y.; Rong, X.; Xu, K.; Chu, M. Antifungal Activity of Coumarin Against Candida albicans Is Related to Apoptosis. Front. Cell. Infect. Microbiol. 2019, 8, 445. [Google Scholar] [CrossRef] [Scilit]
- E Leadsham, J.; Kotiadis, V.N.; Tarrant, D.J.; Gourlay, C.W. Apoptosis and the yeast actin cytoskeleton. Cell Death Differ. 2009, 17, 754–762. [Google Scholar] [CrossRef] [Scilit]
- Pereira, C.; Silva, R.; Saraiva, L.; Johansson, B.; Sousa, M.J.; Côrte-Real, M. Mitochondria-dependent apoptosis in yeast. Biochim. Biophys. Acta (BBA) Bioenerg. 2008, 1783, 1286–1302. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Simon, H.-U.; Haj-Yehia, A.; Levi-Schaffer, F. Role of reactive oxygen species (ROS) in apoptosis induction. Apoptosis 2000, 5, 415–418. [Google Scholar] [CrossRef] [Scilit]
- Boyer, J.L.; Krum, J.E.; Myers, M.C.; Fazal, A.N.; Wigal, C.T. Synthetic utility and mechanistic implications of the fries rear-rangement of hydroquinone diesters in boron trifluoride complexes. J. Org. Chem. 2000, 65, 4712–4714. [Google Scholar] [CrossRef] [Scilit]
- Bose, G.; Barua, P.M.B.; Chaudhuri, M.K.; Kalita, D.; Khan, A.T. A convenient and useful method of preparation of α-bromo enones from the corresponding enones using organic ammonium tribromide (OATB). Chem. Lett. 2001, 30, 290–291. [Google Scholar] [CrossRef] [Scilit]
- Arjomandi, O.K.; Kavoosi, M.; Adibi, H. Synthesis and investigation of inhibitory activities of imidazole derivatives against the metallo-β-lactamase IMP-1. Bioorganic Chem. 2019, 92, 103277. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bahnous, M.; Bouraiou, A.; Chelghoum, M.; Bouacida, S.; Roisnel, T.; Smati, F.; Bentchouala, C.; Gros, P.C.; Belfaitah, A. Synthesis, crystal structure and antibacterial activity of new highly functionalized ionic compounds based on the imidazole nucleus. Bioorganic Med. Chem. Lett. 2013, 23, 1274–1278. [Google Scholar] [CrossRef] [Scilit]
- Kim, J.; Bao, T.H.Q.; Shin, Y.-K.; Kim, K.-Y. Antifungal activity of magnoflorine against Candida strains. World J. Microbiol. Biotechnol. 2018, 34, 167. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Balouiri, M.; Sadiki, M.; Ibnsouda, S.K. Methods for in vitro evaluating antimicrobial activity: A review. J. Pharm. Anal. 2016, 6, 71–79. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Clinical and Laboratory Standards Institute. M27-A3: Reference Method for Broth Dilution Antifungal Susceptibility Testing of Yeasts, Approved Standard—3rd ed.; CLSI: Wayne, PA, USA, 2008. [Google Scholar]
- Shin, Y.; Kim, K. Macelignan inhibits bee pathogenic fungi Ascophaera apis growth through HOG1 pathway. Braz. J. Med Biol. Res. 2016, 49, 5313. [Google Scholar] [CrossRef] [Scilit]
- Kim, J.; Shin, Y.K.; Kim, K.Y. Promotion of keratinocyte proliferation by tracheloside through ERK1/2 stimulation. Evid. Based Complement. Alternat. Med. 2018, 2018, 4580627. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mumma, J.O.; Chhay, J.S.; Ross, K.L.; Eaton, J.S.; Newell-Litwa, K.A.; Fridovich-Keil, J.L. Distinct roles of galactose-1P in galactose-mediated growth arrest of yeast deficient in galactose-1P uridylyltransferase (GALT) and UDP-galactose 4′-epimerase (GALE). Mol. Genet. Metab. 2008, 93, 160–171. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hossain, K.F.B.; Rahman, M.; Sikder, T.; Hosokawa, T.; Saito, T.; Kurasaki, M. Selenium modulates inorganic mercury induced cytotoxicity and intrinsic apoptosis in PC12 cells. Ecotoxicol. Environ. Saf. 2021, 207, 111262. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chen, C.Z.; Cooper, S.L. Interactions between dendrimer biocides and bacterial membranes. Biomaterials 2002, 23, 3359–3368. [Google Scholar] [CrossRef] [Scilit]
- Alshaibani, M.; Zin, N.M.; Jalil, J.; Sidik, N.; Ahmad, S.J.; Kamal, N.; Edrada-Ebel, R. Isolation, purification, and characteri-zation of five active diketopiperazine derivatives from endophytic Streptomyces SUK 25 with antimicrobial and cytotoxic ac-tivities. J. Microbiol. Biotechnol. 2017, 27, 1249–1256. [Google Scholar] [CrossRef] [Scilit]
- Li, X.; Qian, J.; Wang, C.; Zheng, K.; Ye, L.; Fu, Y.; Han, N.; Bian, H.; Pan, J.; Wang, J.; et al. Regulating Cytoplasmic Calcium Homeostasis Can Reduce Aluminum Toxicity in Yeast. PLOS ONE 2011, 6, e21148. [Google Scholar] [CrossRef] [Scilit]
- Morici, P.; Fais, R.; Rizzato, C.; Tavanti, A.; Lupetti, A. Inhibition of Candida albicans biofilm formation by the synthetic lac-toferricin derived peptide hLF1-11. PLoS ONE 2016, 11, e0167470. [Google Scholar] [CrossRef] [Scilit]
- Haque, F.; Verma, N.K.; Alfatah, M.; Bijlani, S.; Bhattacharyya, M.S. Sophorolipid exhibits antifungal activity by ROS mediated endoplasmic reticulum stress and mitochondrial dysfunction pathways in Candida albicans. RSC Adv. 2019, 9, 41639–41648. [Google Scholar] [CrossRef] [Scilit]
- Lü, H.; Zhu, Z.; Dong, L.; Jia, X.; Sun, X.; Yan, L.; Chai, Y.; Jiang, Y.; Cao, Y. Lack of Trehalose Accelerates H2O2-Induced Candida albicans Apoptosis through Regulating Ca2+ Signaling Pathway and Caspase Activity. PLOS ONE 2011, 6, e15808. [Google Scholar] [CrossRef] [Scilit]
- Arendrup, M.C.; Patterson, T.F. Multidrug-Resistant Candida: Epidemiology, Molecular Mechanisms, and Treatment. J. Infect. Dis. 2017, 216, S445–S451. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Forsberg, K.; Woodworth, K.; Walters, M.; Berkow, E.L.; Jackson, B.; Chiller, T.; Vallabhaneni, S. Candida auris: The recent emergence of a multidrug-resistant fungal pathogen. Med Mycol. 2018, 57, 1–12. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ganan, M.; Lorentzen, S.B.; Aam, B.B.; Eijsink, V.G.H.; Gaustad, P.; Sørlie, M. Antibiotic saving effect of combination therapy through synergistic interactions between well-characterized chito-oligosaccharides and commercial antifungals against med-ically relevant yeasts. PLoS ONE 2019, 14, e0227098. [Google Scholar] [CrossRef] [Scilit]
- Vazquez, J.A.; Sobel, J.D. Miconazole Mucoadhesive Tablets: A Novel Delivery System. Clin. Infect. Dis. 2012, 54, 1480–1484. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Espinel-Ingroff, A.; Shadomy, S. In vitro and in vivo evaluation of antifungal agents. Eur. J. Clin. Microbiol. Infect. Dis. 1989, 8, 352–361. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liu, L.-X.; Wang, X.-Q.; Yan, J.-M.; Li, Y.; Sun, C.-J.; Chen, W.; Zhou, B.; Zhang, H.-B.; Yang, X.-D. Synthesis and antitumor ac-tivities of novel dibenzo[b,d]furane imidazole hybrid compounds. Eur. J. Med. Chem. 2013, 66, 423–437. [Google Scholar] [CrossRef] [Scilit] [PubMed]









| Gene | Oligomer | References |
|---|---|---|
| ACT1 | F: TAGGTTTGGAAGCTGCTGG | [36] |
| R: CCTGGGAACATGGTAGTAC | ||
| YPK1 | F: CAACACAACACAGTAGCACC | This study |
| R: GTTGTGGATAAAGGTGGTTCG | ||
| HAC1 | F: TACAACCAACACATCAACCAG | [37] |
| R: ATTAGTTGGACCGGAAGATG | ||
| MCA1 | F: TATAATAGACCTTCTGGAC | [38] |
| R: TTGGTGGACGAGAATAATG |
| Compound | C. albicans | C. tropicalis var. tropicalis | C. parapsilosis var. parapsilosis | C. glabrata | C. tropicalis | C. auris |
|---|---|---|---|---|---|---|
| KCTC7965 | KCTC17762 | KACC45480 | KCTC7219 | KCTC7212 | KCTC17810 | |
| Miconazole | 12.5 | 12.5 | 12.5 | 12.5 | 12.5 | >100 |
| NAIMS 7c | 3.125 | 6.25 | 3.125 | 6.25 | 3.125 | 3.125 |
| NAIMS 7g | 12.5 | 25 | 6.25 | 25 | 6.25 | 6.25 |
| NAIMS 7h | 50 | 25 | 25 | 25 | 50 | 25 |
| 8 | >100 | >100 | >100 | >100 | >100 | N/A |
| 9′ | >100 | >100 | >100 | >100 | >100 | N/A |
| 9 | >100 | >100 | >100 | >100 | >100 | >100 |
| NAIMS 10 | >100 | >100 | >100 | >100 | 25 | >100 |
| NAIMS 11 | >100 | >100 | >100 | >100 | 25 | >100 |
| NAIMS 7e | 6.25 | 6.25 | 6.25 | 6.25 | 6.25 | 3.125 |
| NAIMS 7b | 6.25 | 12.5 | 3.125 | 12.5 | 3.125 | 6.25 |
| NAIMS 7i | 12.5 | 12.5 | 6.25 | 12.5 | 6.25 | 12.5 |
| NAIMS 7a | >100 | >100 | >100 | >100 | >100 | >100 |
| NAIMS 7d | 3.125 | 6.25 | 3.125 | 6.25 | 3.125 | 6.25 |
| NAIMS 7f | 100 | 100 | 12.5 | 6.25 | 25 | 100 |
| Fungal Strains | Time | Miconazole | NAIMS 7c | NAIMS 7g | NAIMS 7h | 8 | 9′ | 9 | NAIMS 10 | NAIMS 11 | NAIMS 7e | NAIMS 7b | NAIMS 7i | NAIMS 7a | NAIMS 7d | NAIMS 7f |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| C. albicans (KCTC7965) | 48h | 12.5 | 6.25 | 12.5 | 100 | >100 | >100 | >100 | >100 | >100 | 12.5 | 12.5 | 12.5 | >100 | 3.125 | 100 |
| 72h | 12.5 | 6.25 | 12.5 | 100 | >100 | >100 | >100 | >100 | >100 | 25 | 12.5 | 12.5 | >100 | 6.25 | 100 | |
| C. tropicalis var. tropicalis (KCTC17762) | 48h | 12.5 | 6.25 | 25 | 50 | >100 | >100 | >100 | >100 | >100 | 12.5 | 12.5 | 12.5 | >100 | 6.25 | 100 |
| 72h | 12.5 | 12.5 | 25 | 100 | >100 | >100 | >100 | >100 | >100 | 12.5 | 12.5 | 25 | >100 | 12.5 | 100 | |
| C. parapsilosis var. parapsilosis (KACC45480) | 48h | 12.5 | 6.25 | 6.25 | 50 | >100 | >100 | >100 | >100 | >100 | 6.25 | 6.25 | 6.25 | >100 | 6.25 | 12.5 |
| 72h | 12.5 | 12.5 | 6.25 | 100 | >100 | >100 | >100 | >100 | >100 | 12.5 | 6.25 | 12.5 | >100 | 6.25 | 12.5 | |
| C. glabrata (KCTC7219) | 48h | 12.5 | 3.125 | 25 | 50 | >100 | >100 | >100 | >100 | >100 | 12.5 | 12.5 | 12.5 | >100 | 12.5 | 6.25 |
| 72h | 12.5 | 6.25 | 25 | 50 | >100 | >100 | >100 | >100 | >100 | 12.5 | 12.5 | 25 | >100 | 12.5 | 6.25 | |
| C. tropicalis (KCTC7212) | 48h | 12.5 | 6.25 | 6.25 | 50 | >100 | 25 | 50 | 25 | 50 | 12.5 | 6.25 | 6.25 | >100 | 6.25 | N/A |
| 72h | 12.5 | 6.25 | 6.25 | 100 | >100 | 50 | 50 | 50 | 50 | 25 | 6.25 | 6.25 | >100 | 6.25 | N/A | |
| C. auris (KCTC17810) | 48h | >100 | 3.125 | 6.25 | 25 | >100 | >100 | >100 | >100 | >100 | 6.25 | 6.25 | 6.25 | >100 | 6.25 | 100 |
| 72h | >100 | 3.125 | 6.25 | 25 | N/A | N/A | >100 | >100 | >100 | 6.25 | 6.25 | 12.5 | >100 | 12.5 | 100 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Lee, J.; Kim, J.-G.; Lee, H.; Lee, T.H.; Kim, K.-Y.; Kim, H. Antifungal Activity of 1,4-Dialkoxynaphthalen-2-Acyl Imidazolium Salts by Inducing Apoptosis of Pathogenic Candida spp. Pharmaceutics 2021, 13, 312. https://doi.org/10.3390/pharmaceutics13030312
Lee J, Kim J-G, Lee H, Lee TH, Kim K-Y, Kim H. Antifungal Activity of 1,4-Dialkoxynaphthalen-2-Acyl Imidazolium Salts by Inducing Apoptosis of Pathogenic Candida spp. Pharmaceutics. 2021; 13(3):312. https://doi.org/10.3390/pharmaceutics13030312
Chicago/Turabian StyleLee, Jisue, Jae-Goo Kim, Haena Lee, Tae Hoon Lee, Ki-Young Kim, and Hakwon Kim. 2021. "Antifungal Activity of 1,4-Dialkoxynaphthalen-2-Acyl Imidazolium Salts by Inducing Apoptosis of Pathogenic Candida spp." Pharmaceutics 13, no. 3: 312. https://doi.org/10.3390/pharmaceutics13030312
APA StyleLee, J., Kim, J.-G., Lee, H., Lee, T. H., Kim, K.-Y., & Kim, H. (2021). Antifungal Activity of 1,4-Dialkoxynaphthalen-2-Acyl Imidazolium Salts by Inducing Apoptosis of Pathogenic Candida spp. Pharmaceutics, 13(3), 312. https://doi.org/10.3390/pharmaceutics13030312

