SFV Replicon Vector Harbouring Porcine Epidemic Diarrhoea Virus Immunogens Delivered by Attenuated Salmonella Typhimurium Induces PEDV Neutralising Antibodies and Lactogenic Immunogenicity in BALB/c Mice
Abstract
1. Introduction
2. Materials and Methods
2.1. Bacterial Strains, Plasmids, Cell Lines, and Viruses
2.2. Construction and Validation of Attenuated Salmonella Delivering Immunogenic PEDV Antigens
2.3. Western Blot and Immunofluorescence Assay
2.4. Safety Assessment of the PED Vaccine Constructs in Mice
2.5. Immunisation and Challenge
2.6. Determination of Antigen-Specific ELISA
2.7. Cytokine Responses
2.8. FACS Analysis of CD3+CD4+ and CD3+CD8+ T Cell Populations
2.9. Serum Neutralisation Test
2.10. Evaluation of PEDV-Specific Lactogenic Immunity in Suckling Mice
2.11. Statistical Analysis
3. Results
3.1. Evaluation and Characterisation of the PEDV Antigens
3.2. Construction and Validation of the PEDV Antigens Expressed by Attenuated S. Typhimurium
3.3. Evaluation of the Safety of the Attenuated S. Typhimurium Strain Delivering PED Vaccine Antigens
3.4. Vaccination-Induced Anti-PEDV Specific Humoral Immune Responses
3.5. Determination of Cytokine Measurement
3.6. Relative Proportions of CD4+ and CD8+ T Cells After Vaccination with Recombinant S. Typhimurium
3.7. Protective Immune Responses Against Salmonellosis
3.8. Passive Immunity Acquired by Suckling Mice Against PEDV
4. Discussion
4.1. Design and Characteriasation of the SFV-Salmonella-Based PEDV Vaccine Platform
4.2. Immunogenicity and Protection Efficacy in Mice
4.3. Implications for Maternal and Lactogenic Immunity
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Debouck, P.; Pensaert, M. Experimental Infection of Pigs with a New Porcine Enteric Coronavirus, CV 777. Am. J. Vet. Res. 1980, 41, 219–223. [Google Scholar] [CrossRef]
- Jung, K.; Eyerly, B.; Annamalai, T.; Lu, Z.; Saif, L.J. Structural Alteration of Tight and Adherens Junctions in Villous and Crypt Epithelium of the Small and Large Intestine of Conventional Nursing Piglets Infected with Porcine Epidemic Diarrhea Virus. Vet. Microbiol. 2015, 177, 373–378. [Google Scholar] [CrossRef] [PubMed]
- Duarte, M.; Gelfi, J.; Lambert, P.; Rasschaert, D.; Laude, H. Genome Organization of Porcine Epidemic Diarrhoea Virus. In Coronaviruses: Molecular Biology and Virus-Host Interactions; Springer: Boston, MA, USA, 1993. [Google Scholar]
- Lee, C. Porcine Epidemic Diarrhea Virus: An Emerging and Re-Emerging Epizootic Swine Virus. Virol. J. 2015, 12, 193. [Google Scholar] [CrossRef] [PubMed]
- Park, J.-E. Porcine Epidemic Diarrhea: Insights and Progress on Vaccines. Vaccines 2024, 12, 212. [Google Scholar] [CrossRef] [PubMed]
- Li, W.; Hangalapura, B.N.; van den Elzen, P.; van den Born, E.; van Kuppeveld, F.J.M.; Rottier, P.J.M.; Bosch, B.-J. Safety and Efficacy of Live Attenuated PEDV Vaccines for Neonatal Protection. npj Vaccines 2025, 10, 131. [Google Scholar] [CrossRef]
- Li, W.; van Kuppeveld, F.J.M.; He, Q.; Rottier, P.J.M.; Bosch, B.-J. Cellular Entry of the Porcine Epidemic Diarrhea Virus. Virus Res. 2016, 226, 117–127. [Google Scholar] [CrossRef]
- Li, C.; Li, W.; Lucio de Esesarte, E.; Guo, H.; van den Elzen, P.; Aarts, E.; van den Born, E.; Rottier, P.J.M.; Bosch, B.-J. Cell Attachment Domains of the Porcine Epidemic Diarrhea Virus Spike Protein Are Key Targets of Neutralizing Antibodies. J. Virol. 2017, 91, 10-1128. [Google Scholar] [CrossRef]
- Chang, C.-Y.; Cheng, I.-C.; Chang, Y.-C.; Tsai, P.-S.; Lai, S.-Y.; Huang, Y.-L.; Jeng, C.-R.; Pang, V.F.; Chang, H.-W. Identification of Neutralizing Monoclonal Antibodies Targeting Novel Conformational Epitopes of the Porcine Epidemic Diarrhoea Virus Spike Protein. Sci. Rep. 2019, 9, 2529. [Google Scholar] [CrossRef]
- Wang, L.; Byrum, B.; Zhang, Y. New Variant of Porcine Epidemic Diarrhea Virus, United States, 2014. Emerg. Infect. Dis. 2014, 20, 917–919. [Google Scholar] [CrossRef]
- Roasto, M.; Bonardi, S.; Mäesaar, M.; Alban, L.; Gomes-Neves, E.; Vieira-Pinto, M.; Vågsholm, I.; Elias, T.; Lindegaard, L.L.; Blagojevic, B. Salmonella enterica Prevalence, Serotype Diversity, Antimicrobial Resistance and Control in the European Pork Production Chain. Trends Food Sci. Technol. 2023, 131, 210–219. [Google Scholar] [CrossRef]
- Joshi, L.R.; Okda, F.A.; Singrey, A.; Maggioli, M.F.; Faccin, T.C.; Fernandes, M.H.V.; Hain, K.S.; Dee, S.; Bauermann, F.V.; Nelson, E.A.; et al. Passive Immunity to Porcine Epidemic Diarrhea Virus Following Immunization of Pregnant Gilts with a Recombinant Orf Virus Vector Expressing the Spike Protein. Arch. Virol. 2018, 163, 2327–2335. [Google Scholar] [CrossRef]
- Langel, S.N.; Paim, F.C.; Lager, K.M.; Vlasova, A.N.; Saif, L.J. Lactogenic Immunity and Vaccines for Porcine Epidemic Diarrhea Virus (PEDV): Historical and Current Concepts. Virus Res. 2016, 226, 93–107. [Google Scholar] [CrossRef] [PubMed]
- Patel, V.; Valentin, A.; Kulkarni, V.; Rosati, M.; Bergamaschi, C.; Jalah, R.; Alicea, C.; Minang, J.T.; Trivett, M.T.; Ohlen, C.; et al. Long-Lasting Humoral and Cellular Immune Responses and Mucosal Dissemination after Intramuscular DNA Immunization. Vaccine 2010, 28, 4827–4836. [Google Scholar] [CrossRef]
- Matic, J.N.; Terry, T.D.; Van Bockel, D.; Maddocks, T.; Tinworth, D.; Jennings, M.P.; Djordjevic, S.P.; Walker, M.J. Development of Non-Antibiotic-Resistant, Chromosomally Based, Constitutive and Inducible Expression Systems for AroA-Attenuated Salmonella enterica Serovar Typhimurium. Infect. Immun. 2009, 77, 1817–1826. [Google Scholar] [CrossRef] [PubMed]
- Chen, H.; Schifferli, D.M. Construction, Characterization, and Immunogenicity of an Attenuated Salmonella enterica Serovar Typhimurium PgtE Vaccine Expressing Fimbriae with Integrated Viral Epitopes from the SpiC Promoter. Infect. Immun. 2003, 71, 4664–4673. [Google Scholar] [CrossRef] [PubMed]
- Kirthika, P.; Senevirathne, A.; Jawalagatti, V.; Park, S.; Lee, J.H. Deletion of the Lon Gene Augments Expression of Salmonella Pathogenicity Island (SPI)-1 and Metal Ion Uptake Genes Leading to the Accumulation of Bactericidal Hydroxyl Radicals and Host pro-Inflammatory Cytokine-Mediated Rapid Intracellular Clearance. Gut Microbes 2020, 11, 1695–1712. [Google Scholar] [CrossRef]
- Knuff, K.; Finlay, B.B. What the SIF Is Happening—The Role of Intracellular Salmonella-Induced Filaments. Front. Cell. Infect. Microbiol. 2017, 7, 335. [Google Scholar] [CrossRef]
- Beuzon, C.R. Salmonella Maintains the Integrity of Its Intracellular Vacuole through the Action of SifA. EMBO J. 2000, 19, 3235–3249. [Google Scholar] [CrossRef]
- Zhou, G.; Zhao, Y.; Ma, Q.; Li, Q.; Wang, S.; Shi, H. Manipulation of Host Immune Defenses by Effector Proteins Delivered from Multiple Secretion Systems of Salmonella and Its Application in Vaccine Research. Front. Immunol. 2023, 14, 1152017. [Google Scholar] [CrossRef]
- Vallet, T.; Vignuzzi, M. Self-Amplifying RNA: Advantages and Challenges of a Versatile Platform for Vaccine Development. Viruses 2025, 17, 566. [Google Scholar] [CrossRef] [PubMed]
- Senevirathne, A.; Park, J.-Y.; Hewawaduge, C.; Perumalraja, K.; Lee, J.H. Eukaryotic Expression System Complemented with Expressivity of Semliki Forest Virus’s RdRp and Invasiveness of Engineered Salmonella Demonstrate Promising Potential for Bacteria Mediated Gene Therapy. Biomaterials 2021, 279, 121226. [Google Scholar] [CrossRef] [PubMed]
- Nakayama, K.; Kelly, S.M.; Curtiss, R. Construction of an ASD+ expression-Cloning Vector: Stable Maintenance and High Level Expression of Cloned Genes in a Salmonella Vaccine Strain. Bio/Technology 1988, 6, 693–697. [Google Scholar] [CrossRef]
- Yang, D.K.; Kim, H.H.; Lee, S.H.; Yoon, S.S.; Park, J.W.; Cho, I.S. Isolation and Characterization of a New Porcine Epidemic Diarrhea Virus Variant That Occurred in Korea in 2014. J. Vet. Sci. 2018, 19, 71–78. [Google Scholar] [CrossRef]
- Giulietti, A.; Overbergh, L.; Valckx, D.; Decallonne, B.; Bouillon, R.; Mathieu, C. An Overview of Real-Time Quantitative PCR: Applications to Quantify Cytokine Gene Expression. Methods 2001, 25, 386–401. [Google Scholar] [CrossRef]
- Pfaffl, M.W. A New Mathematical Model for Relative Quantification in Real-Time RT-PCR. Nucleic Acids Res. 2001, 29, e45. [Google Scholar] [CrossRef]
- Slate, D.; Rupprecht, C.E.; Rooney, J.A.; Donovan, D.; Lein, D.H.; Chipman, R.B. Status of Oral Rabies Vaccination in Wild Carnivores in the United States. Virus Res. 2005, 111, 68–76. [Google Scholar] [CrossRef]
- Song, D.S.; Oh, J.S.; Kang, B.K.; Yang, J.S.; Moon, H.J.; Yoo, H.S.; Jang, Y.S.; Park, B.K. Oral Efficacy of Vero Cell Attenuated Porcine Epidemic Diarrhea Virus DR13 Strain. Res. Vet. Sci. 2007, 82, 134–140. [Google Scholar] [CrossRef]
- Lee, S.; Lee, C. Outbreak-Related Porcine Epidemic Diarrhea Virus Strains Similar to US Strains, South Korea, 2013. Emerg. Infect. Dis. 2014, 20, 1223–1226. [Google Scholar] [CrossRef] [PubMed]
- Gerdts, V.; Zakhartchouk, A. Vaccines for Porcine Epidemic Diarrhea Virus and Other Swine Coronaviruses. Vet. Microbiol. 2017, 206, 45–51. [Google Scholar] [CrossRef] [PubMed]
- Sun, D.; Wang, X.; Wei, S.; Chen, J.; Feng, L. Epidemiology and Vaccine of Porcine Epidemic Diarrhea Virus in China: A Mini-Review. J. Vet. Med. Sci. 2016, 78, 355–363. [Google Scholar] [CrossRef] [PubMed]
- Li, F. Receptor Recognition Mechanisms of Coronaviruses: A Decade of Structural Studies. J. Virol. 2015, 89, 1954–1964. [Google Scholar] [CrossRef]
- Sun, D.; Feng, L.; Shi, H.; Chen, J.; Cui, X.; Chen, H.; Liu, S.; Tong, Y.; Wang, Y.; Tong, G. Identification of Two Novel B Cell Epitopes on Porcine Epidemic Diarrhea Virus Spike Protein. Vet. Microbiol. 2008, 131, 73–81. [Google Scholar] [CrossRef]
- Liu, D.-q.; Ge, J.-w.; Qiao, X.-y.; Jiang, Y.-p.; Liu, S.-m.; Li, Y.-j. High-Level Mucosal and Systemic Immune Responses Induced by Oral Administration with Lactobacillus-Expressed Porcine Epidemic Diarrhea Virus (PEDV) S1 Region Combined with Lactobacillus-Expressed N Protein. Appl. Microbiol. Biotechnol. 2012, 93, 2437–2446. [Google Scholar] [CrossRef]
- Jones, B. Entry of Microbes into the Host: Using M Cells to Break the Mucosal Barrier. Curr. Opin. Immunol. 1995, 7, 474–478. [Google Scholar] [CrossRef]
- da Silva, A.J.; Zangirolami, T.C.; Novo-Mansur, M.T.M.; Giordano, R.d.C.; Martins, E.A.L. Live Bacterial Vaccine Vectors: An Overview. Braz. J. Microbiol. 2014, 45, 1117–1129. [Google Scholar] [CrossRef]
- Kim, S.W.; Moon, K.H.; Baik, H.S.; Kang, H.Y.; Kim, S.K.; Bahk, J.D.; Hur, J.; Lee, J.H. Changes of Physiological and Biochemical Properties of Salmonella enterica Serovar Typhimurium by Deletion of CpxR and Lon Genes Using Allelic Exchange Method. J. Microbiol. Methods 2009, 79, 314–320. [Google Scholar] [CrossRef]
- Spinola, S.M.; Fortney, K.R.; Baker, B.; Janowicz, D.M.; Zwickl, B.; Katz, B.P.; Blick, R.J.; Munson, R.S. Activation of the CpxRA System by Deletion of CpxA Impairs the Ability of Haemophilus ducreyi To Infect Humans. Infect. Immun. 2010, 78, 3898–3904. [Google Scholar] [CrossRef]
- Steele-Mortimer, O. The Salmonella-Containing Vacuole—Moving with the Times. Curr. Opin. Microbiol. 2008, 11, 38–45. [Google Scholar] [CrossRef] [PubMed]
- Outlaw, M.C.; Dimmock, N.J. Mechanisms of Neutralization of Influenza Virus on Mouse Tracheal Epithelial Cells by Mouse Monoclonal Polymeric IgA and Polyclonal IgM Directed against the Viral Haemagglutinin. J. Gen. Virol. 1990, 71, 69–76. [Google Scholar] [CrossRef] [PubMed]
- Dörner, T.; Radbruch, A. Antibodies and B Cell Memory in Viral Immunity. Immunity 2007, 27, 384–392. [Google Scholar] [CrossRef] [PubMed]
- Kidd, P. Th1/Th2 Balance: The Hypothesis, Its Limitations, and Implications for Health and Disease. Altern. Med. Rev. 2003, 8, 223–246. [Google Scholar]
- Parham, P. On the Fragmentation of Monoclonal IgG1, IgG2a, and IgG2b from BALB/c Mice. J. Immunol. 1983, 131, 2895–2902. [Google Scholar] [CrossRef]
- Denkers, E.Y.; Gazzinelli, R.T. Regulation and Function of T-Cell-Mediated Immunity during Toxoplasma gondii Infection. Clin. Microbiol. Rev. 1998, 11, 569–588. [Google Scholar] [CrossRef]
- Janssens, Y.; Joye, J.; Waerlop, G.; Clement, F.; Leroux-Roels, G.; Leroux-Roels, I. The Role of Cell-Mediated Immunity against Influenza and Its Implications for Vaccine Evaluation. Front. Immunol. 2022, 13, 959379. [Google Scholar] [CrossRef]
- Zhang, Q.; Ma, J.; Yoo, D. Inhibition of NF-ΚB Activity by the Porcine Epidemic Diarrhea Virus Nonstructural Protein 1 for Innate Immune Evasion. Virology 2017, 510, 111–126. [Google Scholar] [CrossRef]
- Hodgkin, P.D.; Lee, J.H.; Lyons, A.B. B Cell Differentiation and Isotype Switching Is Related to Division Cycle Number. J. Exp. Med. 1996, 184, 277–281. [Google Scholar] [CrossRef]
- MacLeod, M.K.L.; Kappler, J.W.; Marrack, P. Memory CD4 T Cells: Generation, Reactivation and Re-Assignment. Immunology 2010, 130, 10–15. [Google Scholar] [CrossRef]
- Guglani, L.; Khader, S.A. Th17 Cytokines in Mucosal Immunity and Inflammation. Curr. Opin. HIV AIDS 2010, 5, 120–127. [Google Scholar] [CrossRef]
- Zhang, Y.; Dominguez-Medina, C.; Cumley, N.J.; Heath, J.N.; Essex, S.J.; Bobat, S.; Schager, A.; Goodall, M.; Kracker, S.; Buckley, C.D.; et al. IgG1 Is Required for Optimal Protection after Immunization with the Purified Porin OmpD from Salmonella typhimurium. J. Immunol. 2017, 199, 4103–4109. [Google Scholar] [CrossRef]
- Jung, K.; Saif, L.J.; Wang, Q. Porcine Epidemic Diarrhea Virus (PEDV): An Update on Etiology, Transmission, Pathogenesis, and Prevention and Control. Virus Res. 2020, 286, 198045. [Google Scholar] [CrossRef] [PubMed]
- Song, Y.; Mehl, F.; Zeichner, S.L. Vaccine Strategies to Elicit Mucosal Immunity. Vaccines 2024, 12, 191. [Google Scholar] [CrossRef] [PubMed]
- Renson, P.; Fablet, C.; Andraud, M.; Normand, V.; Lebret, A.; Paboeuf, F.; Rose, N.; Bourry, O. Maternally-Derived Neutralizing Antibodies Reduce Vaccine Efficacy against Porcine Reproductive and Respiratory Syndrome Virus Infection. Vaccine 2019, 37, 4318–4324. [Google Scholar] [CrossRef] [PubMed]
- Oliver-Ferrando, S.; Segalés, J.; López-Soria, S.; Callén, A.; Merdy, O.; Joisel, F.; Sibila, M. Evaluation of Natural Porcine Circovirus Type 2 (PCV2) Subclinical Infection and Seroconversion Dynamics in Piglets Vaccinated at Different Ages. Vet. Res. 2016, 47, 121. [Google Scholar] [CrossRef]
- Su, F.; Patel, G.B.; Hu, S.; Chen, W. Induction of Mucosal Immunity through Systemic Immunization: Phantom or Reality? Hum. Vaccin. Immunother. 2016, 12, 1070–1079. [Google Scholar] [CrossRef]
- Molina Estupiñan, J.L.; Aradottir Pind, A.A.; Foroutan Pajoohian, P.; Jonsdottir, I.; Bjarnarson, S.P. The Adjuvants DmLT and MmCT Enhance Humoral Immune Responses to a Pneumococcal Conjugate Vaccine after Both Parenteral or Mucosal Immunization of Neonatal Mice. Front. Immunol. 2023, 13, 1078904. [Google Scholar] [CrossRef]






| Strains/Plasmids/Primers | Description | References |
|---|---|---|
| S. Typhimurium | ||
| JOL401 | Salmonella Typhimurium wild type, SPI-1 invAE+hilA+avr+; SPI-2, amino acid permease+; SPI-3, mgtC+; SPI4, ABC transporter; SPI5, pipB+; antigen preparation | Lab stock |
| JOL2500 | Salmonella Typhimurium Δlon, ΔcpxR, Δasd, ΔsifA; bacterial delivery vector | Lab stock |
| JOL2865 | JOL2500 delivering empty pJHL204 vector | Lab stock |
| JOL2669 | JOL2500 delivering pJHL204:PEDS1-NTD | This study |
| JOL2670 | JOL2500 delivering pJHL204: N | This study |
| E. coli | ||
| X232 | E. coli F− λ− φ80 Δ(lacZYA-argF) endA1 recA1 hadR17 deoR thi-1 glnV44 gyrA96 relA1 ΔasdA4 strain used for cloning of genes into asd+plasmid | Lab stock |
| BL21pLysS | F–, ompT, hsdSB (rB–, mB–), dcm, gal, λ (DE3), pLysS, Cmr | Progma, USA |
| Plasmids | ||
| pET28a(+) | IPTG-inducible expression vector; Kanamycin resistant | Novagen, USA |
| pJHL204 | asd+, CMV promoter, SV40 promoter, pBR322 ori | Lab stock |
| Primers | ||
| IFN-γ FW | TCAAGTGGCATAGATGTGGAAGAA | [25] |
| IFN-γ RV | TGGCTCTGCAGGATTTTCATG | [25] |
| IL-4 FW | ACAGGAGAAGGGACGCCAT | [25] |
| IL-4 RV | GAAGCCCTACAGACGAGCTCA | [25] |
| β-actin FW | AGAGGGAAATCGTGCGTGAC | [25] |
| β-actin RV | CAATAGTGATGACCTGGCCGT | [25] |
| Group (N = 125) | Strain | Route | Dosage (CFU/100 μL) | Observation | Sample Collection |
|---|---|---|---|---|---|
| A (n = 30) | PBS | IM | 1 × 107 | Mortality and body weight measurement | 3, 5, 7, 14, and 21 dpi |
| B (n = 30) | JOL401 | IM | 1 × 107 | ||
| C (n = 30) | JOL2669 | IM | 1 × 107 | ||
| D (n = 30) | JOL2670 | IM | 1 × 107 | ||
| E (n = 5) | Naïve | - | - |
| Group (N = 75, n = 15) | Strain | Route | Dosage (CFU/100 μL) | Booster |
|---|---|---|---|---|
| A | PBS | IM | 1 × 107 | 2nd week post-primary vaccination (1 × 107 CFU/100 μL, IM) |
| B | JOL2865 | IM | 1 × 107 | |
| C | JOL2669 | IM | 1 × 107 | |
| D | JOL2670 | IM | 1 × 107 | |
| E | Naïve | - | - |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2026 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license.
Share and Cite
Hewawaduge, C.; Park, J.-Y.; Cabarles, J.C., Jr.; Won, G.; Lee, J.H. SFV Replicon Vector Harbouring Porcine Epidemic Diarrhoea Virus Immunogens Delivered by Attenuated Salmonella Typhimurium Induces PEDV Neutralising Antibodies and Lactogenic Immunogenicity in BALB/c Mice. Viruses 2026, 18, 375. https://doi.org/10.3390/v18030375
Hewawaduge C, Park J-Y, Cabarles JC Jr., Won G, Lee JH. SFV Replicon Vector Harbouring Porcine Epidemic Diarrhoea Virus Immunogens Delivered by Attenuated Salmonella Typhimurium Induces PEDV Neutralising Antibodies and Lactogenic Immunogenicity in BALB/c Mice. Viruses. 2026; 18(3):375. https://doi.org/10.3390/v18030375
Chicago/Turabian StyleHewawaduge, Chamith, Ji-Young Park, Jaime C. Cabarles, Jr., Gayeon Won, and John Hwa Lee. 2026. "SFV Replicon Vector Harbouring Porcine Epidemic Diarrhoea Virus Immunogens Delivered by Attenuated Salmonella Typhimurium Induces PEDV Neutralising Antibodies and Lactogenic Immunogenicity in BALB/c Mice" Viruses 18, no. 3: 375. https://doi.org/10.3390/v18030375
APA StyleHewawaduge, C., Park, J.-Y., Cabarles, J. C., Jr., Won, G., & Lee, J. H. (2026). SFV Replicon Vector Harbouring Porcine Epidemic Diarrhoea Virus Immunogens Delivered by Attenuated Salmonella Typhimurium Induces PEDV Neutralising Antibodies and Lactogenic Immunogenicity in BALB/c Mice. Viruses, 18(3), 375. https://doi.org/10.3390/v18030375

