Next Article in Journal
Tracing SARS-CoV-2 Evolution in Algeria: Insights from 2020 to 2023
Previous Article in Journal
Assessment of Functional Antibody Responses Induced by Tembusu Virus Vaccines Using a Blocking ELISA
Previous Article in Special Issue
Interactions of Dengue Virus NS5 and NS3 with the 3′ End of Its Negative-Strand RNA
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Viruses
Volume 18
Issue 2
10.3390/v18020257
viruses-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

1′- and 4′-Cyano Modified Adenosine Analogs Against Prototypic Flavivirus RNA-Dependent RNA Polymerases

by
Simon M. Walker
1,
Calvin J. Gordon
1,
Egor P. Tchesnokov
1,
Long Sun
2,
Jing Zou
2,
Xuping Xie
2,
Nicholas C. Riola
3,
Vincent Cutillas
3,
Venice Du Pont
3,
Xiaofeng Zhao
3,
Ting Wang
3,
Jared Pitts
3,
Dustin S. Siegel
3,
Jason K. Perry
3,
Joy Y. Feng
3,
John P. Bilello
3 and
Matthias Götte
1,*
1
Department of Medical Microbiology and Immunology, Faculty of Medicine and Dentistry, University of Alberta, Edmonton, AB T6G 2E1, Canada
2
Department of Microbiology and Immunology, University of Texas Medical Branch, Galveston, TX 77555, USA
3
Gilead Sciences, Inc., Foster City, CA 94404, USA
*
Author to whom correspondence should be addressed.
Viruses 2026, 18(2), 257; https://doi.org/10.3390/v18020257
Submission received: 5 December 2025 / Revised: 3 February 2026 / Accepted: 7 February 2026 / Published: 18 February 2026
(This article belongs to the Special Issue The Structure and Function of Flavivirus Genes and Proteins)
Browse Figures
Versions Notes

Abstract

Flaviviruses are arthropod-borne RNA viruses associated with significant human diseases globally. There are no effective direct-acting antivirals approved to treat these viral infections. Given its critical role in viral replication, the RNA-dependent RNA polymerase (RdRp) is a logical target for antiviral drug development. Remdesivir (formerly GS-5734), a 1′-cyano modified C-adenosine monophosphate prodrug, was the first US Food and Drug Administration (FDA) approved antiviral for coronavirus disease 2019 (COVID-19) and was also shown to inhibit flavivirus replication. GS-7682, a 4′-cyano modified C-adenosine prodrug, exhibits a broad-spectrum antiviral activity. Here, we determined the anti-flavivirus potency of both remdesivir and GS-7682 and characterized their active triphosphate forms, GS-443902 and GS-646939, respectively, against a panel of purified flavivirus RdRps. These include dengue, Japanese encephalitis, West Nile, yellow fever, and Zika. Enzyme kinetics demonstrate efficient RNA incorporation of GS-443902 and GS-646939. GS-646939 acts as an immediate chain terminator. Conversely, GS-443902 acts through a template-dependent inhibition mechanism by impeding the incorporation of the complementary UTP. Both mechanisms correlate with anti-flavivirus activity, although remdesivir is generally superior. The data demonstrate that immediate chain termination is not necessarily a preferred mechanism of action of nucleotide analogs. Template-dependent inhibition should also be considered, especially for viruses lacking intrinsic proofreading activities.

1. Introduction

Flaviviruses are positive-sense, single-stranded RNA viruses associated with human diseases worldwide [1,2]. Important pathogens include dengue virus (DENV), Japanese encephalitis virus (JEV), West Nile virus (WNV), yellow fever virus (YFV), and Zika virus (ZIKV). The transmission of these flaviviruses is sustained in a zoonotic cycle between mosquito vectors and several mammalian hosts, including pigs, birds, and non-human primates. Cumulatively, these viruses infect over 400 million people annually, with more than 95% of these cases attributed to DENV infection [2,3]. These viruses can cause a variety of severe and life-threatening conditions, including meningitis, encephalitis, hepatic failure, febrile syndrome, and congenital abnormalities [2,3]. Vaccines are available against DENV, JEV, and YFV. However, their utility is limited for several reasons, including poor coverage of genotypes, constraints in production and distribution, and antibody-dependent enhancement (ADE) of disease [2,4,5,6]. Efficient direct-acting antivirals for the treatment of flavivirus infections are currently not approved. The viral RNA-dependent RNA polymerase (RdRp) is essential for viral replication, thus presenting a logical target for therapeutic intervention strategies. Nucleotide analogs represent a class of antivirals that target the RdRp catalytic site. The active triphosphate (TP) form of nucleosides can compete with natural nucleoside triphosphate (NTP) pools for incorporation into nascent RNA strands. Sugar moiety modifications can cause a range of inhibitory effects depending on the specific chemical nature and the polymerase target [7,8,9].
Much of the pre-clinical data on nucleoside analogs against flaviviruses is focused on modifications of the 2′ position. Sofosbuvir (SOF), a 2′-C-methyl modified nucleoside prodrug approved for treatment of the related hepatitis C virus (HCV), acts as a non-obligate chain terminator targeting the RdRp. HCV is a hepacivirus and a member of the Flaviviridae family, thus possessing an RdRp that is structurally homologous to that of flaviviruses [10,11]. Recent studies have demonstrated SOF’s antiviral efficacy against several insect-borne flaviviruses both in vitro and in vivo [12,13,14,15]. However, clinical data from human trials are lacking. 2′-acetylene-7-deaza-adenosine (NITD008) was developed to inhibit DENV RdRp [16,17]. Similar to SOF, the incorporation of NITD008 promotes the termination of RNA synthesis, exhibiting potent antiviral effects against flaviviruses in vitro and in vivo. However, NITD008 failed to progress beyond pre-clinical studies due to toxicities [16]. Numerous other 2′ modified nucleoside analogs have also undergone pre-clinical investigation against the flaviviruses [18].
Nucleoside analogs with modifications at the 1′ position have been considered as well. Remdesivir (RDV) is a 1′-cyano modified C-adenosine monophosphate prodrug (Figure 1A) [19] derived from the parent nucleoside GS-441524 (Figure 1B). RDV was the first antiviral to receive Food and Drug Administration (FDA) approval for the treatment of COVID-19, caused by severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) [20]. In cell culture, RDV has demonstrated broad-spectrum antiviral activity against several positive-sense RNA viruses and non-segmented negative-sense RNA viruses [19,21,22,23,24,25,26]; however, RDV does not show significant antiviral activity against influenza viruses, Lassa virus, or Crimean–Congo hemorrhagic fever virus [22,26]. Importantly, the half maximal effective concentration (EC50) of RDV required to inhibit flavivirus replication in cell culture proved to be in the sub-to-low micromolar range [26]. The incorporation of RDV in its active triphosphate form, herein referred to as GS-443902 (Figure 1C), by the SARS-CoV-2 polymerase outcompetes its natural counterpart adenosine triphosphate (ATP), approximately 2- to 3-fold [27,28]. A steric clash between the 1′-CN of the incorporated RDV-monophosphate (MP) and S861 in non-structural protein (Nsp) 12 results in delayed chain termination [29,30,31]. This inhibitory effect can be overcome at increased NTP concentrations, yielding viral genome copies that contain GS-443902 residues. Subsequently, embedded GS-443902 can inhibit RNA synthesis through a template-dependent mechanism [29]. Previous work has demonstrated that HCV is susceptible to RDV in cell culture [19,26]. Upon investigation, HCV readily incorporated GS-443902; however, no significant inhibition of primer extension reactions was observed [32]. Instead, the termination of RNA synthesis solely relied on a template-dependent mechanism of inhibition. Similarly, the incorporation of GS-443902 by flavivirus RdRps does not result in the termination of RNA synthesis [33]. Despite these observations and the relationship between HCV and flaviviruses, a detailed mechanism of inhibition for GS-443902 against the flaviviruses has yet to be elucidated.
Modifications at the 4′ position have also been associated with antiviral effects against flaviviruses. Balapiravir, a 4′-azidocytidine analog originally developed for HCV, was also explored against DENV [34]. Although treatment demonstrated favorable pharmacokinetics, balapiravir failed to exhibit antiviral potency in a clinical trial. GS-7682 is a 4′-cyano modified C-adenosine analog (Figure 1D) derived from the parent nucleoside GS-646089 (Figure 1E). GS-7682 is likewise associated with a broad spectrum of antiviral activities against multiple viruses, demonstrating its strongest in vitro potency against viruses belonging to the Pneumoviridae and Picornaviridae families [35]. Previously, our group characterized the mechanism of action of the active triphosphate form of GS-7682, herein denoted as GS-646939 (Figure 1F), against several respiratory RNA virus polymerases, providing biochemical explanations for the observed antiviral activity in vitro [36]. However, the antiviral efficacy of GS-7682 and the biochemical mechanism of GS-646939 against flaviviruses have not been explored. Given the prevalence of flavivirus infections and the absence of approved antivirals targeting flaviviruses, a detailed characterization of the 1′-CN and 4′-CN modified nucleotide analogs could contribute to a critical gap in targeted anti-flaviviral drug development. Here, we demonstrate that the 1′-CN and 4′-CN modified nucleotide analogs exhibit different antiviral efficacies against the flaviviruses. This discrepancy may be attributable to their distinct mechanisms of action, providing insights that could support the development of novel antivirals targeting flavivirus RdRps.

2. Materials and Methods

2.1. Viruses

Stable nanoluciferase (Nluc) reporter flaviviruses were generated following a previously described protocol [37]. The study utilized the following viral strains: dengue virus 2 (DENV-2, New Guinea C strain), Japanese encephalitis virus (JEV, 14-14-2 strain 1454), West Nile virus (WNV, NY99 strain), yellow fever virus (YFV, 17D strain YFS11), and Zika virus (ZIKV, Dakar 41525 strain).

2.2. Antiviral Assay

Huh7 human hepatocarcinoma cells (1.2 × 104 cells/well, obtained from the lab of Dr. Charles Rice at Rockefeller University, New York, NY, USA) were seeded in white opaque 96-well plates (Corning, Kennebunk, ME, USA). The following day, cells were infected with Nluc reporter flaviviruses at a multiplicity of infection (MOI) of 0.01–0.1 in the presence of 3-fold serially diluted inhibitors. Cells treated with 0.5% DMSO served as controls. At 48 h post-infection, luciferase activity was measured using the NanoGlo substrate (Promega, Madison, WI, USA) according to the manufacturer’s protocol. Luminescence signals were normalized to those of the DMSO-treated wells, and EC50 values were determined using a four-parameter nonlinear regression model in GraphPad Prism 10 (GraphPad Software, Inc., Boston, MA, USA).

2.3. In Vitro Metabolism

Huh7 cells were seeded in a 12-well plate at 1.5 × 105 cells per well. After 24 h, cell culture medium was replaced with medium containing 1 µM of compound (RDV or GS-7682) and incubated at 37 °C with 5% CO2. After compound addition, cells were then harvested at timepoints of 2, 4, 8, 24, 48, and 72 h, by being washed 3 times with ice-cold tris-buffered saline, scraped into 0.5 mL of ice-cold 70% MeOH, and stored at −80 °C. Extracts were centrifuged at 15,000× g for 15 min, and the supernatants were transferred to clean tubes for evaporation using a miVac Duo concentrator (Genevac, Painter, NY, USA). The dried samples were reconstituted in ammonium dihydrogen phosphate (pH ~7). The LC-MS/MS analysis used a multistage linear gradient from 10% to 50% acetonitrile in mobile phase A, which contained 3 mM ammonium formate (pH 5) and 10 mM dimethylhexylamine in water, at a flow rate of 300 μL/min. Analytes were separated on a 50 × 2 mm, 2.5 μm Luna C18(2) HST column (Phenomenex, Torrance, CA, USA) connected to an LC-40D UHPLC system (Shimadzu, Kyoto, Japan). Detection was performed with a Qtrap 6500+ (AB Sciex, Redwood City, CA, USA) mass spectrometer operating in positive ion mode for GS-443902 and negative mode for GS-646939. Quantification relied on a 6-point standard curve prepared in blank matrices spanning 3 orders of magnitude.

2.4. Nucleic Acids and Chemicals

RNA primers and templates used in this study were 5′-phosphorylated and purchased from Dharmacon (Lafayette, CO, USA). GS-646939 and GS-443902 were provided by Gilead Sciences (Foster City, CA, USA). NTPs were purchased from GE Healthcare (Mississauga, ON, Canada). [α-32P] GTP was purchased from PerkinElmer (Revvity, Waltham, MA, USA).

2.5. Expression and Purification of Viral Polymerases

Full-length YFV NS5 was expressed and purified as previously described [38]. DENV-2, JEV, and ZIKV were expressed in insect cells (Sf9, Invitrogen) using the MultiBac (Geneva Biotech, Indianapolis, IN, USA) [39,40], whereby the pFastBac-1 (Invitrogen, Burlington, ON, Canada) plasmid contained the codon-optimized synthetic DNA sequences (GenScript, Piscataway, NJ, USA) coding for full-length NS5 from DENV-2 (AAK67712.1 polyprotein, residues 2492-3391), JEV (NP_775674.1), and ZIKV (ALU33341 polyprotein, residues 2526-3416). The C-terminal residues 3417–3423 for ZIKV were removed. The pET-15b (Novagen) plasmid with codon-optimized synthetic DNA sequences (GenScript, Piscataway, NJ, USA) coding for full-length WNV NS5 (YP_001527887.1) was expressed in Escherichia coli. DENV-2, JEV, WNV, and YFV NS5 were purified using Ni-NTA affinity chromatography based on their respective 8×histidine tag according to the manufacturer’s specifications (Thermo Scientific, Rockford, IL, USA). ZIKV NS5 was purified using strep-tag-affinity chromatography, according to the manufacturer’s specifications (IBA, Goettingen, Germany). The identity of the purified proteins was confirmed by mass spectrometry analysis (Dr. Jack Moore, Alberta Proteomics and Mass Spectrometry, Edmonton, AB, Canada).

2.6. Evaluation of GS-443902 and GS-646939 Incorporation and Subsequent Primer- and Template-Strand Inhibition on Viral RNA Synthesis

The following synthetic 5′-monophosphorylated RNA templates were used in this study (the portion of the template that is complementary to the 4-nucleotide (nt) primer is underlined): analog selectivity, pattern of inhibition, and inhibition at position i + 1 experiments for all enzymes were performed using 3′UGCGCUAGAAAAAAp. 3′UGCGCUUUUUAAAAAAAAAAp, 3′UGCGCUUUUUG443AAAAAAAAp, and 3′UGCGCUUUUUG646AAAAAAAAp were used for the evaluation of nucleotide incorporation opposite an embedded GS-443902 and GS-646939, respectively. RNA synthesis assays of viral RdRps, data acquisition, and quantification were performed as previously reported by us [36,41]. For experiments determining Vmax and Km, the viral RdRp concentrations (350 nM DENV-2, 380 nM JEV, 390 nM WNV, 1000 nM YFV, and 150 nM ZIKV) and the timepoint for each reaction were optimized to ensure incorporation of [α-32P]-GTP and ATP is within the linear range of product formation. For evaluation of single-nucleotide incorporation, the concentration range of ATP, GS-443902, and GS-646939 was optimized to avoid misincorporation at subsequent positions. Reaction mixtures for RNA synthesis assays (final concentrations after mixing in 15 µL reactions) contain the purified viral RdRps, Tris–HCl (pH 8, 25 mM), RNA primer (200 μM), RNA template (2 μM), [α-32P]-GTP (0.1 µM), and various nucleotide concentrations were prepared on ice and incubated at 30 °C for 5 to 10 min. RNA synthesis was initiated by the addition of 5 mM MgCl2 for reactions containing DENV-2, JEV, WNV, and YFV NS5. RNA synthesis performed by ZIKV NS5 was initiated by the addition of 2.5 mM MnCl2. The duration of DENV-2, JEV, WNV, and ZIKV reactions was 10 min, while YFV reactions were 20 min. The reactions were stopped after the given durations by the addition of an equal volume of formamide/EDTA (50 mM) mixture and incubated at 95 °C for 5 min. The 3 µL reaction samples were then resolved by 20% polyacrylamide gel electrophoresis (PAGE) containing 8 M urea, 89 mM Tris base, 89 mM boric acid, and 2 mM EDTA, using 1×TBE running buffer. The [α-32P] generated signal was then stored and scanned using phosphorimager screens. To calculate selectivity, the fraction of RNA synthesis products generated at position 6 out of the total signal in the lane (5-nt and 6-nt products) was determined and plotted against the concentration of the nucleotide or nucleotide analog. To calculate incorporation efficiency at position i + 1, the sum of RNA synthesis products generated at position 7 and beyond was divided by the total signal in the lane (all RNA synthesis products generated in a given lane) and plotted against the concentration of UTP. The data were analyzed using GraphPad Prism 10 (GraphPad Software, Inc., Boston, MA, USA). To calculate template inhibition, the sum of RNA synthesis products generated beyond position 10 was divided by the total signal in the lane and normalized as a percentage to the highest product fraction observed for that template. This was then plotted against the concentration of UTP. The ratio of UTP concentrations at which 50% of RNA products are generated is beyond position 10 for template A and R generated fold-inhibition values.

3. Results

3.1. Experimental Strategy

This study aimed to compare the antiviral profiles of RDV and GS-7682 against flaviviruses, assessing their potency in vitro while also differentiating the 1′- and 4′-cyano-driven mechanisms of inhibition for GS-443902 and GS-646939, respectively. The viruses included were DENV-2, JEV, WNV, YFV, and ZIKV. The corresponding NS5 was included to evaluate the incorporation efficiency and mechanism of action of the active triphosphate metabolites.

3.2. Anti-Flavivirus Activity and Cytotoxicity of RDV and GS-7682

To investigate the antiviral activity of RDV and GS-7682 against the selected prototypic flaviviruses, human hepatocarcinoma (Huh7) cells were infected with Nluc reporter flaviviruses and treated with the compound. RDV inhibits flavivirus replication in Huh7 cells with EC50 values of 0.063 to 0.180 µM (Table 1). The potential cytotoxicity of RDV was also evaluated in Huh7 cells by determining the half-maximal cytotoxic concentration (CC50). RDV exhibited CC50 values >10 µM. In contrast to RDV, GS-7682 inhibited flavivirus replication with weaker potency, yielding EC50 values of 2.15 to 4.57 µM (Table 1). The CC50 values for GS-7682 were >10 µM.

3.3. Active Metabolite Formation of GS-443902 and GS-646939 in Huh7 Cells

Given the differences in antiviral potencies that were observed for RDV and GS-7682, we wanted to assess the formation of their intracellular active metabolites, GS-443902 and GS-646939, respectively (Table 2). Huh7 cells were incubated with 1 µM of RDV or GS-7682, and intracellular trisphosphate levels were monitored over 72 h at various timepoints. Treatment of Huh7 cells with either prodrug yielded 27.43 pmol/106 cells and 20.43 pmol/106 cells of the intracellular triphosphates GS-443902 and GS-646939, respectively. Thus, no meaningful differences were found between the trisphosphate levels incubated with the prodrugs RDV and GS-7682, suggesting that the disparity in anti-flavivirus potency is likely not due to triphosphate formation.

3.4. Selective Incorporation of GS-443902 and GS-646939 by Flavivirus RdRp Enzymes

Next, we sought to biochemically investigate GS-443902 and GS-646939 against the full-length NS5 from several insect-borne flaviviruses. Previous studies have shown that the efficient incorporation of a nucleotide analog is an essential parameter for antiviral activity [32,36,42]. Therefore, the difference in antiviral potencies between RDV and GS-7682 could be reflected in their respective incorporation efficiencies. Here, we compared the incorporation of GS-443902 and GS-646939 to ATP (Table 3). Under steady-state conditions, the kinetic parameters Vmax and Km were used to determine the efficiency of a single incorporation event of ATP, GS-443902, and GS-646939 (see section: Evaluation of GS-443902 and GS-646939 Incorporation and Subsequent Primer- and Template-Strand Inhibition on Viral RNA Synthesis). Nucleotide incorporation was monitored in gel-based assays using short primer/templates (Figure S1) [32,41,43]. [α-32P]-GTP incorporation at position 5 enables the visualization of RNA synthesis products at single-nucleotide resolution. ATP, GS-443902, or GS-646939 is added to the reaction at increasing concentrations, facilitating incorporation at position 6, and reactions are stopped after a given amount of time after the addition of the divalent metal ion. Assays with DENV-2, JEV, WNV, and YFV RdRps use Mg2+ as a metal co-factor, whereas the ZIKV RdRp requires Mn2+ for RNA synthesis activity [44]. To compare nucleotide incorporation rates, selectivity is determined as the ratio of incorporation efficiency of ATP to each analog. A selectivity value greater than one indicates that the analog is incorporated less efficiently than its natural counterpart. Prior work determined that the HCV RdRp incorporated GS-443902 with a selectivity value of 0.93, indicating that GS-443902 and ATP are incorporated with similar efficiencies [32]. Comparatively, DENV-2, JEV, WNV, YFV, and ZIKV RdRps show selectivity values of 11.1, 6.8, 6.8, 10.4, and 6.5, respectively, demonstrating that GS-443902 is incorporated less efficiently than ATP. Similarly, GS-646939 is incorporated 7.0-, 3.4-, 5.1-, 5.8-, and 4.0-fold less efficiently than ATP by DENV-2, JEV, WNV, YFV, and ZIKV RdRps, respectively. In summary, GS-443902 and GS-646939 incorporate with similar efficiencies; however, RDV exhibits stronger antiviral potency against the flaviviruses, suggesting that flavivirus RdRps may have different threshold levels of incorporation for a given analog, which is likely influenced by the analog’s mechanism of action.

3.5. Inhibition of RNA Primer Extension Reactions

Despite the ~1.5- to ~2-fold less efficient incorporation than GS-646939 (Table 3), GS-443902 shows at least 10-fold better antiviral activity (Table 1). This apparent disconnect between the incorporation efficiencies of GS-443902 and GS-646939, and their prodrugs’ inverse patterns of antiviral potency, warrants further investigation into their mechanisms of action. To evaluate the pattern of inhibition, we employed an RNA template that facilitates a single incorporation of ATP, GS-443902, or GS-646939 at position 6 (Figure 2A). The reaction was supplemented with 1 µM of CTP and UTP, thereby providing all components required for RNA synthesis and the generation of a full-template length product. For all five flavivirus RdRps, GS-443902 does not inhibit RNA synthesis when incorporated into the primer-strand as indicated by the formation of a full-length product at position 14 (Figure 2B); however, when compared to the extension of AMP, an increased signal can be seen at the site of GS-443902 incorporation at position 6 (‘i’). These observations align with previous studies, which found that GS-443902-terminated primers can be extended by flavivirus and hepacivirus RdRps [32,33]. Conversely, GS-646939 behaves as an immediate chain terminator, preventing RNA synthesis beyond its incorporation at position “i” (Figure 2B).
Both nucleotide analogs possess a 3′-hydroxyl group, which can facilitate a nucleophilic attack and, therefore, could support subsequent nucleotide incorporation events. Therefore, we assessed the RNA synthesis patterns following GS-443902 and GS-646939 incorporation at increasing concentrations of subsequent NTPs. For GS-443902, the pattern of inhibition was similar among the flavivirus RdRps examined (Figure 3 and Figure S2). The incorporation of ATP at position “i” could be readily extended to generate 14-mer full-template length product at sub-micromolar concentrations of NTPs. Subtle product formation resulting from GS-443902 incorporation at position 6 is observed at low NTP concentrations; however, this product formation disappears as NTP concentrations are increased, and a corresponding increase in full-template length product is formed. This observation holds for DENV-2, JEV, WNV, and YFV RdRps. However, ZIKV RdRp displays a buildup of product formation at position 6, the site of GS-443902 incorporation, which is maintained across all NTP concentrations, indicating that GS-443902 does not appear to be extended as efficiently by this enzyme. We confirmed this observation in an additional experiment, where we monitored product formation at positions 5, 6, and 7 as a function of time with DENV-2 and ZIKV RdRps (Figure S3). It is conceivable that for ZIKV RdRp, GS-443902-terminated primers at position 6 may dissociate faster than subsequent nucleotide incorporation, potentially explaining the incomplete conversion of product 6 to product 7. However, it should be noted that a direct comparison of patterns of RNA synthesis of ZIKV RdRp and the other flavivirus RdRps is not possible, given the difference in the catalytic metal ions. Nonetheless, in all cases, and regardless of the metal ion provided, the incorporated GS-443902 can be extended to generate a full-length RNA product.
GS-646939 demonstrates much more robust inhibition against all five flavivirus RdRps (Figure 4 and Figure S4). Unlike ATP or GS-443902, where 1.4 µM CTP and UTP were sufficient to generate a 14-mer product, GS-646939 inhibited RNA synthesis at the site of incorporation. This effect appears to be overcome for DENV-2 and WNV RdRps when nucleotide substrate concentration was greater than 12–37 µM, as indicated by the appearance of 14-mer products. The disappearance of the signal at position 6 demonstrates that GS-646939 can be extended once nucleotide concentrations reach up to 1000 µM; no additional intermediate RNA products are observed. In contrast, the incorporation of GS-646939 at position “i” by YFV and ZIKV RdRps appears more stringent on subsequent nucleotide incorporation, with a lesser extent of RNA products generated beyond position 6. For JEV RdRp, GS-646939 incorporation results in nearly absolute immediate chain termination and is seemingly not overcome at increased nucleotide substrate concentrations.
To quantify the inhibitory effect on subsequent NTP incorporation, we measured the kinetic parameters for nucleotide incorporation events at position “i + 1” with AMP-, GS-443902-, and GS-646939-terminated primer-strands (Figure 5 and Table S3). Compared to AMP, a 3.7- to 75-fold reduction in subsequent UTP incorporation efficiency was observed following a GS-443902-terminated primer. In contrast, all flavivirus RdRps demonstrate a greater than 1000-fold reduction in UTP incorporation on a GS-646939-terminated primer. These marked differences in patterns of inhibition provide strong evidence that the primary mechanism of inhibition of GS-443902 does not pertain to the effects on the primer-strand, whereas GS-646939 acts as an immediate chain terminator.

3.6. Template-Embedded GS-443902 Demonstrates an Inhibitory Effect

The formation of a full-length template product when GS-443902 is incorporated into the growing primer-strand implies that newly synthesized flavivirus genome copies may contain analog residues embedded throughout. To assess this scenario, RNA templates were designed to monitor UTP incorporation opposite a template-embedded GS-443902-MP at position 11 (Figure 6A). For DENV-2 RdRp, on template “A” containing the natural nucleotide, full-length RNA synthesis was generated at UTP concentrations as low as 0.45 μM (Figure 6B). Under the same conditions, an embedded GS-443902 reduced full-length product formation. On template “GS-443902”, an intermediate product was observed at position 10; however, this point of inhibition can eventually be overcome with increased UTP concentration. Inhibition was quantified by comparing the signal corresponding to RNA products greater than 10 nt to the total signal in that lane to determine the product fraction. This was then normalized to the highest product fraction observed for each respective template. The normalized percentages could then be plotted against the concentration of UTP to determine the concentration required to meet the 50% inhibitory threshold. For DENV-2, relative to template “A”, template “GS-443902” required an increased UTP concentration of ~148-fold to meet the 50% threshold (Figure 6C). The investigation of JEV, WNV, YFV, and ZIKV RdRps against an embedded GS-443902 similarly revealed an inhibitory effect, with elevated UTP concentrations of ~599, ~317, ~370, and ~73-fold, respectively, required to produce 50% of RNA products made past position 10 (Table S4).
Although the full-length 14-mer product is generated following an incorporated GS-646939 at position “i” with elevated NTP concentrations, quantification of nucleotide incorporation at position “i + 1” indicates that the dominant mechanism of action is via immediate-chain termination. Due to this, it is anticipated that a template-embedded GS-646939 is an unlikely scenario for all flaviviruses; however, a previous study found that the 4′-cyano modification elicited a different pattern of inhibition compared to its 1′ counterpart against other viral RdRps [36]. Therefore, we evaluated the effects of an embedded GS-646939 residue. For DENV-2 and WNV RdRps, RNA synthesis opposite GS-646939 generates an intermediate product at position 10, indicative of an inhibitory effect (Figure S5).
To conclude, GS-443902 and GS-646939 display distinct mechanisms of action against flavivirus RdRps. GS-443902 does not display significant inhibitory effects when incorporated into the primer-strand; however, its antiviral effect is evident when acting as a templating base. In contrast, GS-646939 acts via immediate chain termination. Together, these distinct mechanisms may provide a reason for their difference in anti-flaviviral potency and be exploited for future drug development efforts.

4. Discussion

Nucleoside analogs have long shown promise as an effective antiviral drug strategy, particularly against significant viruses like HIV, HCV, and SARS-CoV-2. Currently, infections with HCV are successfully treated by multidrug therapies including sofosbuvir [45,46]. Despite their significant impact on global human health and the extensive research into analogs targeting the phylogenetically related HCV, there are currently still no approved antivirals for flavivirus infection. Here, we studied the antiviral potency of remdesivir (RDV), a 1ʹ-cyano modified C-adenosine nucleotide monophosphate prodrug, and GS-7682, a 4ʹ-cyano modified C-adenosine nucleotide phosphoramidate analog, and the mechanisms of action of their active nucleotide triphosphate metabolites, GS-443902 and GS-646939, respectively.
For each flavivirus polymerase investigated in this study, the selectivity data demonstrate that GS-646939 is more efficiently incorporated than GS-443902 by roughly 1.5- to 2-fold, albeit both analogs efficiently compete with ATP. Both GS-443902 and GS-646939 act as poor substrates for the h-mtRNAP, with selectivity values of 508 and >1000, respectively [36,41]. Poor incorporation by h-mtRNAP is indicative of low cytotoxicity, which aligns with our observed CC50 values.
GS-443902 has a heterogeneous effect on primer-strand RNA synthesis that is largely dependent on the nature of the viral polymerase [32,36]. In the case of picorna-, corona-, filo-, pneumo-, and paramyxovirus RdRps, GS-443902 displays a delayed chain termination effect; however, the extent and position of this inhibition vary. In the case of HCV RdRp, GS-443902 causes slight inhibition at the site of incorporation, but this effect is easily overcome at the low concentrations of NTPs required to generate a full-template length product [32]. Similarly, the flavivirus RdRps all display subtle inhibition immediately upon incorporation (i) when GS-443902 is incorporated, which is overcome at low NTP concentrations to generate full-length template products [33]. To this end, GS-443902 demonstrates a uniform mechanism of inhibition against the flavivirus RdRps by impairing UTP incorporation when embedded in the template-strand. This template-dependent effect is likely due to the conserved RdRp motif F, rather than a virus-specific residue, as previously described [32]. While this effect can be overcome at elevated NTP concentrations, due to sufficient incorporation rates, this mechanism could describe the sub-micromolar EC50 values observed for RDV against flaviviruses.
GS-646939 acts as an immediate chain terminator. Chain termination with the JEV RdRp appears nearly absolute, whereas increasing NTP concentrations allow the continuation of RNA synthesis against the other flavivirus RdRps, as indicated by the generation of full-template length products. A template-embedded GS-646939 is not anticipated, given the poor efficiency of nucleotide incorporation following GS-646939. Interestingly, the processivity of JEV RdRp appears diminished relative to the flaviviruses, as indicated by a much lower Vmax and Km for nucleotide incorporation. Perhaps the JEV RdRp is less efficient overall, owing to the pronounced termination of GS-646939.
Although GS-443902 and GS-646939 demonstrate similar efficiencies of incorporation by the flavivirus RdRp, the antiviral potency of their prodrugs (RDV and GS-7682, respectively) differ significantly. RDV exhibits EC50 values in the sub-micromolar range (0.063–0.18 µM), whereas GS-7682 shows EC50 values ranging from 2.15 to 4.57 µM.
While analog incorporation efficiency often correlates with antiviral potency, this relationship is multifaceted and therefore influenced by many factors. To determine if this effect was mediated by a disparity in analog bioavailability, the intracellular concentrations of both GS-443902 and GS-646939 were measured over 72 h in Huh7 cells treated with the prodrugs RDV and GS-7682, respectively. We observed similar triphosphate levels of both analogs, indicating that triphosphate formation was likely not the reason for the differences in antiviral potency. This discrepancy between the efficiency of single nucleotide incorporation and antiviral potency suggests that flavivirus RdRps have different threshold levels of incorporation for a given analog, which is influenced by the analog’s mechanism of action and potentially other external factors.
Previously, GS-7682 activity against SARS-CoV-2 presented a similar example of when incorporation efficiency alone did not dictate antiviral efficacy [36]. Modeling and biochemical analysis showed that GS-646939 may elicit its immediate chain termination by hindering translocation once incorporated. Therefore, despite efficient incorporation by the SARS-CoV-2 RdRp, preventing translocation would provide ample opportunity for the exonuclease to access the incorporated GS-646939, resulting in its weaker antiviral activity. While flavivirus RdRps do not possess intrinsic nuclease properties, factors like pyrophosphorolysis and nucleotide-mediated excision of chain-terminating analogs could reduce an analog’s efficacy, as was observed with the closely related HCV [47,48]. Therefore, inhibition caused by chain-terminating nucleotide analogs is vulnerable to excision, thus potentially limiting their antiviral capacity. By contrast, GS-443902 elicits its inhibitory effect through a template-dependent mechanism, which is not susceptible to excision. Despite the similar incorporation efficiencies of the two analogs, the mechanism of action plays a prominent role in eliciting an antiviral effect. These results highlight the intricate relationship between biochemical and cell-based assays, emphasizing the need to consider both approaches in the evaluation of novel nucleotide analogs and their mechanisms of action. While most previous studies in the field focused on the inhibition of primer extension reactions, this study highlights the importance of template-dependent inhibition and its consideration in subsequent antiviral therapeutic development efforts.

5. Limitations and Bias

Experimentally, this study relies on the use of Huh7 cells for the evaluation of the metabolism and antiviral potency of RDV and GS-7682, which may not completely and adequately reflect the nature of these compounds in an in vivo setting. Also, benchmarks such as sofosbuvir were not included in this study, given the differences in base moieties. Moreover, direct comparison of patterns of inhibition between ZIKV and the other flavivirus RdRps is limited due to the different requirements for metal cofactors.

Supplementary Materials

The following supporting information can be downloaded at https://www.mdpi.com/article/10.3390/v18020257/s1, Table S1: Selectivity values for GS-443902 against flavivirus RdRps; Table S2: Selectivity values for GS-646939 against flavivirus RdRps; Table S3: Inhibitory effect of the incorporated analog–monophosphate on the incorporation of the subsequent nucleotide; Table S4: Inhibitory effect of templated RDV-MP against JEV, WNV, YFV, and ZIKV RdRps; Figure S1: Selective incorporation of GS-646939 and GS-443902; Figure S2: WNV, YFV, and ZIKV RdRp-catalyzed RNA synthesis and inhibition patterns following incorporation of a single GS-443902; Figure S3: Product formation over time following ATP or GS-443902 incorporation by DENV-2 and ZIKV RdRps; Figure S4: WNV, YFV, and ZIKV RdRp-catalyzed RNA synthesis and inhibition patterns following incorporation of a single GS-646939; Figure S5: Template-dependent inhibition of DENV-2 and WNV RdRps by a single embedded GS-646939 residue at position 11.

Author Contributions

Conceptualization: S.M.W. and M.G.; methodology: S.M.W., C.J.G., E.P.T., L.S., J.Z. and J.P.; validation: S.M.W., C.J.G., E.P.T., V.D.P., J.P., T.W. and M.G.; formal analysis: S.M.W., C.J.G. and J.Z.; investigation: S.M.W., C.J.G.; L.S., J.Z., N.C.R., V.C. and X.Z.; resources: X.X. and M.G.; data curation: S.M.W., V.D.P. and J.P.; writing—original draft: S.M.W. and M.G.; writing—review and editing: S.M.W., C.J.G., E.P.T., L.S., J.Z., X.X., J.P., D.S.S., J.K.P., J.Y.F., J.P.B. and M.G.; visualization: S.M.W.; supervision: X.X., T.W., J.P., J.P.B. and M.G.; project administration: M.G.; funding acquisition: M.G. All authors have read and agreed to the published version of the manuscript.

Funding

This study was supported by grants to M.G. from Gilead Sciences, Inc., the Alberta Ministry of Technology and Innovation through SPP-ARC (Striving for Pandemic Preparedness—The Alberta Research Consortium) and by the National Institute of Allergy and Infectious Diseases of the National Institutes of Health under Award Number U19AI171292. The content is solely the responsibility of the authors and does not necessarily represent the official views of the National Institutes of Health.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The original contributions presented in this study are included in the article/Supplementary Materials. Further inquiries can be directed to the corresponding author.

Acknowledgments

The authors would like to thank Dana Kocincova and Emma Woolner for their excellent efforts and expertise with the expression of recombinant proteins, as well as Jack Moore at the Alberta Proteomics and Mass Spectrometry facility for the mass spectrometry analysis.

Conflicts of Interest

M.G. and X.X. received funding from Gilead Sciences, Inc. for the mechanistic studies and cellular-based potency of compounds included in this study. N.C.R., V.C., V.D.P., X.Z., T.W., J.P., D.S., J.K.P., J.Y.F. and J.P.B. are employees of Gilead Sciences, Inc. and may hold stock in Gilead Sciences, Inc.

References

  1. Zhao, R.; Wang, M.; Cao, J.; Shen, J.; Zhou, X.; Wang, D.; Cao, J. Flavivirus: From Structure to Therapeutics Development. Life 2021, 11, 615. [Google Scholar] [CrossRef] [PubMed]
  2. Pierson, T.C.; Diamond, M.S. The continued threat of emerging flaviviruses. Nat. Microbiol. 2020, 5, 796–812. [Google Scholar] [CrossRef] [PubMed]
  3. Bhatt, S.; Gething, P.W.; Brady, O.J.; Messina, J.P.; Farlow, A.W.; Moyes, C.L.; Drake, J.M.; Brownstein, J.S.; Hoen, A.G.; Sankoh, O.; et al. The global distribution and burden of dengue. Nature 2013, 496, 504–507. [Google Scholar] [CrossRef] [PubMed]
  4. Montalvo Zurbia-Flores, G.; Rollier, C.S.; Reyes-Sandoval, A. Re-thinking yellow fever vaccines: Fighting old foes with new generation vaccines. Hum. Vaccines Immunother. 2022, 18, 1895644. [Google Scholar] [CrossRef]
  5. Gardner, C.L.; Ryman, K.D. Yellow fever: A reemerging threat. Clin. Lab. Med. 2010, 30, 237–260. [Google Scholar] [CrossRef]
  6. Shukla, R.; Ramasamy, V.; Shanmugam, R.K.; Ahuja, R.; Khanna, N. Antibody-Dependent Enhancement: A Challenge for Developing a Safe Dengue Vaccine. Front. Cell Infect. Microbiol. 2020, 10, 572681. [Google Scholar] [CrossRef]
  7. Jordheim, L.P.; Durantel, D.; Zoulim, F.; Dumontet, C. Advances in the development of nucleoside and nucleotide analogues for cancer and viral diseases. Nat. Rev. Drug Discov. 2013, 12, 447–464. [Google Scholar] [CrossRef]
  8. Kamzeeva, P.N.; Aralov, A.V.; Alferova, V.A.; Korshun, V.A. Recent Advances in Molecular Mechanisms of Nucleoside Antivirals. Curr. Issues Mol. Biol. 2023, 45, 6851–6879. [Google Scholar] [CrossRef]
  9. Seley-Radtke, K.L.; Yates, M.K. The evolution of nucleoside analogue antivirals: A review for chemists and non-chemists. Part 1: Early structural modifications to the nucleoside scaffold. Antivir. Res. 2018, 154, 66–86. [Google Scholar] [CrossRef]
  10. Caillet-Saguy, C.; Lim, S.P.; Shi, P.Y.; Lescar, J.; Bressanelli, S. Polymerases of hepatitis C viruses and flaviviruses: Structural and mechanistic insights and drug development. Antivir. Res. 2014, 105, 8–16. [Google Scholar] [CrossRef]
  11. Dubankova, A.; Boura, E. Structure of the yellow fever NS5 protein reveals conserved drug targets shared among flaviviruses. Antivir. Res. 2019, 169, 104536. [Google Scholar] [CrossRef]
  12. de Freitas, C.S.; Higa, L.M.; Sacramento, C.Q.; Ferreira, A.C.; Reis, P.A.; Delvecchio, R.; Monteiro, F.L.; Barbosa-Lima, G.; James Westgarth, H.; Vieira, Y.R.; et al. Yellow fever virus is susceptible to sofosbuvir both in vitro and in vivo. PLoS Negl. Trop. Dis. 2019, 13, e0007072. [Google Scholar] [CrossRef] [PubMed]
  13. Bullard-Feibelman, K.M.; Govero, J.; Zhu, Z.; Salazar, V.; Veselinovic, M.; Diamond, M.S.; Geiss, B.J. The FDA-approved drug sofosbuvir inhibits Zika virus infection. Antivir. Res. 2017, 137, 134–140. [Google Scholar] [CrossRef] [PubMed]
  14. Xu, H.T.; Colby-Germinario, S.P.; Hassounah, S.A.; Fogarty, C.; Osman, N.; Palanisamy, N.; Han, Y.; Oliveira, M.; Quan, Y.; Wainberg, M.A. Evaluation of Sofosbuvir (beta-D-2′-deoxy-2′-alpha-fluoro-2′-beta-C-methyluridine) as an inhibitor of Dengue virus replication. Sci. Rep. 2017, 7, 6345. [Google Scholar] [CrossRef] [PubMed]
  15. Dragoni, F.; Boccuto, A.; Picarazzi, F.; Giannini, A.; Giammarino, F.; Saladini, F.; Mori, M.; Mastrangelo, E.; Zazzi, M.; Vicenti, I. Evaluation of sofosbuvir activity and resistance profile against West Nile virus in vitro. Antivir. Res. 2020, 175, 104708. [Google Scholar] [CrossRef]
  16. Yin, Z.; Chen, Y.L.; Schul, W.; Wang, Q.Y.; Gu, F.; Duraiswamy, J.; Kondreddi, R.R.; Niyomrattanakit, P.; Lakshminarayana, S.B.; Goh, A.; et al. An adenosine nucleoside inhibitor of dengue virus. Proc. Natl. Acad. Sci. USA 2009, 106, 20435–20439. [Google Scholar] [CrossRef]
  17. Yan, L.; Cao, R.; Zhang, H.; Li, Y.; Li, W.; Li, X.; Fan, S.; Li, S.; Zhong, W. Design, synthesis and evaluation of 2′-acetylene-7-deaza-adenosine phosphoamidate derivatives as anti-EV71 and anti-EV-D68 agents. Eur. J. Med. Chem. 2021, 226, 113852. [Google Scholar] [CrossRef]
  18. Eyer, L.; Nencka, R.; de Clercq, E.; Seley-Radtke, K.; Ruzek, D. Nucleoside analogs as a rich source of antiviral agents active against arthropod-borne flaviviruses. Antivir. Chem. Chemother. 2018, 26, 2040206618761299. [Google Scholar] [CrossRef]
  19. Siegel, D.; Hui, H.C.; Doerffler, E.; Clarke, M.O.; Chun, K.; Zhang, L.; Neville, S.; Carra, E.; Lew, W.; Ross, B.; et al. Discovery and Synthesis of a Phosphoramidate Prodrug of a Pyrrolo [2,1-f][triazin-4-amino] Adenine C-Nucleoside (GS-5734) for the Treatment of Ebola and Emerging Viruses. J. Med. Chem. 2017, 60, 1648–1661. [Google Scholar] [CrossRef]
  20. U.S. Food and Drug Administration Approves Gilead’s Antiviral Veklury® (Remdesivir) for Treatment of COVID-19. 2020. Available online: https://www.gilead.com/news/news-details/2020/us-food-and-drug-administration-approves-gileads-antiviral-veklury-remdesivir-for-treatment-of-covid-19 (accessed on 4 December 2025).
  21. Mackman, R.L.; Hui, H.C.; Perron, M.; Murakami, E.; Palmiotti, C.; Lee, G.; Stray, K.; Zhang, L.; Goyal, B.; Chun, K.; et al. Prodrugs of a 1′-CN-4-Aza-7,9-dideazaadenosine C-Nucleoside Leading to the Discovery of Remdesivir (GS-5734) as a Potent Inhibitor of Respiratory Syncytial Virus with Efficacy in the African Green Monkey Model of RSV. J. Med. Chem. 2021, 64, 5001–5017. [Google Scholar] [CrossRef]
  22. Lo, M.K.; Jordan, R.; Arvey, A.; Sudhamsu, J.; Shrivastava-Ranjan, P.; Hotard, A.L.; Flint, M.; McMullan, L.K.; Siegel, D.; Clarke, M.O.; et al. GS-5734 and its parent nucleoside analog inhibit Filo-, Pneumo-, and Paramyxoviruses. Sci. Rep. 2017, 7, 43395. [Google Scholar] [CrossRef] [PubMed]
  23. Warren, T.K.; Jordan, R.; Lo, M.K.; Ray, A.S.; Mackman, R.L.; Soloveva, V.; Siegel, D.; Perron, M.; Bannister, R.; Hui, H.C.; et al. Therapeutic efficacy of the small molecule GS-5734 against Ebola virus in rhesus monkeys. Nature 2016, 531, 381–385. [Google Scholar] [CrossRef] [PubMed]
  24. Agostini, M.L.; Andres, E.L.; Sims, A.C.; Graham, R.L.; Sheahan, T.P.; Lu, X.; Smith, E.C.; Case, J.B.; Feng, J.Y.; Jordan, R.; et al. Coronavirus Susceptibility to the Antiviral Remdesivir (GS-5734) Is Mediated by the Viral Polymerase and the Proofreading Exoribonuclease. mBio 2018, 9, e00221-18. [Google Scholar] [CrossRef] [PubMed]
  25. Sheahan, T.P.; Sims, A.C.; Graham, R.L.; Menachery, V.D.; Gralinski, L.E.; Case, J.B.; Leist, S.R.; Pyrc, K.; Feng, J.Y.; Trantcheva, I.; et al. Broad-spectrum antiviral GS-5734 inhibits both epidemic and zoonotic coronaviruses. Sci. Transl. Med. 2017, 9, eaal3653. [Google Scholar] [CrossRef]
  26. Radoshitzky, S.R.; Iversen, P.; Lu, X.; Zou, J.; Kaptein, S.J.F.; Stuthman, K.S.; Van Tongeren, S.A.; Steffens, J.; Gong, R.; Truong, H.; et al. Expanded profiling of Remdesivir as a broad-spectrum antiviral and low potential for interaction with other medications in vitro. Sci. Rep. 2023, 13, 3131. [Google Scholar] [CrossRef]
  27. Gordon, C.J.; Tchesnokov, E.P.; Feng, J.Y.; Porter, D.P.; Gotte, M. The antiviral compound remdesivir potently inhibits RNA-dependent RNA polymerase from Middle East respiratory syndrome coronavirus. J. Biol. Chem. 2020, 295, 4773–4779. [Google Scholar] [CrossRef]
  28. Dangerfield, T.L.; Huang, N.Z.; Johnson, K.A. Remdesivir Is Effective in Combating COVID-19 because It Is a Better Substrate than ATP for the Viral RNA-Dependent RNA Polymerase. iScience 2020, 23, 101849. [Google Scholar] [CrossRef]
  29. Tchesnokov, E.P.; Gordon, C.J.; Woolner, E.; Kocinkova, D.; Perry, J.K.; Feng, J.Y.; Porter, D.P.; Gotte, M. Template-dependent inhibition of coronavirus RNA-dependent RNA polymerase by remdesivir reveals a second mechanism of action. J. Biol. Chem. 2020, 295, 16156–16165. [Google Scholar] [CrossRef]
  30. Kokic, G.; Hillen, H.S.; Tegunov, D.; Dienemann, C.; Seitz, F.; Schmitzova, J.; Farnung, L.; Siewert, A.; Hobartner, C.; Cramer, P. Mechanism of SARS-CoV-2 polymerase stalling by remdesivir. Nat. Commun. 2021, 12, 279. [Google Scholar] [CrossRef]
  31. Wu, J.; Wang, H.; Liu, Q.; Li, R.; Gao, Y.; Fang, X.; Zhong, Y.; Wang, M.; Wang, Q.; Rao, Z.; et al. Remdesivir overcomes the S861 roadblock in SARS-CoV-2 polymerase elongation complex. Cell Rep. 2021, 37, 109882. [Google Scholar] [CrossRef]
  32. Gordon, C.J.; Lee, H.W.; Tchesnokov, E.P.; Perry, J.K.; Feng, J.Y.; Bilello, J.P.; Porter, D.P.; Gotte, M. Efficient incorporation and template-dependent polymerase inhibition are major determinants for the broad-spectrum antiviral activity of remdesivir. J. Biol. Chem. 2022, 298, 101529. [Google Scholar] [CrossRef] [PubMed]
  33. Konkolova, E.; Dejmek, M.; Hrebabecky, H.; Sala, M.; Boserle, J.; Nencka, R.; Boura, E. Remdesivir triphosphate can efficiently inhibit the RNA-dependent RNA polymerase from various flaviviruses. Antivir. Res. 2020, 182, 104899. [Google Scholar] [CrossRef] [PubMed]
  34. Nguyen, N.M.; Tran, C.N.; Phung, L.K.; Duong, K.T.; Huynh Hle, A.; Farrar, J.; Nguyen, Q.T.; Tran, H.T.; Nguyen, C.V.; Merson, L.; et al. A randomized, double-blind placebo controlled trial of balapiravir, a polymerase inhibitor, in adult dengue patients. J. Infect. Dis. 2013, 207, 1442–1450. [Google Scholar] [CrossRef] [PubMed]
  35. Siegel, D.S.; Hui, H.C.; Pitts, J.; Vermillion, M.S.; Ishida, K.; Rautiola, D.; Keeney, M.; Irshad, H.; Zhang, L.; Chun, K.; et al. Discovery of GS-7682, a Novel 4′-Cyano-Modified C-Nucleoside Prodrug with Broad Activity against Pneumo- and Picornaviruses and Efficacy in RSV-Infected African Green Monkeys. J. Med. Chem. 2024, 67, 12945–12968. [Google Scholar] [CrossRef]
  36. Gordon, C.J.; Walker, S.M.; Tchesnokov, E.P.; Kocincova, D.; Pitts, J.; Siegel, D.S.; Perry, J.K.; Feng, J.Y.; Bilello, J.P.; Gotte, M. Mechanism and spectrum of inhibition of a 4 -cyano modified nucleotide analog against diverse RNA polymerases of prototypic respiratory RNA viruses. J. Biol. Chem. 2024, 300, 107514. [Google Scholar] [CrossRef]
  37. Baker, C.; Liu, Y.; Zou, J.; Muruato, A.; Xie, X.; Shi, P.Y. Identifying optimal capsid duplication length for the stability of reporter flaviviruses. Emerg. Microbes Infect. 2020, 9, 2256–2265. [Google Scholar] [CrossRef]
  38. Gordon, C.J.; Walker, S.M.; LeCher, J.C.; Amblard, F.; Schinazi, R.F.; Gotte, M. Mechanism of Inhibition of the Active Triphosphate Form of 2′-alpha-Fluoro,2′-beta-bromouridine against Yellow Fever Virus RNA-Dependent RNA Polymerase. ACS Infect. Dis. 2025, 11, 1528–1538. [Google Scholar] [CrossRef]
  39. Berger, I.; Fitzgerald, D.J.; Richmond, T.J. Baculovirus expression system for heterologous multiprotein complexes. Nat. Biotechnol. 2004, 22, 1583–1587. [Google Scholar] [CrossRef]
  40. Bieniossek, C.; Richmond, T.J.; Berger, I. MultiBac: Multigene baculovirus-based eukaryotic protein complex production. Curr. Protoc. Protein Sci. 2008, 51, 5.20.1–5.20.26. [Google Scholar] [CrossRef]
  41. Tchesnokov, E.P.; Feng, J.Y.; Porter, D.P.; Gotte, M. Mechanism of Inhibition of Ebola Virus RNA-Dependent RNA Polymerase by Remdesivir. Viruses 2019, 11, 326. [Google Scholar] [CrossRef]
  42. Fung, A.; Jin, Z.; Dyatkina, N.; Wang, G.; Beigelman, L.; Deval, J. Efficiency of incorporation and chain termination determines the inhibition potency of 2′-modified nucleotide analogs against hepatitis C virus polymerase. Antimicrob. Agents Chemother. 2014, 58, 3636–3645. [Google Scholar] [CrossRef]
  43. Gordon, C.J.; Tchesnokov, E.P.; Woolner, E.; Perry, J.K.; Feng, J.Y.; Porter, D.P.; Gotte, M. Remdesivir is a direct-acting antiviral that inhibits RNA-dependent RNA polymerase from severe acute respiratory syndrome coronavirus 2 with high potency. J. Biol. Chem. 2020, 295, 6785–6797. [Google Scholar] [CrossRef]
  44. Saez-Alvarez, Y.; Arias, A.; Del Aguila, C.; Agudo, R. Development of a fluorescence-based method for the rapid determination of Zika virus polymerase activity and the screening of antiviral drugs. Sci. Rep. 2019, 9, 5397. [Google Scholar] [CrossRef]
  45. Keating, G.M. Sofosbuvir: A review of its use in patients with chronic hepatitis C. Drugs 2014, 74, 1127–1146. [Google Scholar] [CrossRef]
  46. Gilead Sciences Inc. Sovaldi™ (Sofosbuvir) Tablets, for Oral Use: US Prescribing Information. Available online: https://www.gilead.com/-/media/files/pdfs/medicines/liver-disease/sovaldi/sovaldi_patient_pi.pdf (accessed on 4 December 2025).
  47. Deval, J.; Powdrill, M.H.; D’Abramo, C.M.; Cellai, L.; Gotte, M. Pyrophosphorolytic excision of nonobligate chain terminators by hepatitis C virus NS5B polymerase. Antimicrob. Agents Chemother. 2007, 51, 2920–2928. [Google Scholar] [CrossRef]
  48. Jin, Z.; Leveque, V.; Ma, H.; Johnson, K.A.; Klumpp, K. NTP-mediated nucleotide excision activity of hepatitis C virus RNA-dependent RNA polymerase. Proc. Natl. Acad. Sci. USA 2013, 110, E348–E357. [Google Scholar] [CrossRef]
Viruses 18 00257 g001
Figure 1. Chemical structures of the analogs discussed in this study. (A) Remdesivir (RDV, GS-5734), (B) GS-441524, (C) GS-443902, (D) GS-7682, (E) GS-646089, and (F) GS-646939.
Figure 1. Chemical structures of the analogs discussed in this study. (A) Remdesivir (RDV, GS-5734), (B) GS-441524, (C) GS-443902, (D) GS-7682, (E) GS-646089, and (F) GS-646939.
Viruses 18 00257 g001
Viruses 18 00257 g002
Figure 2. Pattern of inhibition of GS-443902 and GS-646939 against prototypic flavivirus RdRp. (A) RNA primer/template supporting a single incorporation of ATP, GS-443902, or GS-646939 at position 6 (i). G indicates incorporation of [α-32P]-GTP at position 5. (B) Migration pattern of RNA synthesis products catalyzed by DENV-2, JEV, WNV, YFV, and ZIKV RdRp. For each RdRp block of lanes, Lane 1 represents αG incorporation with no subsequent nucleotides present. Lanes 2–4, incorporation of ATP, GS-443902, and GS-646939, respectively. Lanes 5–7, extension of RNA following the incorporation of ATP, GS-443902, and GS-646939, respectively, when reactions were supplemented with CTP and UTP. Lane 8, when ATP, GS-443902, and GS-646939 are omitted from the reaction; misincorporation is not evident. Pink arrows point to 6-mer product, indicating incorporated nucleotide at position 6. Green arrows point to 14-mer product, indicating full-template length product formation. DENV-2, dengue virus; JEV, Japanese encephalitis virus; WNV, West Nile virus; YFV, yellow fever virus; ZIKV, Zika virus.
Figure 2. Pattern of inhibition of GS-443902 and GS-646939 against prototypic flavivirus RdRp. (A) RNA primer/template supporting a single incorporation of ATP, GS-443902, or GS-646939 at position 6 (i). G indicates incorporation of [α-32P]-GTP at position 5. (B) Migration pattern of RNA synthesis products catalyzed by DENV-2, JEV, WNV, YFV, and ZIKV RdRp. For each RdRp block of lanes, Lane 1 represents αG incorporation with no subsequent nucleotides present. Lanes 2–4, incorporation of ATP, GS-443902, and GS-646939, respectively. Lanes 5–7, extension of RNA following the incorporation of ATP, GS-443902, and GS-646939, respectively, when reactions were supplemented with CTP and UTP. Lane 8, when ATP, GS-443902, and GS-646939 are omitted from the reaction; misincorporation is not evident. Pink arrows point to 6-mer product, indicating incorporated nucleotide at position 6. Green arrows point to 14-mer product, indicating full-template length product formation. DENV-2, dengue virus; JEV, Japanese encephalitis virus; WNV, West Nile virus; YFV, yellow fever virus; ZIKV, Zika virus.
Viruses 18 00257 g002
Viruses 18 00257 g003
Figure 3. DENV-2 and JEV RdRp-catalyzed RNA synthesis and inhibition patterns following incorporation of a single ATP or GS-443902 as a function of nucleotide concentration. (A) RNA primer/template supporting a single incorporation of ATP or GS-443902 at position 6 (i). G indicates incorporation of [α-32P]-GTP at position 5. (B) Migration pattern of the products of RNA synthesis catalyzed by DENV-2 and JEV RdRp. A 5′-32P-labeled 4-nt primer (4) serves as a size marker (m). RNA products formed at and beyond the asterisk indicate slippage products that may be a result of sequence-dependent slippage events or RdRp nucleotide transferase activity. DENV-2, dengue virus; JEV, Japanese encephalitis virus.
Figure 3. DENV-2 and JEV RdRp-catalyzed RNA synthesis and inhibition patterns following incorporation of a single ATP or GS-443902 as a function of nucleotide concentration. (A) RNA primer/template supporting a single incorporation of ATP or GS-443902 at position 6 (i). G indicates incorporation of [α-32P]-GTP at position 5. (B) Migration pattern of the products of RNA synthesis catalyzed by DENV-2 and JEV RdRp. A 5′-32P-labeled 4-nt primer (4) serves as a size marker (m). RNA products formed at and beyond the asterisk indicate slippage products that may be a result of sequence-dependent slippage events or RdRp nucleotide transferase activity. DENV-2, dengue virus; JEV, Japanese encephalitis virus.
Viruses 18 00257 g003
Viruses 18 00257 g004
Figure 4. DENV-2 and JEV RdRp-catalyzed RNA synthesis and inhibition patterns following incorporation of a single ATP or GS-646939 as a function of nucleotide concentration. (A) RNA primer/template supporting a single incorporation of ATP or GS-646939 at position 6 (i). G indicates incorporation of [α-32P]-GTP at position 5. (B) Migration pattern of the products of RNA synthesis catalyzed by DENV-2 and JEV RdRp. A 5′-32P-labeled 4-nt primer (4) serves as a size marker (m). RNA products formed at and beyond the asterisk indicate slippage products that may be a result of sequence-dependent slippage events or RdRp nucleotide transferase activity. DENV-2, dengue virus; JEV, Japanese encephalitis virus.
Figure 4. DENV-2 and JEV RdRp-catalyzed RNA synthesis and inhibition patterns following incorporation of a single ATP or GS-646939 as a function of nucleotide concentration. (A) RNA primer/template supporting a single incorporation of ATP or GS-646939 at position 6 (i). G indicates incorporation of [α-32P]-GTP at position 5. (B) Migration pattern of the products of RNA synthesis catalyzed by DENV-2 and JEV RdRp. A 5′-32P-labeled 4-nt primer (4) serves as a size marker (m). RNA products formed at and beyond the asterisk indicate slippage products that may be a result of sequence-dependent slippage events or RdRp nucleotide transferase activity. DENV-2, dengue virus; JEV, Japanese encephalitis virus.
Viruses 18 00257 g004
Viruses 18 00257 g005
Figure 5. Efficiency of UTP incorporation following incorporation of ATP, GS-443902, or GS-646939 by flavivirus RdRp. UTP incorporation at position “i + 1” was monitored at increasing concentrations immediately following incorporation of ATP (black), GS-443902 (orange), or GS-646939 (blue) at position “i”. Concentrations of ATP, GS-443902, and GS-646939 supplemented to the reaction are shown in brackets. RdRps investigated include DENV-2 (A), JEV (B), WNV (C), YFV (D), and ZIKV (E). Product fraction was calculated as the signal of RNA products formed at and beyond “i + 1” divided by total signal in the lane. Independent 8-data point experiments were performed at least 3 times and error bars represent standard deviation with the fit. Efficiency of UTP incorporation is calculated as the ratio of Vmax/Km values for UTP incorporation following the incorporation of ATP, GS-443902, or GS-646939. Inhibition is the ratio of the efficiency values determined for the A-analogs to the efficiency value determined for ATP. Inhibition values are denoted on the graphs for GS-443902 (orange) and GS-646939 (blue). See Table S3 for the corresponding Vmax and Km values for UTP incorporation efficiency. DENV-2, dengue virus; JEV, Japanese encephalitis virus; WNV, West Nile virus; YFV, yellow fever virus; ZIKV, Zika virus.
Figure 5. Efficiency of UTP incorporation following incorporation of ATP, GS-443902, or GS-646939 by flavivirus RdRp. UTP incorporation at position “i + 1” was monitored at increasing concentrations immediately following incorporation of ATP (black), GS-443902 (orange), or GS-646939 (blue) at position “i”. Concentrations of ATP, GS-443902, and GS-646939 supplemented to the reaction are shown in brackets. RdRps investigated include DENV-2 (A), JEV (B), WNV (C), YFV (D), and ZIKV (E). Product fraction was calculated as the signal of RNA products formed at and beyond “i + 1” divided by total signal in the lane. Independent 8-data point experiments were performed at least 3 times and error bars represent standard deviation with the fit. Efficiency of UTP incorporation is calculated as the ratio of Vmax/Km values for UTP incorporation following the incorporation of ATP, GS-443902, or GS-646939. Inhibition is the ratio of the efficiency values determined for the A-analogs to the efficiency value determined for ATP. Inhibition values are denoted on the graphs for GS-443902 (orange) and GS-646939 (blue). See Table S3 for the corresponding Vmax and Km values for UTP incorporation efficiency. DENV-2, dengue virus; JEV, Japanese encephalitis virus; WNV, West Nile virus; YFV, yellow fever virus; ZIKV, Zika virus.
Viruses 18 00257 g005
Viruses 18 00257 g006
Figure 6. Template-dependent inhibition of DENV-2 RdRp by a single embedded GS-443902 residue at position 11. (A) RNA primer/template with an embedded adenosine (template “A”, left) and (template “GS-443902”, right) position 11. G indicates incorporation of [α-32P]-GTP at position 5. (B) Migration pattern of products of RNA synthesis catalyzed by the DENV-2 RdRp on template “A” (left) and template “GS-443902” (right). MgCl2, [α-32P]-GTP, and ATP were provided to the reaction to support RNA synthesis up to position 10. Increasing concentrations of UTP were supplemented to the reactions to monitor incorporation opposite adenosine or GS-443902 at position 11 and templated adenosines from position 12 to 20. A 5′-32P-labeled 4-nt primer (4) serves as a size marker (m). RNA products formed at and beyond the asterisk indicate slippage products that may be a result of sequence-dependent slippage events or RdRp nucleotide transferase activity. (C) Graphic representation (top) of the quantification of (B), where the sum of RNA products generated beyond position 10 was divided by the total signal in the lane. The ratio of the UTP concentration at which 50% of RNA products generated are beyond position 10 for template A to template R was used to generate the fold-inhibition value in the table (bottom). To account for template-dependent differences in activity, product fraction was normalized as a percentage of the highest product fraction observed for that template. DENV-2, dengue virus.
Figure 6. Template-dependent inhibition of DENV-2 RdRp by a single embedded GS-443902 residue at position 11. (A) RNA primer/template with an embedded adenosine (template “A”, left) and (template “GS-443902”, right) position 11. G indicates incorporation of [α-32P]-GTP at position 5. (B) Migration pattern of products of RNA synthesis catalyzed by the DENV-2 RdRp on template “A” (left) and template “GS-443902” (right). MgCl2, [α-32P]-GTP, and ATP were provided to the reaction to support RNA synthesis up to position 10. Increasing concentrations of UTP were supplemented to the reactions to monitor incorporation opposite adenosine or GS-443902 at position 11 and templated adenosines from position 12 to 20. A 5′-32P-labeled 4-nt primer (4) serves as a size marker (m). RNA products formed at and beyond the asterisk indicate slippage products that may be a result of sequence-dependent slippage events or RdRp nucleotide transferase activity. (C) Graphic representation (top) of the quantification of (B), where the sum of RNA products generated beyond position 10 was divided by the total signal in the lane. The ratio of the UTP concentration at which 50% of RNA products generated are beyond position 10 for template A to template R was used to generate the fold-inhibition value in the table (bottom). To account for template-dependent differences in activity, product fraction was normalized as a percentage of the highest product fraction observed for that template. DENV-2, dengue virus.
Viruses 18 00257 g006
Table 1. Antiviral activities of RDV and GS-7682 against flaviviruses a.
Table 1. Antiviral activities of RDV and GS-7682 against flaviviruses a.
VirusHost CellRDVGS-7682
EC50 (µM)CC50 (µM)EC50 (µM)CC50 (µM)
DENV-2 bHuh7 g0.180 ± 0.078 (n = 2)>102.44 ± 0.22 (n = 2)>10
JEV cHuh70.063 ± 0.016 (n = 2)>102.92 ± 0.78 (n = 2)>10
WNV dHuh70.074 ± 0.051 (n = 4)>104.57 ± 2.31 (n = 4)>10
YFV eHuh70.073 ± 0.033 (n = 2)>103.50 ± 0.10 (n = 2)>10
ZIKV fHuh70.092 ± 0.040 (n = 4)>102.15 ± 0.82 (n = 4)>10
a The antiviral activity of RDV and GS-7682 was measured in Huh7 cells using a Nluc reporter virus as described in Materials and Methods to determine the half-maximum effective concentration (EC50) and half-maximal cytotoxic concentration (CC50). All data are at least n ≥ 2 replicates and reported as the average ± SD. Replicates for EC50 values are specified in the table. CC50 values are n > 3; b dengue virus; c Japanese encephalitis virus; d West Nile virus; e yellow fever virus; f Zika virus; g human hepatocarcinoma cell.
Table 2. Metabolism of RDV and GS-7682 in Huh7 cells.
Table 2. Metabolism of RDV and GS-7682 in Huh7 cells.
Cell TypeProdrugTrisphosphateConcentration of Triphosphate (pmol/106 Cells) a
Huh7 bRDVGS-44390227.43 ± 4.84
GS-7682GS-64693920.43 ± 14.73
a Average intracellular concentration of trisphosphate following incubation of 1 µM prodrug in Huh7 cells over 72 h. All data are n ≥ 3 replicates and reported as the average ± SD; b human hepatocarcinoma cell.
Table 3. Incorporation of GS-443902 and GS-646939 by polymerase enzymes.
Table 3. Incorporation of GS-443902 and GS-646939 by polymerase enzymes.
RNA SenseFamilyPolymeraseGS-443902GS-646939
Selectivity (Fold) aSelectivity (Fold) b
Positive ssRNAFlaviviridaeDENV-2 c11.17.0
JEV d6.83.4
WNV e6.85.1
YFV f10.45.8
ZIKV g6.54.0
Human DNA-dependent RNAPHumanh-mtRNAP h508 11540 2
a Selectivity of a viral RNA polymerase for GS-443902 is calculated as the ratio of the Vmax/Km values ATP and GS-443902 analog, respectively; b selectivity of a viral RNA polymerase for GS-443902 is calculated as the ratio of the Vmax/Km values ATP and GS-646939 analog, respectively; c dengue virus; d Japanese encephalitis virus; e West Nile virus; f yellow fever virus; g Zika virus; h human mitochondrial RNA polymerase; 1 data from Tchesnokov et al. [41]; 2 data from Gordon et al. [36].
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Walker, S.M.; Gordon, C.J.; Tchesnokov, E.P.; Sun, L.; Zou, J.; Xie, X.; Riola, N.C.; Cutillas, V.; Du Pont, V.; Zhao, X.; et al. 1′- and 4′-Cyano Modified Adenosine Analogs Against Prototypic Flavivirus RNA-Dependent RNA Polymerases. Viruses 2026, 18, 257. https://doi.org/10.3390/v18020257

AMA Style

Walker SM, Gordon CJ, Tchesnokov EP, Sun L, Zou J, Xie X, Riola NC, Cutillas V, Du Pont V, Zhao X, et al. 1′- and 4′-Cyano Modified Adenosine Analogs Against Prototypic Flavivirus RNA-Dependent RNA Polymerases. Viruses. 2026; 18(2):257. https://doi.org/10.3390/v18020257

Chicago/Turabian Style

Walker, Simon M., Calvin J. Gordon, Egor P. Tchesnokov, Long Sun, Jing Zou, Xuping Xie, Nicholas C. Riola, Vincent Cutillas, Venice Du Pont, Xiaofeng Zhao, and et al. 2026. "1′- and 4′-Cyano Modified Adenosine Analogs Against Prototypic Flavivirus RNA-Dependent RNA Polymerases" Viruses 18, no. 2: 257. https://doi.org/10.3390/v18020257

APA Style

Walker, S. M., Gordon, C. J., Tchesnokov, E. P., Sun, L., Zou, J., Xie, X., Riola, N. C., Cutillas, V., Du Pont, V., Zhao, X., Wang, T., Pitts, J., Siegel, D. S., Perry, J. K., Feng, J. Y., Bilello, J. P., & Götte, M. (2026). 1′- and 4′-Cyano Modified Adenosine Analogs Against Prototypic Flavivirus RNA-Dependent RNA Polymerases. Viruses, 18(2), 257. https://doi.org/10.3390/v18020257

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop