ASFV MGF110-7L Inhibits eIF4G1 Expression via Endoplasmic Reticulum Stress to Block Host Translation

Abstract

African swine fever virus (ASFV) is a highly contagious and lethal double-stranded DNA virus that relies on host cellular translation machinery for replication and immune evasion. The multigene family 110 (MGF110) contains several members with incompletely defined functions. Here, the role of MGF110-7L in host translation regulation was investigated in HEK-293T and PK15 cells. Ribopuromycylation assays demonstrated that MGF110-7L expression resulted in potent, dose- and time-dependent inhibition of nascent polypeptide synthesis. Western blotting revealed a selective reduction in eIF4G1 protein abundance, with no significant changes in eIF4G2, eIF4E, and eIF4A, while eIF4G1 mRNA levels remained unaffected, indicating post-transcriptional regulation. Overexpression of eIF4G1 partially rescued translation suppression. MGF110-7L also decreased eIF4B phosphorylation and activated the PERK/eIF2α pathway, consistent with the induction of endoplasmic reticulum (ER) stress. ER stress promoted stress granule (SG) formation and enhanced eIF4G1 association with the SG marker G3BP1. The inhibitor assays demonstrated that the suppression of eIF2α phosphorylation by ISRIB restored the abundance of eIF4G1 protein. In addition, the downregulation of eIF4G1 was reversed by the inhibition of autophagy using bafilomycin A1, indicating an SG-linked autophagy–lysosome degradation pathway. Co-immunoprecipitation assays confirmed increased eIF4G1-G3BP1 interaction, but no direct binding between MGF110-7L and eIF4G1. This work provides the first experimental evidence that an ASFV protein, MGF110-7L, suppresses cap-dependent translation through SG-mediated autophagic degradation of eIF4G1, thereby revealing a previously unrecognized mechanism of ASFV translational control. These findings not only extend current understanding of ASFV–host interactions but also suggest potential molecular targets for antiviral strategies and rational vaccine design.

1. Introduction

African swine fever (ASF) is a highly contagious and fatal infectious disease caused by African swine fever virus (ASFV). Since its first identification in Kenya in 1921 [1], ASFV was largely restricted to African regions. However, with the progression of globalization and international trade, ASF outbreaks showed an upward trend in 2015 and peaked around 2020 [2], posing a severe threat to the global swine industry. ASFV is the sole member of the family Asfarviridae and possesses a linear double-stranded DNA genome. ASFV has been observed to infect only members of the family Suidae, displaying strict host specificity [3]. Nevertheless, the virus employs diverse transmission routes, including ticks, contaminated fomites, and direct contact with infected swine excretions. The virus can stabilize under a wide range of environmental conditions, further facilitating its spread [4].

The ASFV particle exhibits a complex multilayered structure, consisting of an outer envelope, capsid, inner membrane, and core [5]. The core shell encloses the viral genome, which is approximately 170~190 kb in length and encodes more than 150 open reading frames (ORFs), including approximately 68 structural proteins and over 100 nonstructural proteins [6]. These proteins play critical roles in viral entry, genome replication, transcriptional and translational regulation, virion assembly, and immune evasion. Highly variable regions (VRs) are located at both ends of the genome, consisting mainly of multigene families (MGFs) and nonessential genes, which together account for approximately 20–25% of the genome [7]. Genomic studies have demonstrated that variations in ASFV virulence are primarily attributed to repetition or deletion of MGF fragments. The MGFs are classified into several subfamilies based on the average length of their encoded proteins, including MGF100, MGF110, MGF300, MGF360, and MGF505 [8]. Previous studies have indicated that proteins from the MGF110 and MGF505 families can suppress interferon production and signaling. Attenuated live vaccine candidates have been developed using strains with continuous deletions of MGF110-9L and MGF505-7R [9].

In eukaryotic cells, protein synthesis is accomplished through the translation process, which involves the decoding of messenger RNA (mRNA) and the stepwise elongation of the polypeptide chain, under the coordinated action of multiple eukaryotic initiation factors (eIFs). During the initiation phase, the cap-binding protein eIF4E recognizes the 5′cap structure of mRNA (m⁷GpppN) and associates with the scaffold protein eIF4G and the RNA helicase eIF4A to form the eIF4F complex, thereby facilitating recruitment of mRNA to the 40S ribosomal subunit [10,11,12]. Subsequently, eIF2α, bound to guanosine triphosphate (GTP) and the initiator methionyl-tRNA (Met-tRNAi), forms a ternary complex that identifies the start codon AUG, and subsequently joins the 60S ribosomal subunit to assemble the 80S initiation complex, which then transitions into the elongation phase [13]. Viruses lack an autonomous protein synthesis system, and their mRNA translation is therefore dependent upon the host cellular translation machinery. To preferentially synthesize their own proteins, many viruses reprogram the host translation network by modulating the phosphorylation status of translation initiation factors. For instance, by enhancing phosphorylation of eIF4E or eIF4G to stabilize the eIF4F complex, or by phosphorylating eIF2α to inhibit ternary complex formation, thereby suppressing host protein synthesis and redirecting translational resources towards viral mRNAs [14,15]. Figure 1a provides a schematic illustration depicting the assembly of the translation initiation complex and the principal mechanisms involved in its regulation.

A notable hallmark of ASFV infection in host cells is the pronounced inhibition of host mRNA translation, which serves to reduce the synthesis of antiviral proteins while ensuring prioritized expression of viral proteins. This translational suppression has been demonstrated to be closely associated with multiple viral regulatory proteins, including key members of the MGFs. It is noteworthy that various members of the MGF110 family play significant roles in immune modulation, yet their mechanisms of action differ markedly. For example, MGF110-9L promotes degradation of the signal transducers and activators of transcription STAT1 and STAT2, thereby effectively suppressing the type I interferon signaling pathway [9,16,17]. MGF110-1L, which is mutated in certain field isolates, can serve as a phylogenetic marker distinguishing lineages, although its precise function remains incompletely characterized [18,19]. MGF110-4L and MGF110-6L possess a canonical “KEDL” endoplasmic reticulum (ER) retention motif, enabling localization to the ER or Golgi apparatus, where they are proposed to participate in regulation of host protein processing and trafficking of immune-related molecules [20]. Furthermore, certain MGF110 members are absent or fused in low-virulence strains, alterations that are often correlated with reduced pathogenicity [21]; however, such deletions have not been observed in highly virulent strains. Of particular interest is MGF110-7L, which functions independently from other immune evasion strategies. Previous studies have reported that this protein can directly activate the PERK/PKR-eIF2α signaling pathway, thereby inducing ER stress and provoking a global arrest of host protein translation [22]. This event establishes a cellular environment favorable for viral replication. Proteomic analyses have suggested potential interactions of MGF110-7L with multiple translation factors and stress-responsive molecules; nevertheless, its precise mode of action has not yet been systematically elucidated, and the molecular recognition of its target proteins as well as the integration of signal networks during virus-mediated host translation suppression remain insufficiently investigated.

Based on this background, the present study was designed to elucidate the mechanism by which MGF110-7L regulates host translation, with particular focus on whether it induces ER stress to activate the PERK/eIF2α signaling pathway, thereby promoting stress granule-associated autophagy–lysosome mediated degradation of eIFs, ultimately leading to inhibition of host cap-dependent translation.

2. Materials and Methods

2.1. Cells

HEK-293T and PK-15 cell lines were obtained from the China Center for Type Culture Collection (CCTCC; Wuhan, China) and were cultured at 37 °C in a humidified atmosphere containing 5% CO₂ in complete Dulbecco’s modified Eagle medium (DMEM; Gibco, Grand Island, NY, USA), supplemented with 10% fetal bovine serum (FBS; Gibco, Grand Island, NY, USA), 100 U/mL penicillin, and 100 µg/mL streptomycin (Gibco, Grand Island, NY, USA).

2.2. Antibodies and Chemicals

Mouse anti-Flag tag monoclonal antibody (AF2852), mouse anti-β-actin monoclonal antibody (AF0003), mouse anti-HA monoclonal antibody (AF2858), rabbit anti-eIF2α monoclonal antibody (AG1817), rabbit anti-eIF2α phosphorylated at Ser57 monoclonal antibody (AF1237), rabbit anti-PERK phosphorylated at Thr980 polyclonal antibody (AF5902), rabbit anti-eIF5A monoclonal antibody (AF2008), rabbit anti-eIF4E polyclonal antibody (AF6777), mouse anti-4EBP1 monoclonal antibody (AG1824), rabbit anti-4EBP1 phosphorylated at Thr37/46 polyclonal antibody (AF5806), rabbit anti-eIF4B polyclonal antibody (AF6774), rabbit anti-p70S6K polyclonal antibody (AF0258), rabbit anti-p70S6K phosphorylated at Thr389 polyclonal antibody (AF5899), rabbit anti-RPS6 phosphorylated at Ser235/236 polyclonal antibody (AF5917), rabbit anti-mTOR monoclonal antibody (AF1648), rabbit anti-mTOR phosphorylated at Ser2448 polyclonal antibody (AF5869), horseradish peroxidase (HRP)-conjugated goat anti-rabbit IgG (H+L) (A0208), and HRP-conjugated goat anti-mouse IgG (H+L) (A0216) were purchased from Beyotime Biotechnology (Shanghai, China). Rabbit anti-PERK polyclonal antibody (A18196), rabbit anti-eIF4G phosphorylated at Ser1108 polyclonal antibody (AP0796), rabbit anti-eIF4G polyclonal antibody (A0881), rabbit anti-eIF4E phosphorylated at Ser209 polyclonal antibody (AP1024), rabbit anti-eIF4A polyclonal antibody (A20251), rabbit anti-eIF4B phosphorylated at Ser422 polyclonal antibody (AP0775), rabbit anti-RPS6 polyclonal antibody (A11874), rabbit anti-PABPC1 polyclonal antibody (A14872), and rabbit anti-Puromycin monoclonal antibody (A23031) were obtained from ABclonal Technology (Wuhan, China). Rabbit anti-LC3B monoclonal antibody (T55992), rabbit anti-p62 monoclonal antibody (T55546), and rabbit anti-eIF4G2 monoclonal antibody (PA5-31101) were purchased from Abmart (Shanghai, China).

Lipofectamine™ 3000 transfection reagent (L34000015), TRIzol reagent (101002), and pre-stained protein marker (26619) were obtained from Thermo Fisher Scientific (Waltham, MA, USA). Endo-free Plasmid DNA Mini Kit II (D6950) was purchased from Omega Bio-Tek (Norcross, GA, USA). HiScript II 1st Strand cDNA Synthesis Kit (+gDNA wiper) (R212-01), SupRealQ Ultra Hunter SYBR qPCR Master Mix (U+) (Q713-02), and 2× Phanta UniFi Master Mix high-fidelity PCR premix (P516) were obtained from Vazyme Biotech (Nanjing, China). PCR Mix enzyme (B639297) was purchased from Sangon Biotech (Shanghai, China). Thapsigargin (TG, T9033) was purchased from Sigma-Aldrich (St. Louis, MO, USA). NP-40 lysis buffer (P0013F), RIPA lysis buffer (strong and mild) (P0013B/C) and SDS-PAGE protein loading buffer (P0286) were obtained from Beyotime Biotechnology. ISRIB (eIF2α phosphorylation inhibitor, HY-12495), cycloheximide (CHX, protein synthesis inhibitor, HY-12320), MG132 (proteasome inhibitor, HY-13257), bafilomycin A1 (BafA1, autophagy inhibitor, HY-100558), and puromycin reagent (HY-B1743A) were purchased from MedChem Express (Monmouth Junction, NJ, USA).

2.3. Plasmid Constructions and Expression Vectors

All members of the MGF110 gene family from the ASFV strain Pig/HLJ/2018 (GenBank accession number MK 333180.1) were generated by gene synthesis (Tsingke Biotechnology, Nanjing, China) and cloned into the pCAGGS expression vector with a C-terminal FLAG tag. The plasmid pCMV-mCherry-GFP-LC3B (D2816) was purchased from Beyotime Biotechnology (Shanghai, China).

2.4. Transient Transfection

A total of 3 × 10⁶ HEK-293T or PK-15 cells were seeded onto 12-well plates and incubated for 18 h until 70% confluent. Prior to transfection, the medium was changed to DMEM complete medium with 2% FBS. HEK-293T or PK-15 cells were then transfected with a MGF110-7L-Flag-expressing plasmid with an increasing dose (0.2, 0.8, 1.2, and 1.6 μg) or an empty Flag vector (1.6 μg) using Lipofectamine 3000 according to the manufacturer’s instructions. At 24 h post-transfection, the cells were treated as described and analyzed by Western blotting or RT-qPCR.

2.5. Western Blot Analysis

Protein samples for Western blot were prepared by lysing cells with RIPA buffer. The lysates were then mixed with 5 × SDS sample buffer and boiled at 100 °C for 10 min. Bradford’s assay was employed to determine the protein concentration of the samples. Under acidic conditions, Coomassie Brilliant Blue G-250 dye binds to proteins, causing a shift in the maximum absorbance from 465 nm to 595 nm and resulting in a color change from reddish-brown to blue; within a defined concentration range, the intensity of the color is proportional to the protein content. Samples were resolved by SDS-PAGE in an 8 or 12% acrylamide–bisacrylamide gel and transferred to a polyvinylidene difluoride membrane (Merck Millipore, Billerica, MA, USA)). The membrane was blocked with 5% fat-free milk for 2 h at room temperature and then incubated with primary antibodies at 4 °C overnight. The following day, the membrane was washed three times with TBS-Tween and incubated with HRP-conjugated secondary antibody at a dilution of 1:3000 for 1 h at room temperature. Finally, bands obtained after development with ECL reagent (Thermo Fisher Scientific, Waltham, MA, USA) were visualized on a ChemiDoc XRS+ imaging system or Tanon MINI Space (Tanon, Shanghai, China). The bands were quantified by densitometry and the data normalized to control values using Image J software (version 1.53k; National Institutes of Health, Bethesda, MD, USA; available at https://imagej.nih.gov/ij/).

2.6. RT-qPCR

Total RNA was extracted from PK15 cells using the TRIzol reagent according to the manufacturer’s instructions, and the cDNA synthesis was performed using the HiScript II 1st Strand cDNA Synthesis Kit. Quantitative PCR analysis was performed using SupRealQ Ultra Hunter SYBR qPCR Master Mix (U+) on an ABI QuantStudio 5 real-time PCR system. The relative mRNA level of each gene was normalized to β-actin mRNA levels and determined based on the standard 2^–ΔΔCT protocol. The primers used for RT-qPCR were listed in

Table 1. Primers for Quantitative Real-Time PCR of the eIF4G Gene Family.

Target	Orientation	Sequence (5′-3′)
Porcine eIF4G1	Forward	CATTGCTCCAACTGCCCAAC
	Reverse	GCTGGGGTAGCAGAAAGGAT
Porcine eIF4G2	Forward	ACATCATTGGGTTCCTCGCA
	Reverse	CCTTGAGCCATAGGAGCAGG
Porcine eIF4G3	Forward	TGGCTGGAAGAGGCTGGATA
	Reverse	CAGGACGAAGGGAAGGACTG
Porcine β-actin	Forward	GACATCAAGGAGAAGCTGTGC
	Reverse	TGAAGGTAGTTTCGTGGATGC

.

2.7. IFA

PK-15 cells grown on glass coverslips were transfected with an empty Flag vector or a MGF110-7L-Flag-expressing vector until 40 to 50% confluence, or they were co-transfected with a FLAG-tagged plasmid and an indicated plasmid. At 24 h post-transfection, the cells were rinsed twice with phosphate-buffered saline (PBS), fixed with 4% paraformaldehyde for 15 min, washed with PBS, permeabilized with 0.1% Triton X-100 for 15 min, washed again with PBS, and blocked in 5% bovine serum albumin in PBS for 1 h at room temperature. The cells were then incubated in primary antibodies (1:100) diluted in blocking buffer for 1 h at room temperature. After three washes with PBS-Tween, the cells were incubated with Alexa Fluor-conjugated secondary antibodies (1:500) diluted in blocking buffer for 1 h at room temperature. The cells were washed three times with PBS-Tween and incubated for 8 min with 4′,6′-diamidino-2-phenylindole (DAPI). The coverslips were then rinsed twice with PBS and mounted on cover slides using antifade mounting medium. Then, confocal fluorescence images were visualized using a Leica DMI6000B laser-scanning microscope (Leica, Wetzlar, Germany).

2.8. Ribopuromycylation Assay

The cells were transfected with the MGF110-7L-Flag-expressing vector at the indicated dose or with an empty Flag vector. At 24 h post-transfection, the cells were pulse-labeled with 5 μg/mL puromycin and then incubated for 1h. As a positive control, cells transfected with an empty vector were treated with 0.2 mM Cycloheximide for 10 min before the addition of puromycin. After three washes with PBS, the cells were prepared and subjected to Western blot analysis.

2.9. Co-IP

PK15 cells with plasmids transfection were lysed in NP-40 lysis buffer supplemented with protease inhibitor cocktail and sonicated for 1.5 min with an interval of 5 s. After centrifugation (12,000× g for 20 min), supernatants were incubated with the indicated antibody or control IgG at 4 °C overnight. Immunoprecipitated complexes were then mixed with protein G agarose beads at 4 °C for 3 h. After three washes with ice-cold lysis buffer, beads were boiled in 2 × SDS sample buffer and analyzed by Western blotting.

2.10. Statistical Analysis

The experimental data are presented in graph bars as means ± the standard deviations (SD) of at least three independent biological replicates. Statistical significance was determined using a Student t test by SPSS Statistics version 26 (IBM Corporation, Armonk, NY, USA); significance is indicated in the figures by asterisks (*, p < 0.05; **, p < 0.01; ns, not significant).

3. Result

3.1. ASFV MGF110-7L Protein Inhibits Host Translation

To evaluate the effects of MGF110 family proteins on host translational activity, four recombinant plasmids expressing individual members of the ASFV MGF110 gene family-pCAGGS-3L-Flag, pCAGGS-5-6L-Flag, pCAGGS-7L-Flag, and pCAGGS-14L-Flag were generated. Each plasmid was separately transfected into 293T cells under identical experimental conditions to allow direct comparison of their effects. To monitor protein synthesis, puromycin (puro) was added to the culture medium for 1 h prior to harvesting, enabling covalent incorporation into nascent polypeptide chains and subsequent detection by immunoblotting (Figure 1b). Puro mimics the 3′ end of aminoacyl-tRNA and is recognized and catalyzed by the peptidyl transferase center of the ribosome. However, due to its unstable binding to the ribosome, the resulting “peptidyl-puromycin” product rapidly dissociates, thereby terminating translation [23]. Cycloheximide treatment served as a positive control for complete translation inhibition, which binds to the 60S large subunit of the 80S eukaryotic ribosome and inhibits the activity of peptidyl transferase, consequently blocking the translation elongation step [24]. Analysis of Western blot results revealed that both 5-6L and 7L expression caused a marked reduction in the abundance of puromycin-labeled polypeptides, indicating pronounced suppression of nascent protein synthesis in the transfected cells.

To further define the inhibitory capacity of MGF110-7L, both dose-dependent and time-dependent assay experiments were conducted in PK15 (Figure 1c) and 293T (Figure 1d) cells. In the dose-dependent study, incremental increases in the amount of MGF110-7L plasmid DNA used for transfection resulted in progressively decreased puromycin incorporation, reflecting a global suppression of cellular translation. In the time-dependent analysis, maximal inhibition of protein synthesis was observed between 24 h and 36 h post-transfection, with a gradual return toward baseline levels during extended incubation. These results collectively indicate that the ASFV MGF110-7L protein exerts a potent yet time-dependent inhibitory effect on host translation, primarily through suppression of nascent polypeptide chain synthesis.

3.2. ASFV MGF110-7L Suppresses eIF4G1 Expression Within the eIF4F Complex

The eIF4F complex, which comprises the large scaffold protein eIF4G together with eIF4E and eIF4A, functions as a central node in cap-dependent translation initiation and represents a rate-limiting step in protein synthesis. Within the complex, eIF4G facilitates the recruitment of the small ribosomal subunit through interactions with eIF3, while eIF4E binds the 5′mRNA cap structure, and eIF4A unwinds secondary structures in the 5′untranslated region. The phosphorylation state of these components is a critical determinant of translational activity, as phosphorylation of eIF4G generally enhances its scaffolding and stimulatory functions [25,26], whereas phosphorylation of eIF4E can weaken its binding to eIF4G, thereby hindering eIF4F assembly [27]. Western blot analysis of cells transfected with increasing amounts of MGF110-7L plasmid revealed a clear, dose-dependent reduction in the eIF4G protein concentration, whereas the expression of eIF4E and eIF4A remained largely unchanged (Figure 2a). These observations suggest that MGF110-7L may interfere with eIF4F complex assembly specifically through decreasing eIF4G abundance rather than by altering the levels of the other two core components.

The mammalian eIF4G protein family consists of three isoforms: eIF4G1, eIF4G2, and eIF4G3 (Figure 2b). eIF4G1 serves as the principal mediator of canonical cap-dependent initiation [28], while eIF4G2 participates in diverse initiation modes, including internal ribosome entry site (IRES)-driven translation, cap-independent translation enhancer (CITE)-mediated translation, and N6-methyladenosine (m6A)-dependent translation, as well as non-canonical cap-dependent initiation independent of eIF4F [29]. eIF4G3 has more specialized, tissue-restricted functions such as roles in spermatogenesis and neural physiology [30]. Quantitative real-time PCR (qRT-PCR) results demonstrated that MGF110-7L expression had no significant effect on mRNA levels of eIF4G1, eIF4G2, or eIF4G3, indicating post-transcriptional regulation (Figure 2c). Western blot analysis further revealed that MGF110-7L selectively decreased eIF4G1 protein abundance, while eIF4G2 levels were unaffected (Figure 2d). To determine whether the reduction in eIF4G1 was directly responsible for translation inhibition, rescue experiments were performed in which increasing doses of pcDNA3.1-3×HA-eIF4G1 plasmid were co-transfected with MGF110-7L (Figure 2e). This resulted in a dose-dependent restoration of puromycin incorporation, confirming that suppression of eIF4G1 expression is a critical mechanism by which MGF110-7L impairs host translation through disruption of eIF4F complex assembly.

3.3. ASFV MGF110-7L Differentially Regulates mTOR and eIF4B Phosphorylation

The eIF4B plays an important role in stimulating the RNA helicase activity of eIF4A within the eIF4F complex, thereby enhancing ribosome scanning and mRNA unwinding. Reduction in phosphorylated eIF4B is known to diminish translational capacity [31]. Another important co-factor, the poly(A)-binding protein (PABP), interacts with eIF4G to connect the mRNA 5′cap and poly(A) tail, forming a closed-loop structure that promotes re-initiation and overall translation efficiency. Immunoblotting of PABP, eIF4B, and phosphorylated eIF4B (p-eIF4B) revealed that MGF110-7L expression did not significantly affect total levels of PABP or eIF4B, but caused a marked reduction in eIF4B phosphorylation (Figure 3a). This reduction would be expected to weaken eIF4A helicase activation and further impair initiation complex function.

In addition to affecting translation initiation factors, MGF110-7L also impacted key regulators within the mammalian target of rapamycin (mTOR) pathway, a major signaling hub in translational control. MGF110-7L expression enhanced phosphorylation of mTOR and ribosomal protein S6 (RPS6), while neither the total protein levels nor phosphorylation status of 4E-BP1 showed significant changes (Figure 3b). These observations suggest that MGF110-7L selectively modulates components of the mTOR pathway, potentially facilitating viral mRNA translation through alternative initiation mechanisms independent of the canonical eIF4F complex.

3.4. ASFV MGF110-7L Induces Endoplasmic Reticulum Stress via the PERK/eIF2α Pathway

The ER is a central site for synthesis and maturation of secretory and membrane proteins. Under conditions of viral infection, excessive production of viral proteins frequently disturbs ER homeostasis, triggering the unfolded protein response (UPR). A major arm of the UPR is mediated by PERK, whose activation leads to phosphorylation of eIF2α [32]. This phosphorylation event enhances the binding of eIF2 to GDP, thereby inhibiting the exchange of GDP for GTP and reducing global translation initiation, while in parallel stimulating the transcription of ER chaperones such as glucose-regulated protein 78 (GRP78) to relieve protein folding stress (Figure 3c). To assess whether MGF110-7L suppresses host translation through the PERK/eIF2α pathway, dose–response transfections of MGF110-7L were performed, with TG-treated cells serving as a positive ER stress control. MGF110-7L expression markedly increased GRP78 abundance and elevated the ratios of phosphorylated PERK to total PERK and phosphorylated eIF2α to total eIF2α. These effects closely mirrored those observed upon TG treatment, indicating that MGF110-7L triggers ER stress via PERK/eIF2α activation, a process likely to contribute significantly to its translational inhibition.

Figure 3. MGF110-7L Induces eIF4G1 Degradation via Endoplasmic Reticulum Stress. (a) HEK 293T and PK15 cells were transfected with graded doses of the 7L Flag plasmid. At 24 h post-transfection, cells were lysed and collected. Western blotting was performed to detect eIF4B and PABP expression levels; (b) PK15 cells were transfected with the 7L Flag plasmid. At 24 h post-transfection, cell lysates were harvested and subjected to Western blotting analysis to determine the expression levels of translation initiation regulatory proteins; (c) To examine the effect of MGF110 7L on ER stress, PK15 cells were transfected with the 7L Flag plasmid. At 24 h post-transfection, a positive control group was treated with 1 mM TG for 6 h. Cell lysates were collected, and Western blotting was performed to detect GRP78 protein expression and eIF2α phosphorylation levels; (d) To determine the effect of ER stress on eIF4G1 protein expression, PK15 cells were transfected with the 7L Flag plasmid for 24 h, followed by treatment with 200 nM ISRIB for 6 h. Puromycin was added prior to lysis for nascent polypeptide labeling. WB was then performed to detect intracellular eIF4G1 protein expression levels. Bars represent mean ± SEM. Statistical significance levels are indicated as follows: p < 0.05 (*), p < 0.01 (**), p < 0.001 (***), and not significant (ns).

Figure 3. MGF110-7L Induces eIF4G1 Degradation via Endoplasmic Reticulum Stress. (a) HEK 293T and PK15 cells were transfected with graded doses of the 7L Flag plasmid. At 24 h post-transfection, cells were lysed and collected. Western blotting was performed to detect eIF4B and PABP expression levels; (b) PK15 cells were transfected with the 7L Flag plasmid. At 24 h post-transfection, cell lysates were harvested and subjected to Western blotting analysis to determine the expression levels of translation initiation regulatory proteins; (c) To examine the effect of MGF110 7L on ER stress, PK15 cells were transfected with the 7L Flag plasmid. At 24 h post-transfection, a positive control group was treated with 1 mM TG for 6 h. Cell lysates were collected, and Western blotting was performed to detect GRP78 protein expression and eIF2α phosphorylation levels; (d) To determine the effect of ER stress on eIF4G1 protein expression, PK15 cells were transfected with the 7L Flag plasmid for 24 h, followed by treatment with 200 nM ISRIB for 6 h. Puromycin was added prior to lysis for nascent polypeptide labeling. WB was then performed to detect intracellular eIF4G1 protein expression levels. Bars represent mean ± SEM. Statistical significance levels are indicated as follows: p < 0.05 (*), p < 0.01 (**), p < 0.001 (***), and not significant (ns).

3.5. ASFV MGF110-7L Suppression of eIF4G1 Expression Is Associated with Cellular Stress

Eukaryotic cells respond to various environmental insults through the induction of cellular stress pathways, which typically involve a rapid suppression of translation initiation and the assembly of cytoplasmic stress granules (SGs). A cornerstone of the integrated stress response (ISR) is eIF2α phosphorylation, which promotes the disassembly of eIF4F complexes and the sequestration of untranslated mRNAs, 40S ribosomal subunits, RNA-binding proteins, and initiation factors into SGs via liquid–liquid phase separation (LLPS) [33]. SGs serve not only to maintain translational repression but also to regulate selective mRNA stability and translation. Previous evidence indicated that MGF110-7L-induced ER stress could promote SG formation. Considering the established physical interaction between the SG marker G3BP1 and eIF4G, it was hypothesized that MGF110-7L might induce targeted degradation of eIF4G1 through SG-linked pathways. To test this hypothesis, cells were treated with ISRIB, an ISR modulator that binds eIF2B to antagonize p-eIF2α mediated inhibition and thereby restore protein synthesis. ISRIB treatment of MGF110-7L expressing cells increased puromycin incorporation and partially rescued eIF4G1 protein levels (Figure 3d). These results support the conclusion that MGF110-7L reduces eIF4G1 abundance in part through a cellular stress-dependent mechanism that involves SG formation.

3.6. MGF110-7L Protein Indirectly Mediates eIF4G1 Autophagic Degradation via Stress Granules

Protein degradation in mammalian cells proceeds predominantly via the ubiquitin–proteasome system (UPS) or the autophagy-lysosome pathway. To determine which mechanism accounts for eIF4G1 downregulation in the presence of MGF110-7L, cells were treated with the autophagy inhibitor bafilomycin A1 (BafA1) or the proteasome inhibitor MG132. BafA1 treatment substantially restored eIF4G1 protein expression, whereas MG132 had no detectable effect, implicating an autophagy-lysosome dependent degradation pathway (Figure 4a).

To investigate the effect of MGF110-7L on autophagic flux, PK15 cells were co-transfected with pCMV-EGFP-mCherry-LC3 and pCAGGS-7L-Flag. Western blot analysis revealed elevated LC3B levels accompanied by decreased p62 content in MGF110-7L expressing cells (Figure 4b). In this tandem fluorescent LC3 reporter system, EGFP fluorescence is sensitive to acidic environments and therefore quenched upon autophagosome fusion with lysosomes, whereas mCherry fluorescence remains stable under the same conditions due to its acid-resistant properties. Consequently, autophagosomes exhibit both green and red signals (yellow in merged images), while autolysosomes formed after autophagosome-lysosome fusion display red-only puncta. Immunofluorescence microscopy in the present study revealed that LC3 signals in MGF110-7L-expressing cells appeared predominantly as red puncta (Figure 4c), indicating that a large proportion of LC3-tagged vesicles had undergone fusion with lysosomes. This observation is consistent with enhanced autophagic flux, as it reflects progression from autophagosome formation to autolysosome maturation.

Potential direct interaction between MGF110-7L and eIF4G1 was examined by co-immunoprecipitation (Co-IP) after co-transfection of pCAGGS-7L-Flag and pcDNA3.1-3×HA-eIF4G1 (Figure 4e), but no direct binding was detected. By contrast, Co-IP of endogenous proteins revealed that MGF110-7L increased the association between eIF4G1 and the SG marker G3BP1 (Figure 4d). Furthermore, in cells co-expressing eIF4G1-HA, G3BP1-Myc, and 7L-Flag, immunofluorescence showed co-localization of eIF4G1 (green) with G3BP1 (red) within cytoplasmic aggregates (Figure 4f). Taken together, these experiments demonstrate that MGF110-7L indirectly promotes eIF4G1 degradation through an SG-linked autophagy-lysosome pathway, thereby reinforcing its inhibitory effect on host protein synthesis.

4. Discussion

ASFV is recognized as a highly pathogenic and highly contagious double-stranded DNA virus, whose replication process is strongly dependent on the host cell translation machinery. By subverting the host translational apparatus, ASFV can prioritize the synthesis of viral proteins while repressing host protein production, thereby ensuring efficient viral replication and immune evasion. Although the dependence of ASFV on the host translation system has been widely documented, the regulatory mechanisms exerted by its MGF members on host translation at distinct stages of infection have not been systematically elucidated.

The present study demonstrated that the MGF110-7L protein inhibits cellular mRNA translation through multilayered mechanisms, including the promotion of eIF2α phosphorylation, reduction of eIF4G1 protein expression, and induction of ER stress that activates the PERK/eIF2α signaling pathway. ER stress was further found to accelerate the formation of SGs, which indirectly trigger the autophagy–lysosome-dependent degradation of eIF4G1 (Figure 5). This composite inhibitory mechanism reveals a finely coordinated strategy employed by ASFV to manipulate the host translational apparatus, thereby providing novel molecular insights into the virus’s immune evasion and infection dynamics.

Transcription and protein expression of ASFV follow a strictly temporal regulation pattern. Early viral genes often contain TATA-box promoters and depend on host RNA polymerase II for rapid transcription initiation, thus enabling viral suppression of host transcription and translation, remodeling of cellular metabolism, and evasion of innate immune responses in the early infection stage [34]. Several mechanisms have been identified in ASFV-mediated regulation of host translation during this phase: (1) The early decapping enzyme ASFV-DP, encoded by the Ba71V D250R/Malawi g5R gene and containing a Nudix hydrolase motif, removes the 5′ cap of host mRNAs, rendering them susceptible to nuclease degradation [35,36]. (2) The viral ubiquitin-conjugating enzyme UBCv1 interacts with the host initiation factor eIF4E, thereby preventing cap recognition by host mRNAs and inducing ubiquitination of ribosomal protein RPS23, which results in disassembly of ribosomal subunits and suppression of host protein synthesis [37]. (3) Early-expressed proteins C315R and H359L induce ER stress and activate the PERK/eIF2α pathway, causing rapid inhibition of host translation [38]. Beyond non-canonical translation suppression mechanisms, specific viral proteins selectively maintain canonical translation to facilitate viral replication. For example, DP71L counteracts translational arrest by recruiting host protein phosphatase 1 (PP1) to sustain eIF2α in a dephosphorylated state, thereby restoring cap-dependent translation initiation [35]. Concurrently, the g5R protein promotes viral replication by hijacking both eIF5A and RPS15 [36]. Additionally, other proteins such as pCP312R [39] and EP152R [40] have been demonstrated to inhibit cellular protein synthesis in vitro assays.

The functional pattern of MGF110-7L resembles that of these early viral proteins. During infection onset, MGF110-7L reinforces host translation suppression through a dual mechanism-on one hand by promoting eIF2α phosphorylation to block assembly of the translation initiation complex, and on the other hand by specifically decreasing eIF4G1 protein abundance, thereby destabilizing the eIF4F complex. Such parallel “functional inhibition” (signal regulation) and “structural inhibition” (complex disassembly) enable ASFV to achieve early, highly efficient translational shutdown in host cells.

In eukaryotic cells, the eIF4G family is composed of three primary members: eIF4G1, eIF4G2, and eIF4G3. Among them, eIF4G1 serves as a critical scaffold protein mediating cap-dependent translation initiation under normal cellular conditions. Conversely, eIF4G2 is involved in noncanonical translation pathways under stress conditions, including IRES-mediated initiation, CITE-driven translation, and m6A-dependent translation [29]. During cellular stress or viral infection, cap-dependent translation is frequently downregulated to conserve energy, whereas selective noncanonical translation pathways remain active to produce stress response or viral proteins [41].

MGF110-7L selectively targets eIF4G1 for degradation without affecting eIF4G2, representing an adaptive viral strategy. By disrupting the eIF4F cap-dependent initiation complex, host mRNA translation is suppressed, while the eIF4G2 mediated noncanonical translation remains active, allowing continuous synthesis of viral mRNAs that bear IRES or simplified 5′ untranslated regions. This mechanism explains why global host protein synthesis is inhibited whereas viral protein synthesis persists during MGF110-7L overexpression. Moreover, MGF110-7L inhibits eIF4B phosphorylation, thereby diminishing eIF4A helicase activity, resulting in impaired mRNA unwinding and reduced ribosomal loading in host cells. In contrast, viral mRNAs, which generally possess less structured 5′ UTR or IRES elements, are more efficiently translated via eIF4G2-associated noncanonical pathways. Such selective regulation not only achieves efficient blockade of host protein synthesis but also ensures viral translation continuity-a refined translational reprogramming strategy acquired through viral evolution.

Among the multigene families, the MGF110 family has attracted considerable attention owing to its high genetic variability and functional diversity. Located within the left variable region (LVR) of the ASFV genome, MGF110 represents a hyperplastic and mutation-prone locus. Single nucleotide variations (SNVs) within MGF110 genes have frequently been used as genetic anchors for phylogenetic and epidemiological classification of genotype II strains across spatial and temporal distributions [19]. Nevertheless, many MGF110 family proteins are considered nonessential for virus replication. Notably, in bone marrow-derived macrophages (BMDMs) infected with the attenuated ASFV-GS-Δ18R/NL/UK mutant strain lacking three virulence-related genes (DP148R, NL, and UK), expression of the MGF110-7L gene was significantly downregulated, suggesting that its transcriptional activity might be indirectly modulated by these virulence genes [42].

Notably, the MGF110-7L protein induces ER stress, which promotes the formation of SGs. SGs further suppress translation initiation by sequestering translation initiation factors and mRNAs, while selectively facilitating the degradation of specific translation factors. The interaction between eIF4G and G3BP1, a core SG marker protein, is crucial for SG assembly. Viral proteases, such as the EV71 2A protein and the encephalomyocarditis virus (EMCV) L protein, can disrupt the eIF4G1-G3BP1 interaction, thereby inhibiting SG formation [43]. We hypothesize that MGF110-7L promotes the interaction between eIF4G1 and G3BP1, leading to the recruitment and subsequent degradation of eIF4G1 within SGs. This speculation is supported by several experimental findings: ISRIB treatment, which alleviates SG formation, partially restored eIF4G1 protein expression; furthermore, co-immunoprecipitation assays demonstrated that MGF110-7L significantly enhances the binding between eIF4G1 and G3BP1. Additionally, proteomic analysis suggests potential interactions between MGF110-7L and both eIF5A and the transcription factor TFEB [22]. Given TFEB’s central role in regulating lysosomal biogenesis and autophagy [44], its interaction with MGF110-7L warrants further investigation, particularly concerning its potential influence on SG dynamics and the autophagy-related degradation of eIF4G1.

From an applied perspective, comprehensive elucidation of ASFV’s translational suppression network provides promising targets for the development of antiviral strategies. Pharmacological intervention aimed at modulating the MGF110-7L-mediated PERK/eIF2α signaling axis, SG formation, or autophagy-associated degradation pathways may represent viable approaches to counteract ASFV infection. Furthermore, in live-attenuated vaccine development, deletion or functional attenuation of MGF110-7L may attenuate viral pathogenicity and enhance immunogenicity, offering potential avenues toward safe and effective ASFV vaccine design.