Complete Genome Sequencing of the Divergent Guiana Dolphin Morbillivirus (GDMV), Brazil
Abstract
1. Introduction
2. Materials and Methods
2.1. Material
2.2. Viral Isolation
2.3. Immunohistochemical Analysis
2.4. RNA Extraction and Deep Sequencing Analysis
2.5. Primer Design for Genome Gaps Closure
2.6. Conventional RT-PCR
2.7. Phylogenetic Analysis
3. Results
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Correction Statement
References
- Plemper, R.K.; Lamb, R.A. Paramyxoviridae: The viruses and their replication. In Fields Virology: Emerging Viruses, 7th ed.; Howley, P.M., Knipe, D.M., Eds.; Wolters Kluwer: Philadelphia, PA, USA, 2021; Volume 1, pp. 504–558. [Google Scholar]
- de Vries, R.D.; Duprex, W.P.; de Swart, R.L. Morbillivirus infections: An introduction. Viruses 2015, 7, 699–706. [Google Scholar] [CrossRef] [PubMed]
- Domingo, M.; Ferrer, L.; Pumarola, M.; Marco, A.; Plana, J.; Kennedy, S.; McAliskey, M.; Rima, B.K. Morbillivirus in dolphins. Nature 1990, 348, 21. [Google Scholar] [CrossRef]
- McCullough, S.J.; McNeilly, F.; Allan, G.M.; Kennedy, S.; Smyth, J.A.; Cosby, S.L.; McQuaid, S.; Rima, B.K. Isolation and characterisation of a porpoise morbillivirus. Arch. Virol. 1991, 118, 247–252. [Google Scholar] [CrossRef]
- Taubenberger, J.K.; Tsai, M.M.; Atkin, T.J.; Fanning, T.G.; Krafft, A.E.; Moeller, R.B.; Kodsi, S.E.; Mense, M.G.; Lipscomb, T.P. Molecular genetic evidence of a novel morbillivirus in a long-finned pilot whale (Globicephalus melas). Emerg. Infect. Dis. 2000, 6, 42–45. [Google Scholar] [CrossRef]
- Groch, K.R.; Colosio, A.C.; Marcondes, M.C.C.; Zucca, D.; Diaz-Delgado, J.; Niemeyer, C.; Marigo, J.; Brandao, P.E.; Fernandez, A.; Catão-Dias, J.L. Novel cetacean morbillivirus in Guiana dolphin, Brazil. Emerg. Infect. Dis. 2014, 20, 511–513. [Google Scholar] [CrossRef]
- Stephens, N.; Duignan, P.J.; Wang, J.; Bingham, J.; Finn, H.; Bejder, L.; Patterson, A.P.; Holyoake, C. Cetacean morbillivirus in coastal Indo-Pacific bottlenose dolphins, Western Australia. Emerg. Infect. Dis. 2014, 20, 666–670. [Google Scholar] [CrossRef] [PubMed]
- West, K.L.; Silva-Krott, I.; Landrau-Giovannetti, N.; Rotstein, D.; Saliki, J.; Raverty, S.; Nielsen, O.; Popov, V.L.; Davis, N.; Walker, W.A.; et al. Novel cetacean morbillivirus in a rare Fraser’s dolphin (Lagenodelphis hosei) stranding from Maui, Hawai’i. Sci. Rep. 2021, 11, 15986. [Google Scholar][Green Version]
- Rima, B.K.; Collin, A.M.; Earle, J.A. Completion of the sequence of a cetacean morbillivirus and comparative analysis of the complete genome sequences of four morbilliviruses. Virus Genes 2005, 30, 113–119. [Google Scholar] [CrossRef]
- Barrett, T.; Visser, I.K.G.; Mamaev, L.; Goatley, L.; Bressem, M.-F.V.; Osterhaus, A.D.M.E. Dolphin and porpoise morbilliviruses are genetically distinct from phocine distemper virus. Virology 1993, 193, 1010–1012. [Google Scholar] [CrossRef]
- Krafft, A.; Lichy, J.H.; Lipscomb, T.P.; Klaunberg, B.A.; Kennedy, S.; Taubenberger, J.K. Postmortem diagnosis of morbillivirus infection in bottlenose dolphins (Tursiops truncatus) in the Atlantic and Gulf of Mexico epizootics by polymerase chain reaction-based assay. J. Wildl. Dis. 1995, 31, 410–415. [Google Scholar] [CrossRef]
- Saliki, J.T.; Cooper, E.J.; Gustavson, J.P. Emerging morbillivirus infections of marine mammals—Development of two diagnostic approaches. Ann. N. Y. Acad. Sci. 2002, 969, 51–59. [Google Scholar] [CrossRef] [PubMed]
- Taubenberger, J.K.; Tsai, M.; Krafft, A.E.; Lichy, J.H.; Reid, A.H.; Schulman, Y.; Lipscomb, T.P. Two morbilliviruses implicated in bottlenose dolphin epizootics. Emerg. Infect. Dis. 1996, 2, 213–216. [Google Scholar]
- Groch, K.R.; Taniwaki, S.A.; Favero, C.M.; Brandao, P.E.; Diaz-Delgado, J.; Fernandez, A.; Catao-Dias, J.L.; Sierra, E. A novel real-time PCR to detect Cetacean morbillivirus in Atlantic cetaceans. J. Virol. Methods 2020, 285, 113964. [Google Scholar] [CrossRef]
- Van Bressem, M.F.; Visser, I.K.; Van de Bildt, M.W.; Teppema, J.S.; Raga, J.A.; Osterhaus, A.D. Morbillivirus infection in Mediterranean striped dolphins (Stenella coeruleoalba). Vet. Rec. 1991, 129, 471–472. [Google Scholar] [CrossRef] [PubMed]
- Nielsen, O.; Smith, G.; Weingartl, H.; Lair, S.; Measures, L. Use of a SLAM transfected Vero cell line to isolate and characterize marine mammal morbilliviruses using an experimental ferret model. J. Wildl. Dis. 2008, 44, 600–611. [Google Scholar] [CrossRef]
- Jo, W.K.; Kruppa, J.; Habierski, A.; van de Bildt, M.; Mazzariol, S.; Di Guardo, G.; Siebert, U.; Kuiken, T.; Jung, K.; Osterhaus, A.; et al. Evolutionary evidence for multi-host transmission of cetacean morbillivirus. Emerg. Microbes Infect. 2018, 7, 201. [Google Scholar] [CrossRef] [PubMed]
- Peletto, S.; Caruso, C.; Cerutti, F.; Modesto, P.; Biolatti, C.; Pautasso, A.; Grattarola, C.; Giorda, F.; Mazzariol, S.; Mignone, W. Efficient isolation on Vero. DogSLAMtag cells and full genome characterization of Dolphin Morbillivirus (DMV) by next generation sequencing. Sci. Rep. 2018, 8, 860. [Google Scholar] [CrossRef]
- Groch, K.R.; Santos-Neto, E.B.; Díaz-Delgado, J.; Ikeda, J.M.P.; Carvalho, R.R.; Oliveira, R.B.; Guari, E.B.; Bisi, T.L.; Azevedo, A.F.; Lailson-Brito, J.; et al. Guiana dolphin unusual mortality event and link to cetacean morbillivirus, Brazil. Emerg. Infect. Dis. 2018, 24, 1349–1354. [Google Scholar] [CrossRef]
- Groch, K.R.; Diaz-Delgado, J.; Santos-Neto, E.B.; Ikeda, J.M.P.; Carvalho, R.R.; Oliveira, R.B.; Guari, E.B.; Flach, L.; Sierra, E.; Godinho, A.I.; et al. The pathology of cetacean morbillivirus infection and comorbidities in Guiana dolphins during an unusual mortality event (Brazil, 2017–2018). Vet. Pathol. 2020, 57, 845–857. [Google Scholar] [CrossRef]
- Cunha, H.A.; Santos-Neto, E.B.; Carvalho, R.R.; Ikeda, J.M.; Groch, K.R.; Díaz-Delgado, J.; Guari, E.B.; Brião, J.A.; Oliveira, R.B.; Flach, L. Epidemiological features of the first Unusual Mortality Event linked to cetacean morbillivirus in the South Atlantic (Brazil, 2017–2018). Mar. Mamm. Sci. 2021, 37, 1375–1390. [Google Scholar] [CrossRef]
- Groch, K.R.; Kolesnikovas, C.K.M.; de Castilho, P.V.; Moreira, L.M.P.; Barros, C.; Morais, C.R.; Renault-Braga, E.P.; Sierra, E.; Fernandez, A.; Catao-Dias, J.L.; et al. Cetacean morbillivirus in Southern right whales, Brazil. Transbound. Emerg. Dis. 2019, 66, 606–610. [Google Scholar] [CrossRef] [PubMed]
- Groch, K.R.; Blazquez, D.N.H.; Marcondes, M.C.C.; Santos, J.; Colosio, A.; Diaz Delgado, J.; Catao-Dias, J.L. Cetacean morbillivirus in Humpback whales’ exhaled breath. Transbound. Emerg. Dis. 2021, 68, 1736–1743. [Google Scholar] [CrossRef] [PubMed]
- de Amorim, D.B.; de Camargo, L.J.; Ribeiro, P.R.; Budaszewski, R.D.F.; Menegatt, J.C.O.; Paz, M.C.; de Castro, L.T.; Almeida, P.R.; Olegario, J.C.; Canal, C.W.; et al. Characterization of Cetacean Morbillivirus in Humpback Whales, Brazil. Emerg. Infect. Dis. 2024, 30, 1296–1298. [Google Scholar] [CrossRef] [PubMed]
- Costa-Silva, S.; Sacristan, C.; Duarte-Benvenuto, A.; Ewbank, A.C.; Soares, R.M.; Carvalho, V.L.; P, V.C.; Cremer, M.J.; Vieira, J.V.; Lemos, G.G.; et al. Morbillivirus and coronavirus survey in stranded cetaceans, Brazil. PLoS ONE 2025, 20, e0316050. [Google Scholar] [CrossRef]
- Groch, K.R.; Jerdy, H.; Marcondes, M.C.; Barbosa, L.A.; Ramos, H.G.; Pavanelli, L.; Fornells, L.A.M.; Silva, M.B.; Souza, G.S.; Kanashiro, M.M.; et al. Cetacean morbillivirus infection in a killer whale (Orcinus orca) from Brazil. J. Comp. Pathol. 2020, 181, 26–32. [Google Scholar] [CrossRef]
- Díaz-Delgado, J.; Groch, K.R.; Ressio, R.; Riskallah, I.P.; Sierra, E.; Sacchini, S.; Quesada-Canales, Ó.; Arbelo, M.; Fernández, A.; Santos-Neto, E. Comparative immunopathology of Cetacean morbillivirus infection in free-ranging dolphins from Western Mediterranean, Northeast-Central, and Southwestern Atlantic. Front. Immunol. 2019, 10, 485. [Google Scholar] [CrossRef]
- Díaz-Delgado, J.; Groch, K.R.; Sierra, E.; Sacchini, S.; Zucca, D.; Quesada-Canales, Ó.; Arbelo, M.; Fernández, A.; Santos, E.; Ikeda, J. Comparative histopathologic and viral immunohistochemical studies on CeMV infection among Western Mediterranean, Northeast-Central, and Southwestern Atlantic cetaceans. PLoS ONE 2019, 14, e0213363. [Google Scholar] [CrossRef]
- Bellière, E.N.; Esperón, F.; Sánchez-Vizcaíno, J.M. Genetic comparison among dolphin morbillivirus in the 1990–1992 and 2006–2008 Mediterranean outbreaks. Infect. Genet. Evol. 2011, 11, 1913–1920. [Google Scholar] [CrossRef]
- Budaszewski, R.F.; Pinto, L.D.; Weber, M.N.; Caldart, E.T.; Alves, C.D.; Martella, V.; Ikuta, N.; Lunge, V.R.; Canal, C.W. Genotyping of canine distemper virus strains circulating in Brazil from 2008 to 2012. Virus Res. 2014, 180, 76–83. [Google Scholar] [CrossRef]
- Kumar, S.; Stecher, G.; Tamura, K. MEGA7: Molecular Evolutionary Genetics Analysis Version 7.0 for Bigger Datasets. Mol. Biol. Evol. 2016, 33, 1870–1874. [Google Scholar] [CrossRef]
- Van Bressem, M.-F.; Duignan, P.J.; Banyard, A.; Barbieri, M.; Colgrove, K.M.; De Guise, S.; Di Guardo, G.; Dobson, A.; Domingo, M.; Fauquier, D.; et al. Cetacean morbillivirus: Current knowledge and future directions. Viruses 2014, 6, 5145–5181. [Google Scholar] [CrossRef] [PubMed]
- Bolt, G.; Blixenkrone-Møller, M.; Gottschalck, E.; Wishaupt, R.G.; Welsh, M.J.; Earle, J.A.P.; Rima, B.K. Nucleotide and deduced amino acid sequences of the matrix (M) and fusion (F) protein genes of cetacean morbilliviruses isolated from a porpoise and a dolphin. Virus Res. 1994, 34, 291–304. [Google Scholar] [CrossRef] [PubMed]
- Rima, B.K.; Earle, J.A.; Baczko, K.; ter Meulen, V.; Liebert, U.G.; Carstens, C.; Carabana, J.; Caballero, M.; Celma, M.L.; Fernandez-Munoz, R. Sequence divergence of measles virus haemagglutinin during natural evolution and adaptation to cell culture. J. Gen. Virol. 1997, 78 Pt 1, 97–106. [Google Scholar] [CrossRef] [PubMed]
- Tatsuo, H.; Ono, N.; Tanaka, K.; Yanagi, Y. SLAM (CDw150) is a cellular receptor for measles virus. Nature 2000, 406, 893–897. [Google Scholar] [CrossRef]
- Noyce, R.S.; Bondre, D.G.; Ha, M.N.; Lin, L.-T.; Sisson, G.; Tsao, M.-S.; Richardson, C.D. Tumor cell marker PVRL4 (nectin 4) is an epithelial cell receptor for measles virus. PLoS Pathog. 2011, 7, e1002240. [Google Scholar] [CrossRef]
- Mühlebach, M.D.; Mateo, M.; Sinn, P.L.; Prüfer, S.; Uhlig, K.M.; Leonard, V.H.; Navaratnarajah, C.K.; Frenzke, M.; Wong, X.X.; Sawatsky, B. Adherens junction protein nectin-4 is the epithelial receptor for measles virus. Nature 2011, 480, 530–533. [Google Scholar] [CrossRef]
- Ohishi, K.; Maruyama, T.; Seki, F.; Takeda, M. Marine Morbilliviruses: Diversity and Interaction with Signaling Lymphocyte Activation Molecules. Viruses 2019, 11, 606. [Google Scholar] [CrossRef]
- Rima, B.; Balkema-Buschmann, A.; Dundon, W.G.; Duprex, P.; Easton, A.; Fouchier, R.; Kurath, G.; Lamb, R.; Lee, B.; Rota, P. ICTV virus taxonomy profile: Paramyxoviridae. J. Gen. Virol. 2019, 100, 1593–1594. [Google Scholar] [CrossRef]
- McIlhatton, M.A.; Curran, M.D.; Rima, B.K. Nucleotide sequence analysis of the large (L) genes of phocine distemper virus and canine distemper virus (corrected sequence). J. Gen. Virol. 1997, 78 Pt 3, 571–576. [Google Scholar] [CrossRef]
Primer No. | nt Gap (nt Position) * | Primer Name | Target Gene | 5′ → 3′ Sequence (Sense) | Tm | nt Position * | Template [Reference] |
---|---|---|---|---|---|---|---|
1 | 985 (1–985) | DMV-1F | 3′ leading | ACCARACAAAGYTGGSTARGG (+) | 58 | 1–21 | DMV [29] |
2 | GDMV-1R | N | CCTTGGTTTATTCCCTGGTGT (−) | 58 | 835–855 | GDMV [20] | |
3 | DMV-2R | N | AATAGTCATCCGCCTCATCC (−) | 57 | 479–498 | DMV [this study] | |
4 | DMV-3F | N | ACCCAGATGTCAGCATCAGA (+) | 58 | 388–407 | DMV [this study] | |
5 | CDV-3F | N | ACAGRATTGCYGAGGACYTRT (+) | 59 | 851–871 | CDV [30] | |
6 | CDV-4R | N | CARRATAACCATGTAYGGTGC (−) | 58 | 1036–1056 | CDV [30] | |
7 | 52 (4137–4189) | GDMV-5F | M | CACAAAGGTTCAGGGTGGTC (+) | 59 | 3894–3913 | GDMV [this study] |
8 | GDMV-5R | M | TGAACTCCTGTGGGACTGAA (−) | 58 | 4364–4383 | GDMV [this study] | |
9 | 150 (5462–5612) | GDMV-7F | F | CAAATCCATTGGGGAAATCT (+) | 53 | 5352–5371 | GDMV [this study] |
10 | GDMV-7R | F | TTGTTAATATCTCCGCCAAGAG (−) | 56 | 5992–6013 | GDMV [this study] | |
11 | 524 (7387–7911) | GDMV-10F | H | CCAAGACCGAGAAATCATAGAG (+) | 56 | 7136–7157 | GDMV [this study] |
12 | GDMV-10R | H | AACGGTTCATCTTTGTAGCC (−) | 56 | 8015–8034 | GDMV [this study] | |
13 | 550 (13,375–13,924) | GDMV-13F | L | CCCCTATCATAGAAAAGGATG (+) | 43 | 13,246–13,266 | GDMV [this study] |
14 | GDMV-13R | L | TTTAACTGCTCCTCTCCTGA (−) | 45 | 14,062–14,081 | GDMV [this study] |
Target Gene | Primer Combinations a | Annealing Temperature | Consensus Obtained (bp) | nt Position in the Reference Genome b |
---|---|---|---|---|
3′ leading and N | 1–2 followed by 1–3 | 55 | 854 | 108–787 |
N | 1–2 followed by 4–2 | 55 | 388 | 434–801 |
N | 1–2 followed by 4–6 | 55 | 334 | 555–888 |
N | 5–6 | 59 | 122 | 867–989 |
M | 7–8 | 55 | 405 | 3947–4351 |
F | 9–10 | 52 | 512 | 5408–5919 |
H | 11–12 | 55 | 717 | 7249–7965 |
L | 13–14 | 52 | 728 | 13,301–14,030 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Groch, K.R.; Miyagi, S.A.T.; Díaz-Delgado, J.; Santos-Neto, E.B.; Lailson-Brito, J.; Brandão, P.E.; Catão-Dias, J.L. Complete Genome Sequencing of the Divergent Guiana Dolphin Morbillivirus (GDMV), Brazil. Viruses 2025, 17, 582. https://doi.org/10.3390/v17040582
Groch KR, Miyagi SAT, Díaz-Delgado J, Santos-Neto EB, Lailson-Brito J, Brandão PE, Catão-Dias JL. Complete Genome Sequencing of the Divergent Guiana Dolphin Morbillivirus (GDMV), Brazil. Viruses. 2025; 17(4):582. https://doi.org/10.3390/v17040582
Chicago/Turabian StyleGroch, Kátia Regina, Sueli Akemi Taniwaki Miyagi, Josué Díaz-Delgado, Elitieri B. Santos-Neto, José Lailson-Brito, Paulo Eduardo Brandão, and José Luiz Catão-Dias. 2025. "Complete Genome Sequencing of the Divergent Guiana Dolphin Morbillivirus (GDMV), Brazil" Viruses 17, no. 4: 582. https://doi.org/10.3390/v17040582
APA StyleGroch, K. R., Miyagi, S. A. T., Díaz-Delgado, J., Santos-Neto, E. B., Lailson-Brito, J., Brandão, P. E., & Catão-Dias, J. L. (2025). Complete Genome Sequencing of the Divergent Guiana Dolphin Morbillivirus (GDMV), Brazil. Viruses, 17(4), 582. https://doi.org/10.3390/v17040582