Neurobiological Alterations Induced by SARS-CoV-2: Insights from Variant-Specific Host Gene Expression Patterns in hACE2-Expressing Mice
Abstract
1. Introduction
2. Materials and Methods
2.1. In Vivo Animal Experiments
2.2. Reverse Transcription-Polymerase Chain Reaction (RT-PCR)
2.3. Transcriptome Profiling Analysis
2.4. Immune Cell Infiltration and Protein–Protein Interaction (PPI) Analysis
2.5. Statistical Analyses
3. Results and Discussion
3.1. Brain Viral Load After Infection with VOCs
3.2. Dynamics of VOCs Pathogenesis in the Brain Determined via Hierarchical Clustering
3.3. DEGs and Pathway Enrichment Analyses Revealed Variant-Specific Responses in the Brain
3.4. Impacts of VOCs on Immune Cell Infiltration Dynamics
3.5. Elucidation of the Shared and Unique Molecular Signatures of VOCs via a DEGs Network Analysis
3.6. Experimental Validation via RT-qPCR
4. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Firouzabadi, N.; Ghasemiyeh, P.; Moradishooli, F.; Mohammadi-Samani, S. Update on the effectiveness of COVID-19 vaccines on different variants of SARS-CoV-2. Int. Immunopharmacol. 2023, 117, 109968. [Google Scholar] [CrossRef] [PubMed]
- Mohandas, S.; Jagannathan, P.; Henrich, T.J.; Sherif, Z.A.; Bime, C.; Quinlan, E.; Portman, M.A.; Gennaro, M.; Rehman, J. Immune mechanisms underlying COVID-19 pathology and post-acute sequelae of SARS-CoV-2 infection (PASC). Elife 2023, 12, e86014. [Google Scholar] [CrossRef] [PubMed]
- Natekar, J.P.; Pathak, H.; Stone, S.; Kumari, P.; Sharma, S.; Auroni, T.T.; Arora, K.; Rothan, H.A.; Kumar, M. Differential pathogenesis of SARS-CoV-2 variants of concern in human ACE2-expressing mice. Viruses 2022, 14, 1139. [Google Scholar] [CrossRef] [PubMed]
- Shao, W.; Chen, X.; Zheng, C.; Liu, H.; Wang, G.; Zhang, B.; Li, Z.; Zhang, W. Effectiveness of COVID-19 vaccines against SARS-CoV-2 variants of concern in real-world: A literature review and meta-analysis. Emerg. Microbes Infect. 2022, 11, 2383–2392. [Google Scholar] [CrossRef] [PubMed]
- Jin, Y.; Yang, H.; Ji, W.; Wu, W.; Chen, S.; Zhang, W.; Duan, G. Virology, epidemiology, pathogenesis, and control of COVID-19. Viruses 2020, 12, 372. [Google Scholar] [CrossRef]
- Rothan, H.A.; Acharya, A.; Reid, S.P.; Kumar, M.; Byrareddy, S.N. Molecular aspects of COVID-19 differential pathogenesis. Pathogens 2020, 9, 538. [Google Scholar] [CrossRef]
- Proust, A.; Queval, C.J.; Harvey, R.; Adams, L.; Bennett, M.; Wilkinson, R.J. Differential effects of SARS-CoV-2 variants on central nervous system cells and blood–brain barrier functions. J. Neuroinflamm. 2023, 20, 184. [Google Scholar] [CrossRef] [PubMed]
- Torabi, S.H.; Riahi, S.M.; Ebrahimzadeh, A.; Salmani, F. Changes in symptoms and characteristics of COVID-19 patients across different variants: Two years study using neural network analysis. BMC Infect. Dis. 2023, 23, 838. [Google Scholar] [CrossRef]
- Munblit, D.; Nicholson, T.R.; Needham, D.M.; Seylanova, N.; Parr, C.; Chen, J.; Kokorina, A.; Sigfrid, L.; Buonsenso, D.; Bhatnagar, S. Studying the post-COVID-19 condition: Research challenges, strategies, and importance of Core Outcome Set development. BMC Med. 2022, 20, 50. [Google Scholar] [CrossRef] [PubMed]
- Wenting, A.; Gruters, A.; van Os, Y.; Verstraeten, S.; Valentijn, S.; Ponds, R.; de Vugt, M. COVID-19 neurological manifestations and underlying mechanisms: A scoping review. Front. Psychiatry 2020, 11, 860. [Google Scholar] [CrossRef] [PubMed]
- Almutairi, M.M.; Sivandzade, F.; Albekairi, T.H.; Alqahtani, F.; Cucullo, L. Neuroinflammation and Its Impact on the Pathogenesis of COVID-19. Front. Med. 2021, 8, 745789. [Google Scholar] [CrossRef]
- Livieratos, A.; Gogos, C.; Akinosoglou, K. Impact of Prior COVID-19 Immunization and/or Prior Infection on Immune Responses and Clinical Outcomes. Viruses 2024, 16, 685. [Google Scholar] [CrossRef] [PubMed]
- Wise, J. Covid-19: Symptomatic infection with omicron variant is milder and shorter than with delta, study reports. BMJ Br. Med. J. 2022, 377. [Google Scholar] [CrossRef]
- Arabi, M.; Al-Najjar, Y.; Mhaimeed, N.; Salameh, M.A.; Paul, P.; AlAnni, J.; Abdelati, A.A.; Laswi, I.; Khanjar, B.; Al-Ali, D.; et al. Severity of the Omicron SARS-CoV-2 variant compared with the previous lineages: A systematic review. J. Cell Mol. Med. 2023, 27, 1443–1464. [Google Scholar] [CrossRef] [PubMed]
- Huang, Y.; Yang, C.; Xu, X.-f.; Xu, W.; Liu, S.-w. Structural and functional properties of SARS-CoV-2 spike protein: Potential antivirus drug development for COVID-19. Acta Pharmacol. Sin. 2020, 41, 1141–1149. [Google Scholar] [CrossRef] [PubMed]
- Jeong, H.; Woo Lee, Y.; Park, I.H.; Noh, H.; Kim, S.-H.; Kim, J.; Jeon, D.; Jang, H.J.; Oh, J.; On, D. Comparison of the pathogenesis of SARS-CoV-2 infection in K18-hACE2 mouse and Syrian golden hamster models. Dis. Models Mech. 2022, 15, dmm049632. [Google Scholar] [CrossRef] [PubMed]
- Tarrés-Freixas, F.; Trinité, B.; Pons-Grífols, A.; Romero-Durana, M.; Riveira-Muñoz, E.; Ávila-Nieto, C.; Pérez, M.; Garcia-Vidal, E.; Perez-Zsolt, D.; Muñoz-Basagoiti, J. Heterogeneous infectivity and pathogenesis of SARS-CoV-2 variants beta, delta and omicron in transgenic K18-hACE2 and wildtype mice. Front. Microbiol. 2022, 13, 840757. [Google Scholar] [CrossRef] [PubMed]
- Zheng, J.; Wong, L.-Y.R.; Li, K.; Verma, A.K.; Ortiz, M.E.; Wohlford-Lenane, C.; Leidinger, M.R.; Knudson, C.M.; Meyerholz, D.K.; McCray Jr, P.B. COVID-19 treatments and pathogenesis including anosmia in K18-hACE2 mice. Nature 2021, 589, 603–607. [Google Scholar] [CrossRef] [PubMed]
- Aw, Z.Q.; Mok, C.K.; Wong, Y.H.; Chen, H.; Mak, T.M.; Lin, R.T.; Lye, D.C.; Tan, K.S.; Chu, J.J.H. Early pathogenesis profiles across SARS-CoV-2 variants in K18-hACE2 mice revealed differential triggers of lung damages. Front. Immunol. 2022, 13, 950666. [Google Scholar] [CrossRef] [PubMed]
- Rothan, H.A.; Kumari, P.; Stone, S.; Natekar, J.P.; Arora, K.; Auroni, T.T.; Kumar, M. SARS-CoV-2 infects primary neurons from human ACE2 expressing mice and upregulates genes involved in the inflammatory and necroptotic pathways. Pathogens 2022, 11, 257. [Google Scholar] [CrossRef] [PubMed]
- Kumar, M.; Belcaid, M.; Nerurkar, V.R. Identification of host genes leading to West Nile virus encephalitis in mice brain using RNA-seq analysis. Sci. Rep. 2016, 6, 26350. [Google Scholar] [CrossRef]
- Iqbal, N.; Kumar, P. Integrated COVID-19 Predictor: Differential expression analysis to reveal potential biomarkers and prediction of coronavirus using RNA-Seq profile data. Comput. Biol. Med. 2022, 147, 105684. [Google Scholar] [CrossRef] [PubMed]
- Bolger, A.M.; Lohse, M.; Usadel, B. Trimmomatic: A flexible trimmer for Illumina sequence data. Bioinformatics 2014, 30, 2114–2120. [Google Scholar] [CrossRef]
- Pertea, M.; Pertea, G.M.; Antonescu, C.M.; Chang, T.-C.; Mendell, J.T.; Salzberg, S.L. StringTie enables improved reconstruction of a transcriptome from RNA-seq reads. Nat. Biotechnol. 2015, 33, 290–295. [Google Scholar] [CrossRef] [PubMed]
- Batut, B.; van den Beek, M.; Doyle, M.A.; Soranzo, N. RNA-seq data analysis in galaxy. RNA Bioinform. 2021, 367–392. [Google Scholar]
- Yang, R.C.; Huang, K.; Zhang, H.P.; Li, L.; Tan, C.; Chen, H.C.; Jin, M.L.; Wang, X.R. Transcriptional landscape of human neuroblastoma cells in response to SARS-CoV-2. BMC Neurosci. 2022, 23, 43. [Google Scholar] [CrossRef] [PubMed]
- Sun, S.; Guo, W.; Wang, Z.; Wang, X.; Zhang, G.; Zhang, H.; Li, R.; Gao, Y.; Qiu, B.; Tan, F. Development and validation of an immune-related prognostic signature in lung adenocarcinoma. Cancer Med. 2020, 9, 5960–5975. [Google Scholar] [CrossRef] [PubMed]
- Miao, Y.-R.; Xia, M.; Luo, M.; Luo, T.; Yang, M.; Guo, A.-Y. ImmuCellAI-mouse: A tool for comprehensive prediction of mouse immune cell abundance and immune microenvironment depiction. Bioinformatics 2022, 38, 785–791. [Google Scholar] [CrossRef] [PubMed]
- Wickham, H.; Chang, W.; Wickham, M.H. Package ‘ggplot2’. Create elegant data visualisations using the grammar of graphics. Version 2016, 2, 1–189. [Google Scholar]
- Kohl, M.; Wiese, S.; Warscheid, B. Cytoscape: Software for visualization and analysis of biological networks. In Data Mining in Proteomics: From Standards to Applications; Springer: Berlin/Heidelberg, Germany, 2011; pp. 291–303. [Google Scholar]
- Cao, L.; Chen, Y.; Zhang, M.; Xu, D.-q.; Liu, Y.; Liu, T.; Liu, S.-x.; Wang, P. Identification of hub genes and potential molecular mechanisms in gastric cancer by integrated bioinformatics analysis. PeerJ 2018, 6, e5180. [Google Scholar] [CrossRef] [PubMed]
- Ma, H.; He, Z.; Chen, J.; Zhang, X.; Song, P. Identifying of biomarkers associated with gastric cancer based on 11 topological analysis methods of CytoHubba. Sci. Rep. 2021, 11, 1331. [Google Scholar] [CrossRef]
- Rabaan, A.A.; Al-Ahmed, S.H.; Muhammad, J.; Khan, A.; Sule, A.A.; Tirupathi, R.; Mutair, A.A.; Alhumaid, S.; Al-Omari, A.; Dhawan, M.; et al. Role of Inflammatory Cytokines in COVID-19 Patients: A Review on Molecular Mechanisms, Immune Functions, Immunopathology and Immunomodulatory Drugs to Counter Cytokine Storm. Vaccines 2021, 9, 436. [Google Scholar] [CrossRef] [PubMed]
- Khalil, B.A.; Elemam, N.M.; Maghazachi, A.A. Chemokines and chemokine receptors during COVID-19 infection. Comput. Struct. Biotechnol. J. 2021, 19, 976–988. [Google Scholar] [CrossRef] [PubMed]
- Suvarna, K.; Biswas, D.; Pai, M.G.J.; Acharjee, A.; Bankar, R.; Palanivel, V.; Salkar, A.; Verma, A.; Mukherjee, A.; Choudhury, M.; et al. Proteomics and Machine Learning Approaches Reveal a Set of Prognostic Markers for COVID-19 Severity With Drug Repurposing Potential. Front. Physiol. 2021, 12, 652799. [Google Scholar] [CrossRef]
- Navhaya, L.T.; Blessing, D.M.; Yamkela, M.; Godlo, S.; Makhoba, X.H. A comprehensive review of the interaction between COVID-19 spike proteins with mammalian small and major heat shock proteins. Biomol. Concepts 2024, 15, 20220027. [Google Scholar] [CrossRef] [PubMed]
- Sun, B.; Tang, N.; Peluso, M.J.; Iyer, N.S.; Torres, L.; Donatelli, J.L.; Munter, S.E.; Nixon, C.C.; Rutishauser, R.L.; Rodriguez-Barraquer, I.; et al. Characterization and Biomarker Analyses of Post-COVID-19 Complications and Neurological Manifestations. Cells 2021, 10, 386. [Google Scholar] [CrossRef]
- Kanwal, A.; Zhang, Z. Exploring common pathogenic association between Epstein Barr virus infection and long-COVID by integrating RNA-Seq and molecular dynamics simulations. Front. Immunol. 2024, 15, 1435170. [Google Scholar] [CrossRef]
- Rice, J.M.; Zweifach, A.; Lynes, M.A. Metallothionein regulates intracellular zinc signaling during CD4+ T cell activation. BMC Immunol. 2016, 17, 13. [Google Scholar] [CrossRef] [PubMed]
- Dai, H.; Wang, L.; Li, L.; Huang, Z.; Ye, L. Metallothionein 1: A New Spotlight on Inflammatory Diseases. Front. Immunol. 2021, 12, 739918. [Google Scholar] [CrossRef] [PubMed]
- Radvak, P.; Kwon, H.-J.; Kosikova, M.; Ortega-Rodriguez, U.; Xiang, R.; Phue, J.-N.; Shen, R.-F.; Rozzelle, J.; Kapoor, N.; Rabara, T. SARS-CoV-2 B. 1.1. 7 (alpha) and B. 1.351 (beta) variants induce pathogenic patterns in K18-hACE2 transgenic mice distinct from early strains. Nat. Commun. 2021, 12, 6559. [Google Scholar] [CrossRef] [PubMed]
- Nagano, T.; Nakano, M.; Nakashima, A.; Onishi, K.; Yamao, S.; Enari, M.; Kikkawa, U.; Kamada, S. Identification of cellular senescence-specific genes by comparative transcriptomics. Sci. Rep. 2016, 6, 31758. [Google Scholar] [CrossRef] [PubMed]
- Saul, D.; Kosinsky, R.L.; Atkinson, E.J.; Doolittle, M.L.; Zhang, X.; LeBrasseur, N.K.; Pignolo, R.J.; Robbins, P.D.; Niedernhofer, L.J.; Ikeno, Y.; et al. A new gene set identifies senescent cells and predicts senescence-associated pathways across tissues. Nat. Commun. 2022, 13, 4827. [Google Scholar] [CrossRef] [PubMed]
- Kumari, R.; Jat, P. Mechanisms of cellular senescence: Cell cycle arrest and senescence associated secretory phenotype. Front. Cell Dev. Biol. 2021, 9, 645593. [Google Scholar] [CrossRef] [PubMed]
- Xu, P.; Wang, M.; Song, W.-m.; Wang, Q.; Yuan, G.-C.; Sudmant, P.H.; Zare, H.; Tu, Z.; Orr, M.E.; Zhang, B. The landscape of human tissue and cell type specific expression and co-regulation of senescence genes. Mol. Neurodegener. 2022, 17, 5. [Google Scholar] [CrossRef] [PubMed]
- Yang, R.C.; Huang, K.; Zhang, H.P.; Li, L.; Zhang, Y.F.; Tan, C.; Chen, H.C.; Jin, M.L.; Wang, X.R. SARS-CoV-2 productively infects human brain microvascular endothelial cells. J. Neuroinflamm. 2022, 19, 149. [Google Scholar] [CrossRef] [PubMed]
- Wu, D.; Wu, X.; Huang, J.; Rao, Q.; Zhang, Q.; Zhang, W. Lymphocyte subset alterations with disease severity, imaging manifestation, and delayed hospitalization in COVID-19 patients. BMC Infect. Dis. 2021, 21, 631. [Google Scholar] [CrossRef] [PubMed]
- Gil-Manso, S.; Herrero-Quevedo, D.; Carbonell, D.; Martínez-Bonet, M.; Bernaldo-de-Quirós, E.; Kennedy-Batalla, R.; Gallego-Valle, J.; López-Esteban, R.; Blázquez-López, E.; Miguens-Blanco, I. Multidimensional analysis of immune cells from COVID-19 patients identified cell subsets associated with the severity at hospital admission. PLoS Pathog. 2023, 19, e1011432. [Google Scholar] [CrossRef]
- Diao, B.; Wang, C.; Tan, Y.; Chen, X.; Liu, Y.; Ning, L.; Chen, L.; Li, M.; Liu, Y.; Wang, G. Reduction and functional exhaustion of T cells in patients with coronavirus disease 2019 (COVID-19). Front. Immunol. 2020, 11, 827. [Google Scholar] [CrossRef] [PubMed]
- Peng, X.; Ouyang, J.; Isnard, S.; Lin, J.; Fombuena, B.; Zhu, B.; Routy, J.-P. Sharing CD4+ T cell loss: When COVID-19 and HIV collide on immune system. Front. Immunol. 2020, 11, 596631. [Google Scholar] [CrossRef]
- Laine, L.; Skön, M.; Väisänen, E.; Julkunen, I.; Österlund, P. SARS-CoV-2 variants Alpha, Beta, Delta and Omicron show a slower host cell interferon response compared to an early pandemic variant. Front. Immunol. 2022, 13, 1016108. [Google Scholar] [CrossRef]
Gene (Accession No.) | Primer Sequence (5′–3′) |
---|---|
IRF7 (NM_016850.3) | Forward: CCCCAGGATCATTTCTGGCA Reverse: AGGGTTCCTCGTAAACACGG |
CXC10 (NM_021274) | Forward: GGTCTGAGTCCTCGCTCAAG Reverse: GTCGCACCTCCACATAGCTT |
IL-6 (NM_000600) | Forward: CCAGGAGCCCAGCTATGAAC Reverse: CCCAGGGAGAAGGCAACTG |
Wuhan | Alpha | Beta | Delta | Omicron |
---|---|---|---|---|
CXCL10 | CXCL10 | CXCL10 | CXCL10 | CXCL10 |
LCN2 | LCN2 | LCN2 | CCL5 | CCL5 |
CCL2 | CCL5 | CCL5 | LCN2 | LCN2 |
CCL5 | CCL2 | SAA3 | CHIL3 | CCL2 |
SAA3 | SAA3 | CCL2 | CCL2 | ISG15 |
ISG15 | ISG15 | ISG15 | SAA3 | SAA33 |
CHIL3 | CHIL3 | CHIL3 | ISG15 | PLAC8 |
GBP2 | GBP2 | GBP2 | CCL4 | CCL4 |
IFIT3 | RSAD2 | IRF7 | PLAC8 | GBP2 |
IRF7 | CCL12 | PLAC8 | CXCL9 | CHIL3 |
Wuhan | Alpha | Beta | Delta | Omicron |
---|---|---|---|---|
DDN | GPR34 | NPTXR | HCRT | GPR17 |
3110035E14RIK | GKN3 | NEUROD6 | NPTXR | UGT8A |
KCNF1 | FCRLS | UGT8A | GPR34 | MYOC |
TBR1 | UGT8A | 3110035E14RIK | KCNG1 | GPR34 |
KCNG1 | TRIB22 | ADRA1D | FCRLs | GKN3 |
STX1A | MDGA1 | GPR17 | GKN3 | PADI2 |
HPCAL4 | NDST4 | GPR34 | MYOC | CHORDC1 |
NPTXR | TMEFF1 | RGS4 | BTBD17 | TMEM229A |
KCNV1 | SLC30A10 | MYL4 | GPR17 | TRIB2 |
RGS4 | SLC2A5 | KCNG1 | MIR124A-1HG | ELOVL6 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Jahantigh, H.R.; Elsharkawy, A.; Guglani, A.; Arora, K.; Patterson, L.D.; Kumar, M. Neurobiological Alterations Induced by SARS-CoV-2: Insights from Variant-Specific Host Gene Expression Patterns in hACE2-Expressing Mice. Viruses 2025, 17, 329. https://doi.org/10.3390/v17030329
Jahantigh HR, Elsharkawy A, Guglani A, Arora K, Patterson LD, Kumar M. Neurobiological Alterations Induced by SARS-CoV-2: Insights from Variant-Specific Host Gene Expression Patterns in hACE2-Expressing Mice. Viruses. 2025; 17(3):329. https://doi.org/10.3390/v17030329
Chicago/Turabian StyleJahantigh, Hamid Reza, Amany Elsharkawy, Anchala Guglani, Komal Arora, Lila D. Patterson, and Mukesh Kumar. 2025. "Neurobiological Alterations Induced by SARS-CoV-2: Insights from Variant-Specific Host Gene Expression Patterns in hACE2-Expressing Mice" Viruses 17, no. 3: 329. https://doi.org/10.3390/v17030329
APA StyleJahantigh, H. R., Elsharkawy, A., Guglani, A., Arora, K., Patterson, L. D., & Kumar, M. (2025). Neurobiological Alterations Induced by SARS-CoV-2: Insights from Variant-Specific Host Gene Expression Patterns in hACE2-Expressing Mice. Viruses, 17(3), 329. https://doi.org/10.3390/v17030329