REST Is Restless in Neuronal and Non-Neuronal Virus Infections: An In Silico Analysis-Based Perspective
Abstract
1. Introduction
2. REST Repression Mechanism and Neurons
2.1. REST Protein
2.2. Repressor Element 1 (RE-1) Binding by REST: REST Repressor Domains, Co-Repressors, RE-1 Binding Elements, and Epigenetic Modifications
2.3. REST Regulation
2.4. REST Biology in Neurons
2.5. REST in Virus-Infected Neuronal Cells
3. REST in Non-Neuronal Cells
3.1. Tumor-Suppressive Role of REST
3.2. Oncogenic Role of REST
3.3. REST in Virus-Infected Non-Neuronal Cells
4. Identification of REST Binding RE-1 Sites in Viral Genome: An In Silico Insight
5. Conclusions
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
Appendix A
Forward EBV Genome Search for RE-1 Element | ||||||||||
---|---|---|---|---|---|---|---|---|---|---|
Sl No | Sequence Length | Number of N | Number of Mismatch | Query | Hit Sequence | Mismatch Position | Mismatch Pairs | Type | Location in Genome | Gene ID |
1 | 20 | 1 | 1 | NNCAGCACCNGGACAGNNNC | AGCAGCACCAGCACAGCCAC | [11] | [’G-C’] | exon | 36098–37744 | “HHV4_EBNA-2” |
2 | 20 | 1 | 2 | NNCAGCACCNGGACAGNNNC | AGCAGCACCAGCACAGCCAC | [11, 19] | [’G-C’, ’C-C’] | exon | 36098–37744 | “HHV4_EBNA-2” |
3 | 20 | 1 | 2 | NNCAGCACCNGGACAGNNNC | AGCAGCACCAGCACAGCCAC | [11, 15] | [’G-C’, ’G-G’] | exon | 36098–37744 | “HHV4_EBNA-2” |
4 | 20 | 1 | 2 | NNCAGCACCNGGACAGNNNC | AGCAGCACCAGCACAGCCAC | [11, 14] | [’G-C’, ’A-A’] | exon | 36098–37744 | “HHV4_EBNA-2” |
5 | 20 | 1 | 2 | NNCAGCACCNGGACAGNNNC | AGCAGCACCAGCACAGCCAC | [11, 13] | [’G-C’, ’C-C’] | exon | 36098–37744 | “HHV4_EBNA-2” |
6 | 20 | 1 | 2 | NNCAGCACCNGGACAGNNNC | AGCAGCACCAGCACAGCCAC | [11, 12] | [’G-C’, ’A-A’] | exon | 36098–37744 | “HHV4_EBNA-2” |
7 | 20 | 1 | 2 | NNCAGCACCNGGACAGNNNC | AGCAGCACCAGCACAGCCAC | [10, 11] | [’G-G’, ’G-C’] | exon | 36098–37744 | “HHV4_EBNA-2” |
8 | 20 | 1 | 2 | NNCAGCACCNGGACAGNNNC | AGCAGCACCAGCACAGCCAC | [8, 11] | [’C-C’, ’G-C’] | exon | 36098–37744 | “HHV4_EBNA-2” |
9 | 20 | 1 | 2 | NNCAGCACCNGGACAGNNNC | AGCAGCACCAGCACAGCCAC | [7, 11] | [’C-C’, ’G-C’] | exon | 36098–37744 | “HHV4_EBNA-2” |
10 | 20 | 1 | 2 | NNCAGCACCNGGACAGNNNC | AGCAGCACCAGCACAGCCAC | [6, 11] | [’A-A’, ’G-C’] | exon | 36098–37744 | “HHV4_EBNA-2” |
11 | 20 | 1 | 2 | NNCAGCACCNGGACAGNNNC | AGCAGCACCAGCACAGCCAC | [5, 11] | [’C-C’, ’G-C’] | exon | 36098–37744 | “HHV4_EBNA-2” |
12 | 20 | 1 | 2 | NNCAGCACCNGGACAGNNNC | AGCAGCACCAGCACAGCCAC | [4, 11] | [’G-G’, ’G-C’] | exon | 36098–37744 | “HHV4_EBNA-2” |
13 | 20 | 1 | 2 | NNCAGCACCNGGACAGNNNC | AGCAGCACCAGCACAGCCAC | [3, 11] | [’A-A’, ’G-C’] | exon | 36098–37744 | “HHV4_EBNA-2” |
14 | 20 | 1 | 2 | NNCAGCACCNGGACAGNNNC | AGCAGCACCAGCACAGCCAC | [2, 11] | [’C-C’, ’G-C’] | exon | 36098–37744 | “HHV4_EBNA-2” |
15 | 23 | 4 | 2 | NNCAGCACCNNNNGGACAGNNNC | ACCAGCAGCACCAGCACAGCCAC | [7, 14] | [’C-G’, ’G-C’] | exon | 36098–37744 | “HHV4_EBNA-2” |
16 | 24 | 5 | 2 | NNCAGCACCNNNNNGGACAGNNNC | TACAGCAGCTGGATGTACAGCTAC | [7, 15] | [’C-G’, ’G-T’] | exon | 80382–82962 | “HHV4_EBNA-3A” |
17 | 29 | 10 | 2 | NNCAGCACCNNNNNNNNNNGGACAGNNNC | GCCACCACCAGCAGCACCAGCACAGCCAC | [4, 20] | [’G-C’, ’G-C’] | exon | 36098–37744 | “HHV4_EBNA-2” |
Reverse EBV genome search for RE-1 element | ||||||||||
Sl No | Sequence length | Number of N | Number of mismatch | Query | Hit sequence | mismatch position | mismatch pairs | Type | Location in genome | Gene id |
1 | 31 | 12 | 2 | NNCAGCACCNNNNNNNNNNNNGGACAGNNNC | GGCAGCGCCCGGGCCACCCGGGGAGAGTTCC | [6, 24] | [’A-G’, ’C-G’] | exon | 168749–169056 | “HHV4_LMP-1” |
Appendix B
References
- Chong, J.A.; Tapia-Ramirez, J.; Kim, S.; Toledo-Aral, J.J.; Zheng, Y.; Boutros, M.C.; Altshuller, Y.M.; Frohman, M.A.; Kraner, S.D.; Mandel, G. REST: A mammalian silencer protein that restricts sodium channel gene expression to neurons. Cell 1995, 80, 949–957. [Google Scholar] [CrossRef] [PubMed]
- Schoenherr, C.J.; Anderson, D.J. The neuron-restrictive silencer factor (NRSF): A coordinate repressor of multiple neuron-specific genes. Science 1995, 267, 1360–1363. [Google Scholar] [CrossRef] [PubMed]
- Coulson, J.M. Transcriptional regulation: Cancer, neurons and the REST. Curr. Biol. 2005, 15, R665–R668. [Google Scholar] [CrossRef] [PubMed]
- Hwang, J.Y.; Zukin, R.S. REST, a master transcriptional regulator in neurodegenerative disease. Curr. Opin. Neurobiol. 2018, 48, 193–200. [Google Scholar] [CrossRef] [PubMed]
- Ballas, N.; Mandel, G. The many faces of REST oversee epigenetic programming of neuronal genes. Curr. Opin. Neurobiol. 2005, 15, 500–506. [Google Scholar] [CrossRef]
- Ooi, L.; Wood, I.C. Chromatin crosstalk in development and disease: Lessons from REST. Nat. Rev. Genet. 2007, 8, 544–554. [Google Scholar] [CrossRef] [PubMed]
- Qureshi, I.A.; Mehler, M.F. Regulation of non-coding RNA networks in the nervous system—What’s the REST of the story? Neurosci. Lett. 2009, 466, 73–80. [Google Scholar] [CrossRef] [PubMed]
- Hwang, J.Y.; Aromolaran, K.A.; Zukin, R.S. The emerging field of epigenetics in neurodegeneration and neuroprotection. Nat. Rev. Neurosci. 2017, 18, 347–361. [Google Scholar] [CrossRef]
- Ballas, N.; Grunseich, C.; Lu, D.D.; Speh, J.C.; Mandel, G. REST and its corepressors mediate plasticity of neuronal gene chromatin throughout neurogenesis. Cell 2005, 121, 645–657. [Google Scholar] [CrossRef] [PubMed]
- Rodenas-Ruano, A.; Chavez, A.E.; Cossio, M.J.; Castillo, P.E.; Zukin, R.S. REST-dependent epigenetic remodeling promotes the developmental switch in synaptic NMDA receptors. Nat. Neurosci. 2012, 15, 1382–1390. [Google Scholar] [CrossRef] [PubMed]
- Hwang, J.Y.; Kaneko, N.; Noh, K.M.; Pontarelli, F.; Zukin, R.S. The gene silencing transcription factor REST represses miR-132 expression in hippocampal neurons destined to die. J. Mol. Biol. 2014, 426, 3454–3466. [Google Scholar] [CrossRef]
- Cortes-Sarabia, K.; Alarcon-Romero, L.D.C.; Flores-Alfaro, E.; Illades-Aguiar, B.; Vences-Velazquez, A.; Mendoza-Catalan, M.A.; Navarro-Tito, N.; Valdes, J.; Moreno-Godinez, M.E.; Ortuno-Pineda, C. Significant decrease of a master regulator of genes (REST/NRSF) in high-grade squamous intraepithelial lesion and cervical cancer. Biomed. J. 2021, 44, S171–S178. [Google Scholar] [CrossRef] [PubMed]
- Bruce, A.W.; Donaldson, I.J.; Wood, I.C.; Yerbury, S.A.; Sadowski, M.I.; Chapman, M.; Gottgens, B.; Buckley, N.J. Genome-wide analysis of repressor element 1 silencing transcription factor/neuron-restrictive silencing factor (REST/NRSF) target genes. Proc. Natl. Acad. Sci. USA 2004, 101, 10458–10463. [Google Scholar] [CrossRef] [PubMed]
- Mortazavi, A.; Leeper Thompson, E.C.; Garcia, S.T.; Myers, R.M.; Wold, B. Comparative genomics modeling of the NRSF/REST repressor network: From single conserved sites to genome-wide repertoire. Genome Res. 2006, 16, 1208–1221. [Google Scholar] [CrossRef] [PubMed]
- Calderone, A.; Jover, T.; Noh, K.M.; Tanaka, H.; Yokota, H.; Lin, Y.; Grooms, S.Y.; Regis, R.; Bennett, M.V.; Zukin, R.S. Ischemic insults derepress the gene silencer REST in neurons destined to die. J. Neurosci. 2003, 23, 2112–2121. [Google Scholar] [CrossRef] [PubMed]
- Formisano, L.; Noh, K.M.; Miyawaki, T.; Mashiko, T.; Bennett, M.V.; Zukin, R.S. Ischemic insults promote epigenetic reprogramming of mu opioid receptor expression in hippocampal neurons. Proc. Natl. Acad. Sci. USA 2007, 104, 4170–4175. [Google Scholar] [CrossRef]
- Noh, K.M.; Hwang, J.Y.; Follenzi, A.; Athanasiadou, R.; Miyawaki, T.; Greally, J.M.; Bennett, M.V.; Zukin, R.S. Repressor element-1 silencing transcription factor (REST)-dependent epigenetic remodeling is critical to ischemia-induced neuronal death. Proc. Natl. Acad. Sci. USA 2012, 109, E962–E971. [Google Scholar] [CrossRef]
- Kaneko, N.; Hwang, J.Y.; Gertner, M.; Pontarelli, F.; Zukin, R.S. Casein kinase 1 suppresses activation of REST in insulted hippocampal neurons and halts ischemia-induced neuronal death. J. Neurosci. 2014, 34, 6030–6039. [Google Scholar] [CrossRef]
- Gu, H.; Liang, Y.; Mandel, G.; Roizman, B. Components of the REST/CoREST/histone deacetylase repressor complex are disrupted, modified, and translocated in HSV-1-infected cells. Proc. Natl. Acad. Sci. USA 2005, 102, 7571–7576. [Google Scholar] [CrossRef] [PubMed]
- Pinnoji, R.C.; Bedadala, G.R.; George, B.; Holland, T.C.; Hill, J.M.; Hsia, S.C. Repressor element-1 silencing transcription factor/neuronal restrictive silencer factor (REST/NRSF) can regulate HSV-1 immediate-early transcription via histone modification. Virol. J. 2007, 4, 56. [Google Scholar] [CrossRef] [PubMed]
- Chakraborty, S.; Cheng, B.Y.; Edwards, D.L.; Gonzalez, J.C.; Chiu, D.K.; Zheng, H.; Scallan, C.; Guo, X.; Tan, G.S.; Coffey, G.P.; et al. Sialylated IgG induces the transcription factor REST in alveolar macrophages to protect against lung inflammation and severe influenza disease. Immunity 2025, 58, 182–196. [Google Scholar] [CrossRef]
- Valiya Veettil, M.; Dutta, D.; Bottero, V.; Bandyopadhyay, C.; Gjyshi, O.; Sharma-Walia, N.; Dutta, S.; Chandran, B. Glutamate secretion and metabotropic glutamate receptor 1 expression during Kaposi’s sarcoma-associated herpesvirus infection promotes cell proliferation. PLoS Pathog. 2014, 10, e1004389. [Google Scholar] [CrossRef] [PubMed]
- Valiya Veettil, M.; Krishna, G.; Roy, A.; Ghosh, A.; Dutta, D.; Kumar, B.; Chakraborty, S.; Anju, T.R.; Sharma-Walia, N.; Chandran, B. Kaposi’s Sarcoma-Associated Herpesvirus Infection Induces the Expression of Neuroendocrine Genes in Endothelial Cells. J. Virol. 2020, 94, e01692-19. [Google Scholar] [CrossRef] [PubMed]
- Ye, F.; Alvarez-Carbonell, D.; Nguyen, K.; Leskov, K.; Garcia-Mesa, Y.; Sreeram, S.; Valadkhan, S.; Karn, J. Recruitment of the CoREST transcription repressor complexes by Nerve Growth factor IB-like receptor (Nurr1/NR4A2) mediates silencing of HIV in microglial cells. PLoS Pathog. 2022, 18, e1010110. [Google Scholar] [CrossRef]
- Zhao, B. Epstein-Barr Virus B Cell Growth Transformation: The Nuclear Events. Viruses 2023, 15, 832. [Google Scholar] [CrossRef]
- Zimber-Strobl, U.; Strobl, L.J. EBNA2 and Notch signalling in Epstein-Barr virus mediated immortalization of B lymphocytes. Semin. Cancer Biol. 2001, 11, 423–434. [Google Scholar] [CrossRef] [PubMed]
- Friberg, A.; Thumann, S.; Hennig, J.; Zou, P.; Nossner, E.; Ling, P.D.; Sattler, M.; Kempkes, B. The EBNA-2 N-Terminal Transactivation Domain Folds into a Dimeric Structure Required for Target Gene Activation. PLoS Pathog. 2015, 11, e1004910. [Google Scholar] [CrossRef]
- Li, C.; Wang, Z.; Tang, X.; Zeng, L.; Fan, X.; Li, Z. Molecular mechanisms and potential prognostic effects of REST and REST4 in glioma (Review). Mol. Med. Rep. 2017, 16, 3707–3712. [Google Scholar] [CrossRef] [PubMed]
- Schoenherr, C.J.; Anderson, D.J. Silencing is golden: Negative regulation in the control of neuronal gene transcription. Curr. Opin. Neurobiol. 1995, 5, 566–571. [Google Scholar] [CrossRef]
- Tapia-Ramirez, J.; Eggen, B.J.; Peral-Rubio, M.J.; Toledo-Aral, J.J.; Mandel, G. A single zinc finger motif in the silencing factor REST represses the neural-specific type II sodium channel promoter. Proc. Natl. Acad. Sci. USA 1997, 94, 1177–1182. [Google Scholar] [CrossRef]
- Thiel, G.; Ekici, M.; Rossler, O.G. RE-1 silencing transcription factor (REST): A regulator of neuronal development and neuronal/endocrine function. Cell Tissue Res. 2015, 359, 99–109. [Google Scholar] [CrossRef] [PubMed]
- Chen, G.L.; Miller, G.M. Extensive alternative splicing of the repressor element silencing transcription factor linked to cancer. PLoS ONE 2013, 8, e62217. [Google Scholar] [CrossRef] [PubMed]
- Coulson, J.M.; Edgson, J.L.; Woll, P.J.; Quinn, J.P. A splice variant of the neuron-restrictive silencer factor repressor is expressed in small cell lung cancer: A potential role in derepression of neuroendocrine genes and a useful clinical marker. Cancer Res. 2000, 60, 1840–1844. [Google Scholar]
- Yu, M.; Cai, L.; Liang, M.; Huang, Y.; Gao, H.; Lu, S.; Fei, J.; Huang, F. Alteration of NRSF expression exacerbating 1-methyl-4-phenyl-pyridinium ion-induced cell death of SH-SY5Y cells. Neurosci. Res. 2009, 65, 236–244. [Google Scholar] [CrossRef] [PubMed]
- Raj, B.; O’Hanlon, D.; Vessey, J.P.; Pan, Q.; Ray, D.; Buckley, N.J.; Miller, F.D.; Blencowe, B.J. Cross-regulation between an alternative splicing activator and a transcription repressor controls neurogenesis. Mol. Cell 2011, 43, 843–850. [Google Scholar] [CrossRef]
- Johnson, R.; Gamblin, R.J.; Ooi, L.; Bruce, A.W.; Donaldson, I.J.; Westhead, D.R.; Wood, I.C.; Jackson, R.M.; Buckley, N.J. Identification of the REST regulon reveals extensive transposable element-mediated binding site duplication. Nucleic Acids Res. 2006, 34, 3862–3877. [Google Scholar] [CrossRef]
- Johnson, R.; Teh, C.H.; Kunarso, G.; Wong, K.Y.; Srinivasan, G.; Cooper, M.L.; Volta, M.; Chan, S.S.; Lipovich, L.; Pollard, S.M.; et al. REST regulates distinct transcriptional networks in embryonic and neural stem cells. PLoS Biol. 2008, 6, e256. [Google Scholar] [CrossRef]
- Johnson, D.S.; Mortazavi, A.; Myers, R.M.; Wold, B. Genome-wide mapping of in vivo protein-DNA interactions. Science 2007, 316, 1497–1502. [Google Scholar] [CrossRef]
- Otto, S.J.; McCorkle, S.R.; Hover, J.; Conaco, C.; Han, J.J.; Impey, S.; Yochum, G.S.; Dunn, J.J.; Goodman, R.H.; Mandel, G. A new binding motif for the transcriptional repressor REST uncovers large gene networks devoted to neuronal functions. J. Neurosci. 2007, 27, 6729–6739. [Google Scholar] [CrossRef] [PubMed]
- Schoenherr, C.J.; Paquette, A.J.; Anderson, D.J. Identification of potential target genes for the neuron-restrictive silencer factor. Proc. Natl. Acad. Sci. USA 1996, 93, 9881–9886. [Google Scholar] [CrossRef]
- Zheng, D.; Zhao, K.; Mehler, M.F. Profiling RE1/REST-mediated histone modifications in the human genome. Genome Biol. 2009, 10, R9. [Google Scholar] [CrossRef] [PubMed]
- Monaghan, C.E.; Nechiporuk, T.; Jeng, S.; McWeeney, S.K.; Wang, J.; Rosenfeld, M.G.; Mandel, G. REST corepressors RCOR1 and RCOR2 and the repressor INSM1 regulate the proliferation-differentiation balance in the developing brain. Proc. Natl. Acad. Sci. USA 2017, 114, E406–E415. [Google Scholar] [CrossRef] [PubMed]
- Gopalakrishnan, V. REST and the RESTless: In stem cells and beyond. Future Neurol. 2009, 4, 317–329. [Google Scholar] [CrossRef]
- Majumder, S. REST in good times and bad: Roles in tumor suppressor and oncogenic activities. Cell Cycle 2006, 5, 1929–1935. [Google Scholar] [CrossRef] [PubMed]
- Maksour, S.; Ooi, L.; Dottori, M. More than a Corepressor: The Role of CoREST Proteins in Neurodevelopment. eNeuro 2020, 7, ENEURO.0337-19.2020. [Google Scholar] [CrossRef]
- Grimes, J.A.; Nielsen, S.J.; Battaglioli, E.; Miska, E.A.; Speh, J.C.; Berry, D.L.; Atouf, F.; Holdener, B.C.; Mandel, G.; Kouzarides, T. The co-repressor mSin3A is a functional component of the REST-CoREST repressor complex. J. Biol. Chem. 2000, 275, 9461–9467. [Google Scholar] [CrossRef]
- Hsieh, J.; Gage, F.H. Chromatin remodeling in neural development and plasticity. Curr. Opin. Cell Biol. 2005, 17, 664–671. [Google Scholar] [CrossRef]
- Lunyak, V.V.; Rosenfeld, M.G. No rest for REST: REST/NRSF regulation of neurogenesis. Cell 2005, 121, 499–501. [Google Scholar] [CrossRef]
- Shi, Y.; Sawada, J.; Sui, G.; Affar el, B.; Whetstine, J.R.; Lan, F.; Ogawa, H.; Luke, M.P.; Nakatani, Y.; Shi, Y. Coordinated histone modifications mediated by a CtBP co-repressor complex. Nature 2003, 422, 735–738. [Google Scholar] [CrossRef]
- Ding, N.; Tomomori-Sato, C.; Sato, S.; Conaway, R.C.; Conaway, J.W.; Boyer, T.G. MED19 and MED26 are synergistic functional targets of the RE1 silencing transcription factor in epigenetic silencing of neuronal gene expression. J. Biol. Chem. 2009, 284, 2648–2656. [Google Scholar] [CrossRef] [PubMed]
- Lee, M.G.; Wynder, C.; Cooch, N.; Shiekhattar, R. An essential role for CoREST in nucleosomal histone 3 lysine 4 demethylation. Nature 2005, 437, 432–435. [Google Scholar] [CrossRef] [PubMed]
- Ooi, L.; Belyaev, N.D.; Miyake, K.; Wood, I.C.; Buckley, N.J. BRG1 chromatin remodeling activity is required for efficient chromatin binding by repressor element 1-silencing transcription factor (REST) and facilitates REST-mediated repression. J. Biol. Chem. 2006, 281, 38974–38980. [Google Scholar] [CrossRef] [PubMed]
- Perera, A.; Eisen, D.; Wagner, M.; Laube, S.K.; Kunzel, A.F.; Koch, S.; Steinbacher, J.; Schulze, E.; Splith, V.; Mittermeier, N.; et al. TET3 is recruited by REST for context-specific hydroxymethylation and induction of gene expression. Cell Rep. 2015, 11, 283–294. [Google Scholar] [CrossRef]
- Garcia-Manteiga, J.M.; Bonfiglio, S.; Folladori, L.; Malosio, M.L.; Lazarevic, D.; Stupka, E.; Cittaro, D.; Meldolesi, J. REST-Governed Gene Expression Profiling in a Neuronal Cell Model Reveals Novel Direct and Indirect Processes of Repression and Up-Regulation. Front. Cell Neurosci. 2015, 9, 438. [Google Scholar] [CrossRef]
- Wang, G.; Yang, X.; Qi, M.; Li, M.; Dong, M.; Xu, R.; Zhang, C. Systematic analysis identifies REST as an oncogenic and immunological biomarker in glioma. Sci. Rep. 2023, 13, 3023. [Google Scholar] [CrossRef] [PubMed]
- Mukherjee, S.; Brulet, R.; Zhang, L.; Hsieh, J. REST regulation of gene networks in adult neural stem cells. Nat. Commun. 2016, 7, 13360. [Google Scholar] [CrossRef] [PubMed]
- Pollard, S.M.; Marques-Torrejon, M.A. Give it a REST! eLife 2016, 5, e12615. [Google Scholar] [CrossRef] [PubMed]
- Aron, L.; Qiu, C.; Ngian, Z.K.; Liang, M.; Drake, D.; Choi, J.; Fernandez, M.A.; Roche, P.; Bunting, E.L.; Lacey, E.K.; et al. A neurodegeneration checkpoint mediated by REST protects against the onset of Alzheimer’s disease. Nat. Commun. 2023, 14, 7030. [Google Scholar] [CrossRef]
- Lu, T.; Aron, L.; Zullo, J.; Pan, Y.; Kim, H.; Chen, Y.; Yang, T.H.; Kim, H.M.; Drake, D.; Liu, X.S.; et al. REST and stress resistance in ageing and Alzheimer’s disease. Nature 2014, 507, 448–454. [Google Scholar] [CrossRef] [PubMed]
- Hall, A.M.; Kamei, N.; Shao, M.; Mun, H.S.; Chen, K.; Chen, Y.; Baram, T.Z. Inhibition of Neuron-Restrictive Silencing Factor (REST/NRSF) Chromatin Binding Attenuates Epileptogenesis. eNeuro 2024, 11, ENEURO.0006-24.2024. [Google Scholar] [CrossRef]
- Butler-Ryan, R.; Wood, I.C. The functions of repressor element 1-silencing transcription factor in models of epileptogenesis and post-ischemia. Metab. Brain Dis. 2021, 36, 1135–1150. [Google Scholar] [CrossRef]
- Morris-Blanco, K.C.; Kim, T.; Bertogliat, M.J.; Mehta, S.L.; Chokkalla, A.K.; Vemuganti, R. Inhibition of the Epigenetic Regulator REST Ameliorates Ischemic Brain Injury. Mol. Neurobiol. 2019, 56, 2542–2550. [Google Scholar] [CrossRef] [PubMed]
- Guardavaccaro, D.; Frescas, D.; Dorrello, N.V.; Peschiaroli, A.; Multani, A.S.; Cardozo, T.; Lasorella, A.; Iavarone, A.; Chang, S.; Hernando, E.; et al. Control of chromosome stability by the beta-TrCP-REST-Mad2 axis. Nature 2008, 452, 365–369. [Google Scholar] [CrossRef] [PubMed]
- Westbrook, T.F.; Hu, G.; Ang, X.L.; Mulligan, P.; Pavlova, N.N.; Liang, A.; Leng, Y.; Maehr, R.; Shi, Y.; Harper, J.W.; et al. SCFbeta-TRCP controls oncogenic transformation and neural differentiation through REST degradation. Nature 2008, 452, 370–374. [Google Scholar] [CrossRef] [PubMed]
- Singh, A.; Rokes, C.; Gireud, M.; Fletcher, S.; Baumgartner, J.; Fuller, G.; Stewart, J.; Zage, P.; Gopalakrishnan, V. Retinoic acid induces REST degradation and neuronal differentiation by modulating the expression of SCF(beta-TRCP) in neuroblastoma cells. Cancer 2011, 117, 5189–5202. [Google Scholar] [CrossRef]
- Huang, Z.; Wu, Q.; Guryanova, O.A.; Cheng, L.; Shou, W.; Rich, J.N.; Bao, S. Deubiquitylase HAUSP stabilizes REST and promotes maintenance of neural progenitor cells. Nat. Cell Biol. 2011, 13, 142–152. [Google Scholar] [CrossRef]
- Huang, Z.; Bao, S. Ubiquitination and deubiquitination of REST and its roles in cancers. FEBS Lett. 2012, 586, 1602–1605. [Google Scholar] [CrossRef] [PubMed]
- Cheong, J.K.; Virshup, D.M. Casein kinase 1: Complexity in the family. Int. J. Biochem. Cell Biol. 2011, 43, 465–469. [Google Scholar] [CrossRef] [PubMed]
- Chen, H.; Ma, H.; Inuzuka, H.; Diao, J.; Lan, F.; Shi, Y.G.; Wei, W.; Shi, Y. DNA damage regulates UHRF1 stability via the SCF(beta-TrCP) E3 ligase. Mol. Cell Biol. 2013, 33, 1139–1148. [Google Scholar] [CrossRef]
- Weissman, A.M. How much REST is enough? Cancer Cell 2008, 13, 381–383. [Google Scholar] [CrossRef]
- Nesti, E.; Corson, G.M.; McCleskey, M.; Oyer, J.A.; Mandel, G. C-terminal domain small phosphatase 1 and MAP kinase reciprocally control REST stability and neuronal differentiation. Proc. Natl. Acad. Sci. USA 2014, 111, E3929–E3936. [Google Scholar] [CrossRef] [PubMed]
- Lee, N.S.; Evgrafov, O.V.; Souaiaia, T.; Bonyad, A.; Herstein, J.; Lee, J.Y.; Kim, J.; Ning, Y.; Sixto, M.; Weitz, A.C.; et al. Non-coding RNAs derived from an alternatively spliced REST transcript (REST-003) regulate breast cancer invasiveness. Sci. Rep. 2015, 5, 11207. [Google Scholar] [CrossRef] [PubMed]
- Raj, B.; Irimia, M.; Braunschweig, U.; Sterne-Weiler, T.; O’Hanlon, D.; Lin, Z.Y.; Chen, G.I.; Easton, L.E.; Ule, J.; Gingras, A.C.; et al. A global regulatory mechanism for activating an exon network required for neurogenesis. Mol. Cell 2014, 56, 90–103. [Google Scholar] [CrossRef]
- Pandey, U.B.; Nie, Z.; Batlevi, Y.; McCray, B.A.; Ritson, G.P.; Nedelsky, N.B.; Schwartz, S.L.; DiProspero, N.A.; Knight, M.A.; Schuldiner, O.; et al. HDAC6 rescues neurodegeneration and provides an essential link between autophagy and the UPS. Nature 2007, 447, 859–863. [Google Scholar] [CrossRef] [PubMed]
- Shimojo, M.; Hersh, L.B. Characterization of the REST/NRSF-interacting LIM domain protein (RILP): Localization and interaction with REST/NRSF. J. Neurochem. 2006, 96, 1130–1138. [Google Scholar] [CrossRef] [PubMed]
- Zuccato, C.; Tartari, M.; Crotti, A.; Goffredo, D.; Valenza, M.; Conti, L.; Cataudella, T.; Leavitt, B.R.; Hayden, M.R.; Timmusk, T.; et al. Huntingtin interacts with REST/NRSF to modulate the transcription of NRSE-controlled neuronal genes. Nat. Genet. 2003, 35, 76–83. [Google Scholar] [CrossRef]
- Zuccato, C.; Belyaev, N.; Conforti, P.; Ooi, L.; Tartari, M.; Papadimou, E.; MacDonald, M.; Fossale, E.; Zeitlin, S.; Buckley, N.; et al. Widespread disruption of repressor element-1 silencing transcription factor/neuron-restrictive silencer factor occupancy at its target genes in Huntington’s disease. J. Neurosci. 2007, 27, 6972–6983. [Google Scholar] [CrossRef] [PubMed]
- Park, H.; Poo, M.M. Neurotrophin regulation of neural circuit development and function. Nat. Rev. Neurosci. 2013, 14, 7–23. [Google Scholar] [CrossRef] [PubMed]
- Yeo, M.; Berglund, K.; Augustine, G.; Liedtke, W. Novel repression of Kcc2 transcription by REST-RE-1 controls developmental switch in neuronal chloride. J. Neurosci. 2009, 29, 14652–14662. [Google Scholar] [CrossRef]
- de Souza, J.M.; Abd-Elrahman, K.S.; Ribeiro, F.M.; Ferguson, S.S.G. mGluR5 regulates REST/NRSF signaling through N-cadherin/beta-catenin complex in Huntington’s disease. Mol. Brain 2020, 13, 118. [Google Scholar] [CrossRef]
- Prada, I.; Marchaland, J.; Podini, P.; Magrassi, L.; D’Alessandro, R.; Bezzi, P.; Meldolesi, J. REST/NRSF governs the expression of dense-core vesicle gliosecretion in astrocytes. J. Cell Biol. 2011, 193, 537–549. [Google Scholar] [CrossRef]
- Ashton, N.J.; Hye, A.; Leckey, C.A.; Jones, A.R.; Gardner, A.; Elliott, C.; Wetherell, J.L.; Lenze, E.J.; Killick, R.; Marchant, N.L. Plasma REST: A novel candidate biomarker of Alzheimer’s disease is modified by psychological intervention in an at-risk population. Transl. Psychiatry 2017, 7, e1148. [Google Scholar] [CrossRef]
- Pajarillo, E.; Kim, S.; Digman, A.; Ajayi, I.; Nyarko-Danquah, I.; Son, D.S.; Aschner, M.; Lee, E. Dopaminergic REST/NRSF is protective against manganese-induced neurotoxicity in mice. J. Biol. Chem. 2024, 300, 107707. [Google Scholar] [CrossRef] [PubMed]
- Yu, M.; Suo, H.; Liu, M.; Cai, L.; Liu, J.; Huang, Y.; Xu, J.; Wang, Y.; Zhu, C.; Fei, J.; et al. NRSF/REST neuronal deficient mice are more vulnerable to the neurotoxin MPTP. Neurobiol. Aging 2013, 34, 916–927. [Google Scholar] [CrossRef] [PubMed]
- Gu, H.; Roizman, B. Herpes simplex virus-infected cell protein 0 blocks the silencing of viral DNA by dissociating histone deacetylases from the CoREST-REST complex. Proc. Natl. Acad. Sci. USA 2007, 104, 17134–17139. [Google Scholar] [CrossRef]
- Du, T.; Zhou, G.; Khan, S.; Gu, H.; Roizman, B. Disruption of HDAC/CoREST/REST repressor by dnREST reduces genome silencing and increases virulence of herpes simplex virus. Proc. Natl. Acad. Sci. USA 2010, 107, 15904–15909. [Google Scholar] [CrossRef]
- Zhou, G.; Du, T.; Roizman, B. HSV carrying WT REST establishes latency but reactivates only if the synthesis of REST is suppressed. Proc. Natl. Acad. Sci. USA 2013, 110, E498–E506. [Google Scholar] [CrossRef]
- Tsai, M.C.; Manor, O.; Wan, Y.; Mosammaparast, N.; Wang, J.K.; Lan, F.; Shi, Y.; Segal, E.; Chang, H.Y. Long noncoding RNA as modular scaffold of histone modification complexes. Science 2010, 329, 689–693. [Google Scholar] [CrossRef]
- Saijo, K.; Winner, B.; Carson, C.T.; Collier, J.G.; Boyer, L.; Rosenfeld, M.G.; Gage, F.H.; Glass, C.K. A Nurr1/CoREST pathway in microglia and astrocytes protects dopaminergic neurons from inflammation-induced death. Cell 2009, 137, 47–59. [Google Scholar] [CrossRef] [PubMed]
- De Miranda, B.R.; Popichak, K.A.; Hammond, S.L.; Jorgensen, B.A.; Phillips, A.T.; Safe, S.; Tjalkens, R.B. The Nurr1 Activator 1,1-Bis(3′-Indolyl)-1-(p-Chlorophenyl)Methane Blocks Inflammatory Gene Expression in BV-2 Microglial Cells by Inhibiting Nuclear Factor kappaB. Mol. Pharmacol. 2015, 87, 1021–1034. [Google Scholar] [CrossRef] [PubMed]
- Cloud, A.S.; Vargheese, A.M.; Gunewardena, S.; Shimak, R.M.; Ganeshkumar, S.; Kumaraswamy, E.; Jensen, R.A.; Chennathukuzhi, V.M. Loss of REST in breast cancer promotes tumor progression through estrogen sensitization, MMP24 and CEMIP overexpression. BMC Cancer 2022, 22, 180. [Google Scholar] [CrossRef]
- Karlin, K.L.; Mondal, G.; Hartman, J.K.; Tyagi, S.; Kurley, S.J.; Bland, C.S.; Hsu, T.Y.; Renwick, A.; Fang, J.E.; Migliaccio, I.; et al. The oncogenic STP axis promotes triple-negative breast cancer via degradation of the REST tumor suppressor. Cell Rep. 2014, 9, 1318–1332. [Google Scholar] [CrossRef] [PubMed]
- Westbrook, T.F.; Martin, E.S.; Schlabach, M.R.; Leng, Y.; Liang, A.C.; Feng, B.; Zhao, J.J.; Roberts, T.M.; Mandel, G.; Hannon, G.J.; et al. A genetic screen for candidate tumor suppressors identifies REST. Cell 2005, 121, 837–848. [Google Scholar] [CrossRef] [PubMed]
- Kreisler, A.; Strissel, P.L.; Strick, R.; Neumann, S.B.; Schumacher, U.; Becker, C.M. Regulation of the NRSF/REST gene by methylation and CREB affects the cellular phenotype of small-cell lung cancer. Oncogene 2010, 29, 5828–5838. [Google Scholar] [CrossRef] [PubMed]
- Jin, Y.; Ma, D.; Gramyk, T.; Guo, C.; Fang, R.; Ji, H.; Shi, Y.G. Kdm1a promotes SCLC progression by transcriptionally silencing the tumor suppressor Rest. Biochem. Biophys. Res. Commun. 2019, 515, 214–221. [Google Scholar] [CrossRef]
- Zhang, Y.; Wang, Q.; Wang, Z.; Zhang, C.; Xu, X.; Xu, J.; Ren, H.; Shao, X.; Zhen, X.; Zhang, L.; et al. Comprehensive Analysis of REST/NRSF Gene in Glioma and Its ceRNA Network Identification. Front. Med. 2021, 8, 739624. [Google Scholar] [CrossRef]
- Conti, L.; Crisafulli, L.; Caldera, V.; Tortoreto, M.; Brilli, E.; Conforti, P.; Zunino, F.; Magrassi, L.; Schiffer, D.; Cattaneo, E. REST controls self-renewal and tumorigenic competence of human glioblastoma cells. PLoS ONE 2012, 7, e38486. [Google Scholar] [CrossRef] [PubMed]
- Panina, S.B.; Schweer, J.V.; Zhang, Q.; Raina, G.; Hardtke, H.A.; Kim, S.; Yang, W.; Siegel, D.; Zhang, Y.J. Targeting of REST with rationally-designed small molecule compounds exhibits synergetic therapeutic potential in human glioblastoma cells. BMC Biol. 2024, 22, 83. [Google Scholar] [CrossRef] [PubMed]
- Zhang, D.; Li, Y.; Wang, R.; Li, Y.; Shi, P.; Kan, Z.; Pang, X. Inhibition of REST Suppresses Proliferation and Migration in Glioblastoma Cells. Int. J. Mol. Sci. 2016, 17, 664. [Google Scholar] [CrossRef] [PubMed]
- Yucebas, M.; Yilmaz Susluer, S.; Onur Caglar, H.; Balci, T.; Dogan Sigva, Z.O.; Akalin, T.; Oktar, N.; Dalbasti, T.; Biray Avci, C.; Gunduz, C. Expression profiling of RE1-silencing transcription factor (REST), REST corepressor 1 (RCOR1), and Synapsin 1 (SYN1) genes in human gliomas. J. BUON 2016, 21, 964–972. [Google Scholar]
- Taylor, P.; Fangusaro, J.; Rajaram, V.; Goldman, S.; Helenowski, I.B.; MacDonald, T.; Hasselblatt, M.; Riedemann, L.; Laureano, A.; Cooper, L.; et al. REST is a novel prognostic factor and therapeutic target for medulloblastoma. Mol. Cancer Ther. 2012, 11, 1713–1723. [Google Scholar] [CrossRef] [PubMed]
- Shaik, S.; Maegawa, S.; Haltom, A.R.; Wang, F.; Xiao, X.; Dobson, T.; Sharma, A.; Yang, Y.; Swaminathan, J.; Kundra, V.; et al. REST promotes ETS1-dependent vascular growth in medulloblastoma. Mol. Oncol. 2021, 15, 1486–1506. [Google Scholar] [CrossRef] [PubMed]
- Su, X.; Gopalakrishnan, V.; Stearns, D.; Aldape, K.; Lang, F.F.; Fuller, G.; Snyder, E.; Eberhart, C.G.; Majumder, S. Abnormal expression of REST/NRSF and Myc in neural stem/progenitor cells causes cerebellar tumors by blocking neuronal differentiation. Mol. Cell Biol. 2006, 26, 1666–1678. [Google Scholar] [CrossRef] [PubMed]
- Dobson, T.H.W.; Tao, R.H.; Swaminathan, J.; Maegawa, S.; Shaik, S.; Bravo-Alegria, J.; Sharma, A.; Kennis, B.; Yang, Y.; Callegari, K.; et al. Transcriptional repressor REST drives lineage stage-specific chromatin compaction at Ptch1 and increases AKT activation in a mouse model of medulloblastoma. Sci. Signal 2019, 12, eaan8680. [Google Scholar] [CrossRef] [PubMed]
- Ren, H.; Gao, Z.; Wu, N.; Zeng, L.; Tang, X.; Chen, X.; Liu, Z.; Zhang, W.; Wang, L.; Li, Z. Expression of REST4 in human gliomas in vivo and influence of pioglitazone on REST in vitro. Biochem. Biophys. Res. Commun. 2015, 463, 504–509. [Google Scholar] [CrossRef] [PubMed]
- Callegari, K.; Maegawa, S.; Bravo-Alegria, J.; Gopalakrishnan, V. Pharmacological inhibition of LSD1 activity blocks REST-dependent medulloblastoma cell migration. Cell Commun. Signal 2018, 16, 60. [Google Scholar] [CrossRef] [PubMed]
- Liang, J.; Tong, P.; Zhao, W.; Li, Y.; Zhang, L.; Xia, Y.; Yu, Y. The REST gene signature predicts drug sensitivity in neuroblastoma cell lines and is significantly associated with neuroblastoma tumor stage. Int. J. Mol. Sci. 2014, 15, 11220–11233. [Google Scholar] [CrossRef]
- Pandey, G.K.; Mitra, S.; Subhash, S.; Hertwig, F.; Kanduri, M.; Mishra, K.; Fransson, S.; Ganeshram, A.; Mondal, T.; Bandaru, S.; et al. The risk-associated long noncoding RNA NBAT-1 controls neuroblastoma progression by regulating cell proliferation and neuronal differentiation. Cancer Cell 2014, 26, 722–737. [Google Scholar] [CrossRef]
- Bird, L. Sialylated IgG restrains lung inflammation. Nat. Rev. Immunol. 2024, 25, 2. [Google Scholar] [CrossRef] [PubMed]
- Zhang, X.; Zhang, Y.; Liu, W.; Luo, B. Epstein-Barr virus regulates the life cycle and host cell biology by hijacking post-translational modification. Rev. Med. Virol. 2023, 33, e2447. [Google Scholar] [CrossRef]
- Damania, B.; Kenney, S.C.; Raab-Traub, N. Epstein-Barr virus: Biology and clinical disease. Cell 2022, 185, 3652–3670. [Google Scholar] [CrossRef] [PubMed]
- Chiu, Y.F.; Sugden, A.U.; Sugden, B. Epstein-Barr viral productive amplification reprograms nuclear architecture, DNA replication, and histone deposition. Cell Host Microbe 2013, 14, 607–618. [Google Scholar] [CrossRef]
- Dugan, J.P.; Coleman, C.B.; Haverkos, B. Opportunities to Target the Life Cycle of Epstein-Barr Virus (EBV) in EBV-Associated Lymphoproliferative Disorders. Front. Oncol. 2019, 9, 127. [Google Scholar] [CrossRef] [PubMed]
- Murata, T.; Sugimoto, A.; Inagaki, T.; Yanagi, Y.; Watanabe, T.; Sato, Y.; Kimura, H. Molecular Basis of Epstein-Barr Virus Latency Establishment and Lytic Reactivation. Viruses 2021, 13, 2344. [Google Scholar] [CrossRef] [PubMed]
- Woellmer, A.; Hammerschmidt, W. Epstein-Barr virus and host cell methylation: Regulation of latency, replication and virus reactivation. Curr. Opin. Virol. 2013, 3, 260–265. [Google Scholar] [CrossRef] [PubMed]
- Huang, W.; Bai, L.; Tang, H. Epstein-Barr virus infection: The micro and macro worlds. Virol. J. 2023, 20, 220. [Google Scholar] [CrossRef]
- Kang, M.S.; Kieff, E. Epstein-Barr virus latent genes. Exp. Mol. Med. 2015, 47, e131. [Google Scholar] [CrossRef]
- Krishnan, D.; Babu, S.; Raju, R.; Veettil, M.V.; Prasad, T.S.K.; Abhinand, C.S. Epstein-Barr Virus: Human Interactome Reveals New Molecular Insights into Viral Pathogenesis for Potential Therapeutics and Antiviral Drug Discovery. OMICS 2024, 28, 32–44. [Google Scholar] [CrossRef]
- Volaric, A.K.; Saleem, A.; Younes, S.F.; Zhao, S.; Natkunam, Y. Epstein-Barr virus latency patterns in polymorphic lymphoproliferative disorders and lymphomas in immunodeficiency settings: Diagnostic implications. Ann. Diagn. Pathol. 2024, 70, 152286. [Google Scholar] [CrossRef] [PubMed]
- Kelly, G.L.; Milner, A.E.; Baldwin, G.S.; Bell, A.I.; Rickinson, A.B. Three restricted forms of Epstein-Barr virus latency counteracting apoptosis in c-myc-expressing Burkitt lymphoma cells. Proc. Natl. Acad. Sci. USA 2006, 103, 14935–14940. [Google Scholar] [CrossRef]
- Wu, D.Y.; Kalpana, G.V.; Goff, S.P.; Schubach, W.H. Epstein-Barr virus nuclear protein 2 (EBNA2) binds to a component of the human SNF-SWI complex, hSNF5/Ini1. J. Virol. 1996, 70, 6020–6028. [Google Scholar] [CrossRef] [PubMed]
- Beer, S.; Wange, L.E.; Zhang, X.; Kuklik-Roos, C.; Enard, W.; Hammerschmidt, W.; Scialdone, A.; Kempkes, B. EBNA2-EBF1 complexes promote MYC expression and metabolic processes driving S-phase progression of Epstein-Barr virus-infected B cells. Proc. Natl. Acad. Sci. USA 2022, 119, e2200512119. [Google Scholar] [CrossRef]
- Leopizzi, M.; Mundo, L.; Messina, E.; Campolo, F.; Lazzi, S.; Angeloni, A.; Marchese, C.; Leoncini, L.; Giordano, C.; Slack, F.; et al. Epstein-Barr virus-encoded EBNA2 downregulates ICOSL by inducing miR-24 in B-cell lymphoma. Blood 2024, 143, 429–443. [Google Scholar] [CrossRef]
- Skalsky, R.L. MicroRNA-mediated control of Epstein-Barr virus infection and potential diagnostic and therapeutic implications. Curr. Opin. Virol. 2022, 56, 101272. [Google Scholar] [CrossRef] [PubMed]
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Pillai, V.S.; Ravindran, S.; Krishna, G.; Abhinand, C.S.; Nelson-Sathi, S.; Veettil, M.V. REST Is Restless in Neuronal and Non-Neuronal Virus Infections: An In Silico Analysis-Based Perspective. Viruses 2025, 17, 234. https://doi.org/10.3390/v17020234
Pillai VS, Ravindran S, Krishna G, Abhinand CS, Nelson-Sathi S, Veettil MV. REST Is Restless in Neuronal and Non-Neuronal Virus Infections: An In Silico Analysis-Based Perspective. Viruses. 2025; 17(2):234. https://doi.org/10.3390/v17020234
Chicago/Turabian StylePillai, Vinod Soman, Shilpa Ravindran, Gayathri Krishna, Chandran S. Abhinand, Shijulal Nelson-Sathi, and Mohanan Valiya Veettil. 2025. "REST Is Restless in Neuronal and Non-Neuronal Virus Infections: An In Silico Analysis-Based Perspective" Viruses 17, no. 2: 234. https://doi.org/10.3390/v17020234
APA StylePillai, V. S., Ravindran, S., Krishna, G., Abhinand, C. S., Nelson-Sathi, S., & Veettil, M. V. (2025). REST Is Restless in Neuronal and Non-Neuronal Virus Infections: An In Silico Analysis-Based Perspective. Viruses, 17(2), 234. https://doi.org/10.3390/v17020234