Prevalence of Aphid-Transmitted Potyviruses in Pumpkin and Winter Squash in Georgia, USA
Abstract
1. Introduction
2. Materials and Methods
2.1. Crop Production
2.2. Symptoms Observation
2.3. Sample Collection
2.4. RNA Extraction and High-Throughput Sequencing (HTS) of sRNA
2.5. In Silico Data Analysis
2.6. Construction of Viral Genome Sequence and Coverage Maps
2.7. Molecular Validation of HTS Results
2.8. Target Gene Amplification and Sanger Sequencing
2.9. Phylogenetic Analysis and Nucleotide Sequence Identity
3. Results
3.1. Symptomatology
3.2. Virus Detection Using HTS
3.3. Virus Prevalence and Distribution in Pumpkin and Winter Squash
3.4. Sequence Analysis and Phylogenetic Tree
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Food and Agriculture Organization (FAO). Global Production of Vegetables in 2022, by Type (in Million Metric Tons), in Statista. Available online: https://www.statista.com/statistics/264065/global-production-of-vegetables-by-type/ (accessed on 15 February 2024).
- United States Department of Agriculture (USDA). Vegetables 2023 Summary; United States Department of Agriculture, National Agricultural Statistics Service: Washington, DC, USA, 2024; pp. 6–84. Available online: https://downloads.usda.library.cornell.edu/usda-esmis/files/02870v86p/qz20vd735/ht24z584t/vegean24.pdf (accessed on 7 January 2025).
- Gavril, R.N.; Stoica, F.; Lipsa, F.D.; Constantin, O.E.; Stanciuc, N.; Aprodu, I.; Rapeanu, G. Pumpkin and pumpkin by-Products: A comprehensive overview of phytochemicals, extraction, health benefits, and food applications. Foods 2024, 13, 2694. [Google Scholar] [CrossRef]
- Evranuz, E.O.; Arduzlar-Kagan, D. Winter squash and pumpkins. In Handbook of Vegetable Preservation and Processing, 2nd ed.; Hui, Y.H., Ozgul Evranuz, E., Eds.; CRC Press: Boca Raton, FL, USA, 2015; pp. 671–690. [Google Scholar]
- Kates, H.R. Pumpkins, squashes, and gourds (Cucurbita L.) of North America. In North American Crop Wild Relatives; Greene, S.L., Williams, K.A., Khoury, C.K., Kantar, M.B., Marek, L.F., Eds.; Springer: Cham, Switzerland, 2019; pp. 195–224. [Google Scholar]
- Coolong, T. Commercial production and management of pumpkins and gourds. In University of Georgia, Vegetable Extension and Research Report; Kelley, W.T., Langston, D.B., Eds.; University of Georgia Cooperative Extension: Athens, GA, USA, 2023; pp. 16–17. [Google Scholar]
- Ebnstrom, G.W.; Gilreath, P.R.; Maynard, D.N. Pumpkins: A potential commercial crop for Florida. Proc. Fla. State Hort. Soc. 1988, 101, 382–385. [Google Scholar]
- Mulholland, S.; Wildman, O.; Daly, A.; Tesoriero, L.; Chapman, T.A. Distribution and diversity of viruses affecting cucurbit production in New South Wales, Australia. Australas. Plant Pathol. 2023, 52, 339–351. [Google Scholar] [CrossRef]
- Moya-Ruiz, C.D.; Gomez, P.; Juarez, M. Occurrence, distribution, and management of aphid-transmitted viruses in cucurbits in Spain. Pathogens 2023, 12, 422. [Google Scholar] [CrossRef]
- Lecoq, H.; Desbiez, C. Viruses of cucurbit crops in the Mediterranean region: An ever-changing picture. In Advances in Virus Research; Loebenstein, G., Lecoq, H., Eds.; Academic Press: Amsterdam, The Netherlands, 2012; pp. 67–126. [Google Scholar]
- Lopez-Martin, M.; Sifres, A.; Gomez-Guillamon, M.L.; Pico, B.; Perez-de-Castro, A. Incidence and genetic diversity of cucurbit viruses in the Spanish Mediterranean area. Plant Pathol. J. 2024, 73, 431–443. [Google Scholar] [CrossRef]
- Sharma, P. Epidemiology of potyviruses infecting crops of Cucurbitaceae. In Plant RNA Viruses; Gaur, R.K., Patil, B.L., Selvarajan, R., Eds.; Academic Press: Cambridge, MA, USA, 2023; pp. 213–227. [Google Scholar]
- Radouane, N.; Ezrari, S.; Belabess, Z.; Tahiri, A.; Tahzima, R.; Massart, S.; Jijakli, H.; Benjelloun, M.; Lahlali, R. Viruses of cucurbit crops: Current status in the Mediterranean Region. Phytopathol. Mediterr. 2021, 60, 389–570. [Google Scholar] [CrossRef]
- Mahdi, S.A.; Shaker, H.N.; Ali, H.A. Plant viruses transmitted by insects. EJTA 2024, 2, 804–815. [Google Scholar] [CrossRef] [PubMed]
- Gadhave, K.R.; Gautam, S.; Rasmussen, D.A.; Srinivasan, R. Aphid transmission of Potyvirus: The largest plant-infecting RNA virus genus. Viruses 2020, 12, 773. [Google Scholar] [CrossRef] [PubMed]
- Khanal, V. Distribution, Molecular Diversity, and Characterization of Potyviruses Infecting Cucurbits in Oklahoma. Ph.D. Dissertation, The University of Tulsa, Tulsa, OK, USA, 2022. [Google Scholar]
- Ali, A.; Abdalla, O.; Bruton, B.; Fish, W.; Sikora, E.; Zhang, S.; Taylor, M. Occurrence of viruses infecting watermelon, other cucurbits, and weeds in the parts of southern United States. Plant Health Prog. 2012, 13, 635–646. [Google Scholar] [CrossRef]
- Devendran, R.; Kavalappara, S.R.; Simmons, A.M.; Bag, S. Whitefly-transmitted viruses of cucurbits in the Southern United States. Viruses 2023, 15, 2278. [Google Scholar] [CrossRef]
- Center for Invasive Species and Ecosystem Health, University of Georgia, Widely Prevalent Viruses in the United States. Available online: https://www.prevalentviruses.org/subjectlist.cfm (accessed on 12 December 2024).
- Ali, A.; Mohammad, O.; Khattab, A. Distribution of viruses infecting cucurbit crops and isolation of potential new virus-like sequences from weeds in Oklahoma. Plant Dis. 2012, 96, 243–248. [Google Scholar] [CrossRef] [PubMed]
- Center for Invasive Species and Ecosystem Health, University of Georgia, Widely Prevalent Viruses in the United States-Georgia 43 Records. Available online: https://www.prevalentviruses.org/state.cfm?id=us_ga (accessed on 12 December 2024).
- Adeleke, I.A.; Kavalappara, S.R.; Bennett, J.; McGregor, C.; Srinivasan, R.; Bag, S. First report of watermelon crinkle leaf-associated virus 1 naturally infecting watermelon (Citrullus lanatus) in Georgia, United States. Plant Dis. 2022, 106, 2273. [Google Scholar] [CrossRef] [PubMed]
- Kavalappara, S.R.; Acharya, N.; Suarez, E.; McAvoy, T.; Bag, S. First Report of Watermelon Crinkle Leaf-Associated Virus-2 (WCLaV-2) in Watermelon (Citrullus lanatus) in Georgia, USA. Plant Dis. 2024, 108, 2246. [Google Scholar] [CrossRef] [PubMed]
- Adeleke, I.A.; Kavalappara, S.R.; McGregor, C.; Srinivasan, R.; Bag, S. Persistent, and asymptomatic viral infections and whitefly-transmitted viruses impacting cantaloupe and watermelon in Georgia, USA. Viruses 2022, 14, 1310. [Google Scholar] [CrossRef] [PubMed]
- Kavalappara, S.R.; Milner, H.; Konakalla, N.C.; Morgan, K.; Sparks, A.N.; McGregor, C.; Culbreath, A.K.; Wintermantel, W.M.; Bag, S. High throughput sequencing-aided survey reveals widespread mixed infections of whitefly-transmitted viruses in cucurbits in Georgia, USA. Viruses 2021, 13, 988. [Google Scholar] [CrossRef] [PubMed]
- Kumar, M.; Kavalappara, S.R.; McAvoy, T.; Hutton, S.; Simmons, A.M.; Bag, S. Association of tomato chlorosis virus complicates the management of tomato yellow leaf curl virus in cultivated tomato (Solanum lycopersicum) in the Southern United States. Horticulturae 2023, 9, 948. [Google Scholar] [CrossRef]
- Kavalappara, S.R.; Bag, S.; Luckew, A.; McGregor, C.E. Small RNA profiling of cucurbit yellow stunting disorder virus from susceptible and tolerant squash (Cucurbita pepo) lines. Viruses 2023, 15, 788. [Google Scholar] [CrossRef] [PubMed]
- Dunham, J.P.; Simmons, H.E.; Holmes, E.C.; Stephenson, A.G. Analysis of viral (zucchini yellow mosaic virus) genetic diversity during systemic movement through a Cucurbita pepo vine. Virus Res. 2014, 191, 172–179. [Google Scholar] [CrossRef] [PubMed]
- Kumar, S.; Stecher, G.; Li, M.; Knyaz, C.; Tamura, K. MEGA X: Molecular evolutionary genetics analysis across computing platforms. Mol. Biol. Evol. 2018, 35, 1547–1549. [Google Scholar] [CrossRef] [PubMed]
- Muhire, B.M.; Varsani, A.; Martin, D.P. SDT: A virus classification tool based on pairwise sequence alignment and identity calculation. PLoS ONE 2014, 9, e108277. [Google Scholar] [CrossRef]
- Nontajak, S.; Vulyasevi, S.; Jonglaekha, N.; Smitamana, P. Effect of mixed viruses infection on symptom expression in zucchini (Cucurbita pepo L.). J. Adv. Agric. Technol. 2014, 10, 1329–1341. [Google Scholar]
- Villamor, D.E.; Ho, T.; Al Rwahnih, M.; Martin, R.R.; Tzanetakis, I.E. High throughput sequencing for plant virus detection and discovery. Phytopathology 2019, 109, 716–725. [Google Scholar] [CrossRef]
- Ibaba, J.D.; Gubba, A. High-throughput sequencing application in the diagnosis and discovery of plant-infecting viruses in Africa, a decade later. Plants 2020, 9, 1376. [Google Scholar] [CrossRef]
- Mehetre, G.T.; Leo, V.V.; Singh, G.; Sorokan, A.; Maksimov, I.; Yadav, M.K.; Upadhyaya, K.; Hashem, A.; Alsaleh, A.N.; Dawoud, T.M.; et al. Current developments and challenges in plant viral diagnostics: A systematic review. Viruses 2021, 13, 412. [Google Scholar] [CrossRef] [PubMed]
- Perez-Losada, M.; Arenas, M.; Galán, J.C.; Bracho, M.A.; Hillung, J.; García-González, N.; González-Candelas, F. High-throughput sequencing (HTS) for the analysis of viral populations. Infect. Genet. Evol. 2020, 80, 104208. [Google Scholar] [CrossRef] [PubMed]
- Villamor, D.E.V.; Keller, K.E.; Martin, R.R.; Tzanetakis, I.E. Comparison of high throughput sequencing to standard protocols for virus detection in berry crops. Plant Dis. 2022, 106, 518–525. [Google Scholar] [CrossRef]
- Maliogka, V.I.; Minafra, A.; Saldarelli, P.; Ruiz-Garcia, A.B.; Glasa, M.; Katis, N.; Olmos, A. Recent advances on detection and characterization of fruit tree viruses using high-throughput sequencing technologies. Viruses 2018, 10, 436. [Google Scholar] [CrossRef]
- Singhal, P.; Nabi, S.U.; Yadav, M.K.; Dubey, A. Mixed infection of plant viruses: Diagnostics, interactions and impact on host. J. Plant Dis. Prot. 2021, 128, 353–368. [Google Scholar] [CrossRef]
- Moreno, A.B.; Lopez-Moya, J.J. When viruses play team sports: Mixed infections in plants. Phytopathology 2020, 110, 29–48. [Google Scholar] [CrossRef]
- Khanal, V.; Wells, H.; Ali, A. High prevalence of three potyviruses infecting cucurbits in Oklahoma and phylogenetic analysis of cucurbit aphid-borne yellows virus isolated from pumpkins. Pathogens 2021, 10, 53. [Google Scholar] [CrossRef]
- Mondal, S.; Hladky, L.J.; Wintermantel, W.M. Differential seasonal prevalence of yellowing viruses infecting melon crops in southern California and Arizona determined by multiplex RT-PCR and RT-qPCR. Plant Dis. 2023, 107, 2653–2664. [Google Scholar] [CrossRef]
- Perotto, M.C.; Di Rienzo, J.A.; Lanati, S.; Panonto, S.; Macchiavelli, R.; Cafrune, E.E.; Conci, V.C. Temporal and spatial spread of potyvirus infection and its relationship to aphid populations visiting garlic crops. Australas. Plant Pathol. 2014, 43, 623–630. [Google Scholar] [CrossRef]
- Nagendran, K.; Mohankumar, S.; Aravintharaj, R.; Balaji, C.G.; Manoranjitham, S.K.; Singh, A.K.; Rai, A.B.; Singh, B.; Karthikeyan, G. The occurrence and distribution of major viruses infecting cucurbits in Tamil Nadu state, India. Crop Prot. 2017, 99, 10–16. [Google Scholar] [CrossRef]
- Ahsan, M.; Ashfaq, M.; Amer, M.A.; Shakeel, M.T.; Mehmood, M.A.; Umar, M.; Al-Saleh, M.A. Zucchini yellow mosaic virus (ZYMV) as a serious biotic stress to cucurbits: Prevalence, diversity, and its implications for crop sustainability. Plants 2023, 12, 3503. [Google Scholar] [CrossRef] [PubMed]
- Abdalla, O.A.; Ali, A. Genetic diversity in the 3′-terminal region of papaya ringspot virus (PRSV-W) isolates from watermelon in Oklahoma. Arch. Virol. 2012, 157, 405–412. [Google Scholar] [CrossRef]
- Moury, B.; Desbiez, C. Host range evolution of potyviruses: A global phylogenetic analysis. Viruses 2020, 12, 111. [Google Scholar] [CrossRef]
- Priya, U.; Ranjan, T.; Kushwaha, C.; Srivastava, J.N.; Ansar, M. Molecular detection of Papaya ringspot virus and associated complexities in papaya and cucurbits. Appl. Fruit Sci. 2024, 66, 1061–1067. [Google Scholar] [CrossRef]
- Gibbs, A.J.; Hajizadeh, M.; Ohshima, K.; Jones, R.A. The potyviruses: An evolutionary synthesis is emerging. Viruses 2020, 12, 132. [Google Scholar] [CrossRef] [PubMed]
- Barzman, M.; Bàrberi, P.; Birch, A.N.E.; Boonekamp, P.; Dachbrodt-Saaydeh, S.; Graf, B.; Hommel, B.; Jensen, J.E.; Kiss, J.; Kudsk, P.; et al. Eight principles of integrated pest management. Agron. Sustain. Dev. 2015, 35, 1199–1215. [Google Scholar] [CrossRef]
- Zhou, W.; Arcot, Y.; Medina, R.F.; Bernal, J.; Cisneros-Zevallos, L.; Akbulut, M.E. Integrated pest management: An update on the sustainability approach to crop protection. ACS Omega 2024, 9, 41130–41147. [Google Scholar] [CrossRef]






| Primer Name | Sequence (5′-3′) | Tm (°C) | Amplicon Size | References |
|---|---|---|---|---|
| qPCR primers | ||||
| ZYMV_qPCR_CP_F | CAGCGGAGGCATACATAGAAA | 62 | 99 | This study |
| ZYMV_qPCR_CP_R | CGTATCGAGCCAAACTCCTATC | |||
| ZYMV_qPCR_HC-Pro_F | GGTACTCGTAAGTTGGCCATAG | 62 | 100 | This study |
| ZYMV_qPCR_HC-Pro_R | TGAGCGGCTTCTTCTCAATAC | |||
| PRSV_qPCR_HC-Pro_F | CACATGACAGCCATCAACAAC | 62 | 96 | This study |
| PRSV_qPCR_HC-Pro_R | TCTCACGATCTCTCGAAGACTAT | |||
| PRSV_qPCR_CP_F | GGAGATGGGAGAAGCCTATTTG | 62 | 107 | This study |
| PRSV_qPCR_CP_R | CCGTGTTGGGATTGCACTATAA | |||
| Full-length primers | ||||
| ZYMV_CP_FL_F | TCAGGCACTCAGCCAACTG | 63 | 837 | This study |
| ZYMV_CP_FL_R | CTGCATTGTATTCACACCTAGG | |||
| ZYMV_HC-Pro_FL_F | TCGTCGCAACCGGAAGTTC | 63 | 1368 | This study |
| ZYMV_HC-Pro_FL_R | GCCAACTCTGTAATGTTTCATCTC | |||
| PRSV_CP_FL_F | TCTAAAAATGAGGCTGTGGATGC | 65 | 861 | This study |
| PRSV_CP_FL_R | GTTGCGCATACCCAGGAGAGA | |||
| PRSV_Nia_FL_F | GGTTTCTCCGCACGACA | 65 | 567 | This study |
| PRSV_Nia_FL_R | TTCGTGATGAACTAATTTCGAG |
| Virus Detected | Crops | Sample ID | Genome Size of Refseq (nt) | Total sRNA Reads | € Reads Matching to Virus | ¶ Coverage (%) | ¥ Nucleotide Identity (%) |
|---|---|---|---|---|---|---|---|
| ZYMV | Pumpkin | PK1 | 9591 | 21,632,823 | 99 (0.00045) | 9591 (100) | 100 |
| PK2 | 22,698,801 | 15,845 (0.069) | 8550 (89.2) | 89.15 | |||
| PK3 | 30,127,054 | 2,980,951 (9.89) | 9006 (93.9) | 93.90 | |||
| PK4 | 20,586,748 | 41,992 (0.20) | 8866 (92.4) | 92.44 | |||
| Winter squash | WS1 | 25,536,117 | 1,742,326 (6.822) | 9001 (93.9) | 93.85 | ||
| WS2 | 26,949,961 | 1,375,873 (5.10) | 8917 (93) | 92.97 | |||
| PRSV | Pumpkin | PK1 | 10,326 | 21,632,823 | 83 (0.00038) | 10,326 (100) | 100 |
| PK2 | 22,698,801 | 483,543 (2.13) | 9264 (89.7) | 89.72 | |||
| PK3 | 30,127,054 | 324,041 (1.07) | 9362 (90.7) | 90.66 | |||
| PK4 | 20,586,748 | 109 (0.00052) | 9694 (93.8) | 93.88 | |||
| Winter squash | WS1 | 25,536,117 | 139,751 (0.54) | 9304 (90.1) | 90.10 | ||
| WS2 | 26,949,961 | 1341 (0.0049) | 8558 (82.9) | 82.88 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Acharya, N.; Kumar, M.; Bag, S.; Riley, D.G.; Diaz-Perez, J.C.; Simmons, A.M.; Coolong, T.; McAvoy, T. Prevalence of Aphid-Transmitted Potyviruses in Pumpkin and Winter Squash in Georgia, USA. Viruses 2025, 17, 233. https://doi.org/10.3390/v17020233
Acharya N, Kumar M, Bag S, Riley DG, Diaz-Perez JC, Simmons AM, Coolong T, McAvoy T. Prevalence of Aphid-Transmitted Potyviruses in Pumpkin and Winter Squash in Georgia, USA. Viruses. 2025; 17(2):233. https://doi.org/10.3390/v17020233
Chicago/Turabian StyleAcharya, Nirmala, Manish Kumar, Sudeep Bag, David G. Riley, Juan C. Diaz-Perez, Alvin M. Simmons, Timothy Coolong, and Theodore McAvoy. 2025. "Prevalence of Aphid-Transmitted Potyviruses in Pumpkin and Winter Squash in Georgia, USA" Viruses 17, no. 2: 233. https://doi.org/10.3390/v17020233
APA StyleAcharya, N., Kumar, M., Bag, S., Riley, D. G., Diaz-Perez, J. C., Simmons, A. M., Coolong, T., & McAvoy, T. (2025). Prevalence of Aphid-Transmitted Potyviruses in Pumpkin and Winter Squash in Georgia, USA. Viruses, 17(2), 233. https://doi.org/10.3390/v17020233

