DDX21 Promotes PCV3 Replication by Binding to Cap Protein and Inhibiting Interferon Responses
Abstract
1. Introduction
2. Materials and Methods
2.1. Cells and Virus
2.2. Antibodies and Reagents
2.3. Plasmid Construction
2.4. Sodium Dodecyl Sulfate–Polyacrylamide Gel Electrophoresis and Immunoblotting
2.5. Confocal Microscopy, Co-IP, and GST Pull-Down
2.6. Quantitative Real-Time Reverse Transcription PCR
2.7. Statistical Analysis
3. Results
3.1. PCV3 Infection Prevents the Repression of DDX21 at Protein and mRNA Levels
3.2. DDX21 Expression Promotes PCV3 Replication
3.3. PCV3 Cap Co-Localizes and Interacts Directly with DDX21
3.4. The NLS of PCV3 Cap Is Crucial for Binding to DDX21
3.5. The DDX21-CTD Mediated Interaction with PCV3 Cap and Facilitated Viral Replication
3.6. DDX21 Facilitates PCV3 Replication by Reducing IFN-β Production and ISG Expression
4. Discussion
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Palinski, R.; Pineyro, P.; Shang, P.C.; Yuan, F.F.; Guo, R.; Fang, Y.; Byers, E.; Hause, B.M. A novel porcine circovirus Distantly related to known circoviruses is associated with porcine dermatitis and nephropathy syndrome and reproductive failure. J. Virol. 2017, 91, e01879-16. [Google Scholar] [CrossRef] [PubMed]
- Faccini, S.; Barbieri, I.; Gilioli, A.; Sala, G.; Gibelli, L.R.; Moreno, A.; Sacchi, C.; Rosignoli, C.; Franzini, G.; Nigrelli, A. Detection and genetic characterization of porcine circovirus type 3 in Italy. Transbound. Emerg. Dis. 2017, 64, 1661–1664. [Google Scholar] [CrossRef]
- Tochetto, C.; Lima, D.A.; Varela, A.P.M.; Loiko, M.R.; Paim, W.P.; Scheffer, C.M.; Herpich, J.I.; Cerva, C.; Schmitd, C.; Cibulski, S.P.; et al. Full-genome sequence of porcine circovirus type 3 recovered from serum of sows with stillbirths in Brazil. Transbound. Emerg. Dis. 2018, 65, 5–9. [Google Scholar] [CrossRef]
- Li, G.; He, W.; Zhu, H.; Bi, Y.; Wang, R.; Xing, G.; Zhang, C.; Zhou, J.; Yuen, K.Y.; Gao, G.F.; et al. Origin, genetic diversity, and evolutionary dynamics of novel porcine circovirus 3. Adv. Sci. 2018, 5, 1800275. [Google Scholar] [CrossRef]
- Jiang, H.; Wang, D.; Wang, J.; Zhu, S.; She, R.; Ren, X.; Tian, J.; Quan, R.; Hou, L.; Li, Z.; et al. Induction of porcine dermatitis and nephropathy syndrome in piglets by infection with porcine circovirus type 3. J. Virol. 2019, 93, e02045-18. [Google Scholar] [CrossRef]
- Oh, T.; Chae, C. First isolation and genetic characterization of porcine circovirus type 3 using primary porcine kidney cells. Vet. Microbiol. 2020, 241, 108576. [Google Scholar] [CrossRef] [PubMed]
- Sirisereewan, C.; Thanawongnuwech, R.; Kedkovid, R. Current understanding of the pathogenesis of porcine circovirus 3. Pathogens 2022, 11, 64. [Google Scholar] [CrossRef]
- Shi, R.H.; Hou, L.; Wei, L.; Quan, R.; Zhou, B.; Jiang, H.J.; Wang, J.; Zhu, S.S.; Song, J.W.; Wang, D.; et al. Porcine circovirus type 3 enters into PK15 cells through clathrin- and dynamin-2-mediated endocytosis in a rab5/rab7 and pH-dependent fashion. Front. Microbiol. 2021, 12, 636307. [Google Scholar] [CrossRef] [PubMed]
- Song, J.W.; Hou, L.; Wang, D.; Wei, L.; Zhu, S.S.; Wang, J.; Quan, R.; Jiang, H.J.; Shi, R.H.; Liu, J. Nucleolar phosphoprotein NPM1 interacts with porcine circovirus type 3 Cap protein and facilitates viral replication. Front. Microbiol. 2021, 12, 679341. [Google Scholar] [CrossRef] [PubMed]
- Hou, L.; Yang, X.; Liu, C.; Guo, J.; Shi, Y.; Sun, T.; Feng, X.; Zhou, J.; Liu, J. Heme oxygenase-1 and its metabolites carbon monoxide and biliverdin, but not iron, exert antiviral activity against porcine circovirus type 3. Microbiol. Spectr. 2023, 11, e0506022. [Google Scholar] [CrossRef] [PubMed]
- Wang, D.; Zhao, J.; Yang, X.; Ji, Y.; Yu, J.; Li, Z.; Shi, Y.; Guo, J.; Zhou, J.; Hou, L.; et al. E3 ligase RNF2 inhibits porcine circovirus type 3 replication by targeting its capsid protein for ubiquitination-dependent degradation. J. Virol. 2024, 98, e0022324. [Google Scholar] [CrossRef] [PubMed]
- Liu, X.; Shen, H.; Zhang, X.; Liang, T.; Ban, Y.; Yu, L.; Zhang, L.; Liu, Y.; Dong, J.; Zhang, P.; et al. Porcine circovirus type 3 capsid protein induces NF-kappaB activation and upregulates pro-inflammatory cytokine expression in HEK-293T cells. Arch. Virol. 2021, 166, 2141–2149. [Google Scholar] [CrossRef] [PubMed]
- Mou, C.; Wang, M.; Pan, S.; Chen, Z. Identification of nuclear localization signals in the ORF2 protein of porcine circovirus type 3. Viruses 2019, 11, 1086. [Google Scholar] [CrossRef] [PubMed]
- Shen, H.Q.; Liu, X.H.; Zhang, P.F.; Wang, S.Y.; Liu, Y.L.; Zhang, L.Y.; Song, C.X. Porcine circovirus 3 Cap inhibits type I interferon signaling through interaction with STAT2. Virus Res. 2020, 275, 197804. [Google Scholar] [CrossRef]
- Wang, D.; Hou, L.; Ji, Y.; Xie, J.; Zhao, J.; Zhu, N.; Yang, X.; Zhou, J.; Cui, Y.; Guo, J.; et al. Ubiquitination-dependent degradation of nucleolin mediated by porcine circovirus type 3 capsid protein. J. Virol. 2023, 97, e0089423. [Google Scholar] [CrossRef] [PubMed]
- Zhang, P.F.; Shen, H.Q.; Liu, X.H.; Wang, S.Y.; Liu, Y.L.; Xu, Z.; Song, C.X. Porcine circovirus type 3 Cap inhibits type I interferon induction through interaction with G3BP1. Front. Vet. Sci. 2020, 7, 594438. [Google Scholar] [CrossRef]
- McRae, E.K.S.; Booy, E.P.; Moya-Torres, A.; Ezzati, P.; Stetefeld, J.; McKenna, S.A. Human DDX21 binds and unwinds RNA guanine quadruplexes. Nucleic Acids Res. 2017, 45, 6656–6668. [Google Scholar] [CrossRef] [PubMed]
- Calo, E.; Flynn, R.A.; Martin, L.; Spitale, R.C.; Chang, H.Y.; Wysocka, J. RNA helicase DDX21 coordinates transcription and ribosomal RNA processing. Nature 2015, 518, 249–253. [Google Scholar] [CrossRef] [PubMed]
- McRae, E.K.S.; Dupas, S.J.; Booy, E.P.; Piragasam, R.S.; Fahlman, R.P.; McKenna, S.A. An RNA guanine quadruplex regulated pathway to TRAIL-sensitization by DDX21. RNA 2020, 26, 44–57. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Z.Q.; Kim, T.; Bao, M.S.; Facchinetti, V.; Jung, S.Y.; Ghaffari, A.A.; Qin, J.; Cheng, G.H.; Liu, Y.J. DDX1, DDX21, and DHX36 helicases form a complex with the adaptor molecule TRIF to sense dsRNA in dendritic cells. Immunity 2011, 34, 866–878. [Google Scholar] [CrossRef] [PubMed]
- Li, J.; Fang, P.; Zhou, Y.; Wang, D.; Fang, L.; Xiao, S. DEAD-box RNA helicase 21 negatively regulates cytosolic RNA-mediated innate immune signaling. Front. Immunol. 2022, 13, 956794. [Google Scholar] [CrossRef] [PubMed]
- Li, J.; Wang, D.; Fang, P.; Pang, Y.; Zhou, Y.; Fang, L.; Xiao, S. DEAD-box RNA helicase 21 (DDX21) positively regulates the replication of porcine reproductive and respiratory syndrome virus via multiple mechanisms. Viruses 2022, 14, 467. [Google Scholar] [CrossRef]
- Bonaventure, B.; Goujon, C. DExH/D-box helicases at the frontline of intrinsic and innate immunity against viral infections. J. General. Virol. 2022, 103, 001766. [Google Scholar] [CrossRef]
- Fullam, A.; Schröder, M. DExD/H-box RNA helicases as mediators of anti-viral innate immunity and essential host factors for viral replication. BBA-Gene Regul. Mech. 2013, 1829, 854–865. [Google Scholar] [CrossRef]
- Wu, W.; Qu, Y.; Yu, S.Q.; Wang, S.; Yin, Y.C.; Liu, Q.F.; Meng, C.C.; Liao, Y.; Rehman, Z.U.; Tan, L.; et al. Caspase-dependent cleavage of DDX21 suppresses host innate immunity. Mbio 2021, 12, e0100521. [Google Scholar] [CrossRef]
- Dong, Y.C.; Ye, W.; Yang, J.; Han, P.J.; Wang, Y.; Ye, C.T.; Weng, D.H.; Zhang, F.L.; Xu, Z.K.; Lei, Y.F. DDX21 translocates from nucleus to cytoplasm and stimulates the innate immune response due to dengue virus infection. Biochem. Biophys. Res. Commun. 2016, 473, 648–653. [Google Scholar] [CrossRef] [PubMed]
- Zhou, J.; Wang, Y.; Zhou, L.; Qiu, Y.; Zhao, J.; Dai, B.; Feng, X.; Hou, L.; Liu, J. Interaction network of porcine circovirus type 3 and 4 capsids with host proteins. Viruses 2022, 14, 939. [Google Scholar] [CrossRef] [PubMed]
- Zhou, J.; Li, J.; Li, H.; Zhang, Y.; Dong, W.; Jin, Y.; Yan, Y.; Gu, J.; Zhou, J. The serine-48 residue of nucleolar phosphoprotein nucleophosmin-1 plays critical role in subcellular localization and interaction with porcine circovirus type 3 capsid protein. Vet. Res. 2021, 52, 4. [Google Scholar] [CrossRef]
- Zhou, J.; Wang, Y.; Qiu, Y.; Wang, Y.; Yang, X.; Liu, C.; Shi, Y.; Feng, X.; Hou, L.; Liu, J. Contribution of DEAD-box RNA helicase 21 to the nucleolar localization of porcine circovirus type 4 capsid protein. Front. Microbiol. 2022, 13, 802740. [Google Scholar] [CrossRef]
- Zhou, J.W.; Qiu, Y.H.; Zhu, N.; Zhou, L.Y.; Dai, B.N.; Feng, X.F.; Hou, L.; Liu, J. The nucleolar localization signal of porcine circovirus type 4 capsid protein is essential for interaction with serine-48 residue of nucleolar phosphoprotein nucleophosmin-1. Front. Microbiol. 2021, 12, 751382. [Google Scholar] [CrossRef] [PubMed]
- Zhou, J.W.; Qiu, Y.H.; Zhao, J.; Wang, Y.X.; Zhu, N.; Wang, D.D.; Cui, Y.Q.; Guo, J.S.; Sun, T.; Ji, Y.; et al. The network of interactions between the porcine epidemic diarrhea virus nucleocapsid and host cellular proteins. Viruses 2022, 14, 2269. [Google Scholar] [CrossRef] [PubMed]
- Zhou, J.W.; Dai, Y.D.; Lin, C.; Zhang, Y.; Feng, Z.X.; Dong, W.R.; Jin, Y.L.; Yan, Y.; Zhou, J.Y.; Gu, J.Y. Nucleolar protein NPM1 is essential for circovirus replication by binding to viral capsid. Virulence 2020, 11, 1379–1393. [Google Scholar] [CrossRef] [PubMed]
- Lischwe, M.A.; Richards, R.L.; Busch, R.K.; Busch, H. Localization of phosphoprotein C23 to nucleolar structures and to the nucleolus organizer regions. Exp. Cell Res. 1981, 136, 101–109. [Google Scholar] [CrossRef] [PubMed]
- Rocak, S.; Linder, P. DEAD-box proteins: The driving forces behind RNA metabolism. Nat. Rev. Mol. Cell Biol. 2004, 5, 232–241. [Google Scholar] [CrossRef] [PubMed]
- Lee, K.G.; Kim, S.S.Y.; Kui, L.; Voon, D.C.C.; Mauduit, M.; Bist, P.; Bi, X.Z.; Pereira, N.A.; Liu, C.C.; Sukumaran, B.; et al. Bruton’s tyrosine kinase phosphorylates DDX41 and activates its binding of dsDNA and STING to initiate type 1 interferon response. Cell Rep. 2015, 10, 1055–1065. [Google Scholar] [CrossRef]
- Zan, J.; Xu, R.X.; Tang, X.L.; Lu, M.Y.; Xie, S.S.; Cai, J.; Huang, Z.; Zhang, J.Y. RNA helicase DDX5 suppresses IFN-I antiviral innate immune response by interacting with PP2A-Cβ to deactivate IRF3. Exp. Cell Res. 2020, 396, 112332. [Google Scholar] [CrossRef] [PubMed]
- Zhou, J.; Zhao, J.; Sun, H.; Dai, B.; Zhu, N.; Dai, Q.; Qiu, Y.; Wang, D.; Cui, Y.; Guo, J.; et al. DEAD-box RNA helicase 21 interacts with porcine circovirus type 2 Cap protein and facilitates viral replication. Front. Microbiol. 2024, 15, 1298106. [Google Scholar] [CrossRef] [PubMed]
- Flores-Rozas, H.; Hurwitz, J. Characterization of a new RNA helicase from nuclear extracts of HeLa cells which translocates in the 5′ to 3′ direction. J. Biol. Chem. 1993, 268, 21372–21383. [Google Scholar] [CrossRef]
- Valdez, B.C.; Henning, D.; Busch, R.K.; Woods, K.; Flores-Rozas, H.; Hurwitz, J.; Perlaky, L.; Busch, H. A nucleolar RNA helicase recognized by autoimmune antibodies from a patient with watermelon stomach disease. Nucleic Acids Res. 1996, 24, 1220–1224. [Google Scholar] [CrossRef] [PubMed]
- Holmstrom, T.H.; Mialon, A.; Kallio, M.; Nymalm, Y.; Mannermaa, L.; Holm, T.; Johansson, H.; Black, E.; Gillespie, D.; Salminen, T.A.; et al. c-Jun supports ribosomal RNA processing and nucleolar localization of RNA helicase DDX21. J. Biol. Chem. 2008, 283, 7046–7053. [Google Scholar] [CrossRef]
- Xing, Y.H.; Yao, R.W.; Zhang, Y.; Guo, C.J.; Jiang, S.; Xu, G.; Dong, R.; Yang, L.; Chen, L.L. SLERT regulates DDX21 rings associated with Pol I transcription. Cell 2017, 169, 664–678.e16. [Google Scholar] [CrossRef] [PubMed]
- Foy, E.; Li, K.; Sumpter, R.; Loo, Y.M.; Johnson, C.L.; Wang, C.F.; Fish, P.M.; Yoneyama, M.; Fujita, T.; Lemon, S.M.; et al. Control of antiviral defenses through hepatitis C virus disruption of retinoic acid-inducible gene-I signaling. Proc. Natl. Acad. Sci. USA 2005, 102, 2986–2991. [Google Scholar] [CrossRef] [PubMed]
- Matsumoto, M.; Funami, K.; Tanabe, M.; Oshiumi, H.; Shingai, M.; Seto, Y.; Yamamoto, A.; Seya, T. Subcellular localization of toll-like receptor 3 in human dendritic cells. J. Immunol. 2003, 171, 3154–3162. [Google Scholar] [CrossRef] [PubMed]
- Stumper, R.; Loo, Y.M.; Foy, E.; Li, K.; Yoneyama, M.; Fujita, T.; Lemon, S.M.; Gale, M. Regulating intracellular antiviral defense and permissiveness to hepatitis C virus RNA replication through a cellular RNA helicase, RIG-I. J. Virol. 2005, 79, 2689–2699. [Google Scholar] [CrossRef]
- Xu, L.G.; Wang, Y.Y.; Han, K.J.; Li, L.Y.; Zhai, Z.H.; Shu, H.B. VISA is an adapter protein required for virus-triggered IFN-β signaling. Mol. Cell 2005, 19, 727–740. [Google Scholar] [CrossRef]
- Heil, F.; Hemmi, H.; Hochrein, H.; Ampenberger, F.; Kirschning, C.; Akira, S.; Lipford, G.; Wagner, H.; Bauer, S. Species-specific recognition of single-stranded RNA via toll-like receptor 7 and 8. Science 2004, 303, 1526–1529. [Google Scholar] [CrossRef] [PubMed]






| Gene Product | Sense Primer (5′ to 3′) | Antisense Primer (5′ to 3′) |
|---|---|---|
| RT-DDX21 | TAGAGAAGCACGCTGAGCAC | GCAAGTTTCTGCCCCCTACT |
| RT-IFN-β | GTTGCCTGGGACTCCTCAAT | ACGGTTTCATTCCAGCCAGT |
| RT-MX1 | GTCATCGGGGACCAGAGTTC | TCCCGGTAACTGACTTTGCC |
| RT-MX2 | GTCATCGGGGACCAGAGTTC | CTCCACTTTGCGGTAGCTGA |
| RT-OAS1 | GGCTGACCCCACCTACAATG | GGGACTGGGCTCTTGTTGTT |
| RT-ISG15 | GGCAATGTGCTTCAGGATGG | CAGACCTCATAGGCGTTGCT |
| GAPDH | TCGGAGTGAACGGATTTGGC | TGACAAGCTTCCCGTTCTCC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Sun, H.; Dai, Q.; Zhou, B.; Lan, X.; Qiu, Y.; Zhang, Q.; Wang, D.; Cui, Y.; Guo, J.; Hou, L.; et al. DDX21 Promotes PCV3 Replication by Binding to Cap Protein and Inhibiting Interferon Responses. Viruses 2025, 17, 166. https://doi.org/10.3390/v17020166
Sun H, Dai Q, Zhou B, Lan X, Qiu Y, Zhang Q, Wang D, Cui Y, Guo J, Hou L, et al. DDX21 Promotes PCV3 Replication by Binding to Cap Protein and Inhibiting Interferon Responses. Viruses. 2025; 17(2):166. https://doi.org/10.3390/v17020166
Chicago/Turabian StyleSun, Haoyu, Qianhong Dai, Beiyi Zhou, Xiaoyuan Lan, Yonghui Qiu, Qianqian Zhang, Dedong Wang, Yongqiu Cui, Jinshuo Guo, Lei Hou, and et al. 2025. "DDX21 Promotes PCV3 Replication by Binding to Cap Protein and Inhibiting Interferon Responses" Viruses 17, no. 2: 166. https://doi.org/10.3390/v17020166
APA StyleSun, H., Dai, Q., Zhou, B., Lan, X., Qiu, Y., Zhang, Q., Wang, D., Cui, Y., Guo, J., Hou, L., Liu, J., & Zhou, J. (2025). DDX21 Promotes PCV3 Replication by Binding to Cap Protein and Inhibiting Interferon Responses. Viruses, 17(2), 166. https://doi.org/10.3390/v17020166

