Reliable Polymerase Chain Reaction Methods for Screening for Porcine Endogenous Retroviruses-C (PERV-C) in Pigs
Abstract
1. Introduction
2. Materials and Methods
2.1. Animals and Tissues
2.2. DNA Isolation and Characterization
2.3. PCR and Real-Time PCR
2.4. Sanger Sequencing
2.5. Nanopore Sequencing
2.6. Sequence Alignment and Phylogenetic Tree
| Primer/Probe | Sequence 5′-3′ | Location a | PERV-C b | PERV-A c |
|---|---|---|---|---|
| PERV-C | ||||
| PCR1 fwd d | CTGACCTGGATTAGAACTGG | 6606-6625 | yes | no |
| PCR1 rev e | CCAGGACCATCCTCTAACAT | 6867-6886 | yes | no |
| PCR4 fwd | GATTAGAACTGGAAGCCCCAAGTGCTCT | 6614-6641 | yes | no |
| PCR4 rev | ACCATCCTCTAACATAACTTCTGGATCAGA | 6872-6901 | yes | no |
| PCR5 fwd | CTATTCGCCTCAAAATAAACCAG | 6778-6800 | yes | no |
| PCR5 rev = PCR8 rev = PCR9 rev | CATAGAGACCAATGCACATG | 7086-7105 | yes | no |
| PCR6 fwd = PCR8 fwd = PCR10 fwd | CCAGGACCACCAAATAATGG | 6435-6454 | yes | no |
| PCR6 rev = envC real time rev | ACTAAAATGGGGGCAAAACTT | 6924-6944 | yes | no |
| envC real-time fwd = PCR9 fwd | CCCCAACCCAAGGACCAG | 6853-6870 | yes | no |
| envC real-time probe | FAM-CTCTAACATAACTTCTGGATCAGACCC-BHQ1 | 6878-6904 | Yes | no |
| PCR10 rev | CACTGAAGCCTTTAATCAAACC | 7183-7205 | yes | no |
| PERV-A/C (380 bp amplicon) | ||||
| PERV-A-VRB f fwd | CCTACCAGTTATAATCAATTTAATTATGGC | 6129-6158 | no | yes |
| PERV-C rev | TATGTTAGAGGATGGTCCTGGTC | 6451-6473 | yes | no |
| PERV-A/C (1260 bp amplicon) | ||||
| PERV-A-VRB—fwd PERV-C-TMR g rev | CCTACCAGTTATAATCAATTTAATTATGGC CTCAAACCACCCTTGAGTAGTTTCC | 6129-6158 7370-7395 | no yes | yes no |
| pGAPDH | ||||
| pGAPDH-fwd pGAPDH-rev pGAPDH-probe | ACATGGCCTCCAAGGAGTAAGA TCAGTGTCGGGGTTGAGCTAG HEX-CCA CCA ACC CCA GCA AGA G-BHQ | |||
3. Results
3.1. PCR Methods Used for the Detection of PERV-C
3.2. Application of These Methods to Detect PERV-C in Different Pigs
3.3. Sequence Analysis of PERV-C from Indigenous Greek Black Pigs
3.4. Analysis of the Primer Binding Sites
3.5. The Real-Time PCR Is Not PERV-C-Specific
3.6. Sequences Obtained by PCR10
3.7. Screening for PERV-A/C
4. Discussion
- 1.
- To date, PERV has not infected recipients in preclinical and clinical xenotransplantations (see above), even when PERV-C-positive animals were used as donors.
- 2.
- Although CRISPR/Cas technology is highly specific, the risk of unintended off-target modifications in the DNA is not yet fully understood.
- 3.
- Producing a large number of CRISPR/Cas-treated animals with inactivated PERVs presents challenges, as this requires cloning, which is inefficient and may negatively impact the expression of introduced human transgenes.
- a.
- The cloning efficiency is relatively low. In the first reported study, 37 PERV-inactivated piglets were produced from 17 sows, but only 15 piglets survived [45].
- b.
- 4.
- Pig PK15 cells treated with PERV-specific CRISPR/Cas still release viral particles, although these particles are thought to be non-infectious [56]. These particles contain viral genomic RNA with an inactivated reverse transcriptase sequence. However, it cannot be excluded that these particles might enter human cells, as they carry functional envelope proteins. While the inactivated reverse transcriptase prevents viral RNA from being transcribed into DNA, human cells express reverse transcriptase from LINE sequences [57] or human endogenous retroviruses (HERVs) [58]. Consequently, the possibility cannot be ruled out that these human reverse transcriptases could potentially rescue PERVs, facilitating reverse transcription and integration.
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Takeuchi, Y.; Patience, C.; Magre, S.; Weiss, R.A.; Banerjee, P.T.; Le Tissier, P.; Stoye, J.P. Host range and interference studies of three classes of pig endogenous retrovirus. J. Virol. 1998, 72, 9986–9991. [Google Scholar] [CrossRef] [PubMed]
- Tönjes, R.R.; Niebert, M. Relative age of proviral porcine endogenous retrovirus sequences in Sus scrofa based on the molecular clock hypothesis. J. Virol. 2003, 77, 12363–12368. [Google Scholar] [CrossRef] [PubMed]
- Chen, Y.; Chen, X.; Duan, X.; Cui, J. Ancient origin and complex evolution of porcine endogenous retroviruses. Biosaf. Health 2020, 2, 142–151. [Google Scholar] [CrossRef]
- Denner, J. The origin of porcine endogenous retroviruses (PERVs). Arch. Virol. 2021, 166, 1007–1013. [Google Scholar] [CrossRef]
- Denner, J.; Tönjes, R.R. Infection barriers to successful xenotransplantation focusing on porcine endogenous retroviruses. Clin. Microbiol. Rev. 2012, 25, 318–343. [Google Scholar] [CrossRef]
- Bartosch, B.; Stefanidis, D.; Myers, R.; Weiss, R.; Patience, C.; Takeuchi, Y. Evidence and consequence of porcine endogenous retrovirus recombination. J. Virol. 2004, 78, 13880–13890. [Google Scholar] [CrossRef]
- Wood, J.C.; Quinn, G.; Suling, K.M.; Oldmixon, B.A.; Van Tine, B.A.; Cina, R.; Arn, S.; Huang, C.A.; Scobie, L.; Onions, D.E.; et al. Identification of exogenous forms of human-tropic porcine endogenous retrovirus in miniature Swine. J. Virol. 2004, 78, 2494–2501. [Google Scholar] [CrossRef]
- Denner, J.; Specke, V.; Thiesen, U.; Karlas, A.; Kurth, R. Genetic alterations of the long terminal repeat of an ecotropic porcine endogenous retrovirus during passage in human cells. Virology 2003, 314, 125–133. [Google Scholar] [CrossRef]
- Harrison, I.; Takeuchi, Y.; Bartosch, B.; Stoye, J.P. Determinants of high titer in recombinant porcine endogenous retroviruses. J. Virol. 2004, 78, 13871–13879. [Google Scholar] [CrossRef]
- Hering, B.J.; Cooper, D.K.; Cozzi, E.; Schuurman, H.J.; Korbutt, G.S.; Denner, J.; O’Connell, P.J.; Vanderpool, H.Y.; Pierson, R.N., 3rd. The international xenotransplantation association consensus statement on conditions for undertaking clinical trials of porcine islet products in type 1 diabetes–executive summary. Xenotransplantation 2009, 16, 196–202. [Google Scholar] [CrossRef]
- Pal, N.; Baker, R.; Schalk, S.; Scobie, L.; Tucker, A.W.; Opriessnig, T. Detection of porcine endogenous retrovirus (PERV) viremia in diseased versus healthy US pigs by qualitative and quantitative real-time RT-PCR. Transbound. Emerg. Dis. 2011, 58, 344–351. [Google Scholar] [CrossRef] [PubMed]
- Kaulitz, D.; Mihica, D.; Dorna, J.; Costa, M.R.; Petersen, B.; Niemann, H.; Tönjes, R.R.; Denner, J. Development of sensitive methods for detection of porcine endogenous retrovirus-C (PERV-C) in the genome of pigs. J. Virol. Methods 2011, 175, 60–65. [Google Scholar] [CrossRef] [PubMed]
- Guo, F.; Xing, X.; Hawthorne, W.J.; Dong, Q.; Ye, B.; Zhang, J.; Liang, Q.; Nie, W.; Wang, W. Characterization of PERV in a new conserved pig herd as potential donor animals for xenotransplantation in China. Virol. J. 2014, 11, 212. [Google Scholar] [CrossRef]
- Gazda, L.S.; Collins, J.; Lovatt, A.; Holdcraft, R.W.; Morin, M.J.; Galbraith, D.; Graham, M.; Laramore, M.A.; Maclean, C.; Black, J.; et al. A comprehensive microbiological safety approach for agarose encapsulated porcine islets intended for clinical trials. Xenotransplantation 2016, 23, 444–463. [Google Scholar] [CrossRef]
- Kaulitz, D.; Mihica, D.; Adlhoch, C.; Semaan, M.; Denner, J. Improved pig donor screening including newly identified variants of porcine endogenous retrovirus-C (PERV-C). Arch. Virol. 2013, 158, 341–348. [Google Scholar] [CrossRef]
- Denner, J. How Active Are Porcine Endogenous Retroviruses (PERVs)? Viruses 2016, 8, 215. [Google Scholar] [CrossRef]
- Fiebig, U.; Fischer, K.; Bähr, A.; Runge, C.; Schnieke, A.; Wolf, E.; Denner, J. Porcine endogenous retroviruses: Quantification of the copy number in cell lines, pig breeds, and organs. Xenotransplantation 2018, 25, e12445. [Google Scholar] [CrossRef]
- Krüger, L.; Stillfried, M.; Prinz, C.; Schröder, V.; Neubert, L.K.; Denner, J. Copy Number and Prevalence of Porcine Endogenous Retroviruses (PERVs) in German Wild Boars. Viruses 2020, 12, 419. [Google Scholar] [CrossRef]
- Sypniewski, D.; Machnik, G.; Mazurek, U.; Wilczok, T.; Smorag, Z.; Jura, J.; Gajda, B. Distribution of porcine endogenous retroviruses (PERVs) DNA in organs of a domestic pig. Ann. Transpl. 2005, 10, 46–51. [Google Scholar]
- Mazurek, U.; Kimsa, M.C.; Strzalka-Mrozik, B.; Kimsa, M.W.; Adamska, J.; Lipinski, D.; Zeyland, J.; Szalata, M.; Slomski, R.; Jura, J.; et al. Quantitative analysis of porcine endogenous retroviruses in different organs of transgenic pigs generated for xenotransplantation. Curr. Microbiol. 2013, 67, 505–514. [Google Scholar] [CrossRef]
- Fiebig, U.; Krüger, L.; Denner, J. Determination of the Copy Number of Porcine Endogenous Retroviruses (PERV) in Auckland Island Pigs Repeatedly Used for Clinical Xenotransplantation and Elimination of PERV-C. Microorganisms 2024, 12, 98. [Google Scholar] [CrossRef] [PubMed]
- Jhelum, H.; Papatsiros, V.; Papakonstantinou, G.; Krabben, L.; Kaufer, B.; Denner, J. Screening for viruses in indigenous Greek black pigs. Microorganisms 2024, 12, 315. [Google Scholar] [CrossRef] [PubMed]
- Lange, A.; Medugorac, I.; Ali, A.; Kessler, B.; Kurome, M.; Zakhartchenko, V.; Hammer, S.; Hauser, A.; Denner, J.; Dobenecker, B.; et al. Genetic diversity, growth and heart function of Auckland Island pigs, a potential source for organ xenotransplantation. Xenotransplantation 2024, 31, e12858. [Google Scholar] [CrossRef]
- Hinrichs, A.; Riedel, E.O.; Klymiuk, N.; Blutke, A.; Kemter, E.; Längin, M.; Dahlhoff, M.; Keßler, B.; Kurome, M.; Zakhartchenko, V.; et al. Growth hormone receptor knockout to reduce the size of donor pigs for preclinical xenotransplantation studies. Xenotransplantation 2021, 28, e12664. [Google Scholar] [CrossRef]
- Fan, B.; Gongora, J.; Chen, Y.; Garkavenko, O.; Li Moran, C. Population genetic variability and origin of Auckland Island feral pigs. J. R. Soc. N. Z. 2005, 35, 279–285. [Google Scholar] [CrossRef]
- Garkavenko, O.; Muzina, M.; Muzina, Z.; Powels, K.; Elliott, R.B.; Croxson, M.C. Monitoring for potentially xenozoonotic viruses in New Zealand pigs. J. Med. Virol. 2004, 72, 338–344. [Google Scholar] [CrossRef]
- Garkavenko, O.; Dieckhoff, B.; Wynyard, S.; Denner, J.; Elliott, R.B.; Tan, P.L.; Croxson, M.C. Absence of transmission of potentially xenotic viruses in a prospective pig to primate islet xenotransplantation study. J. Med. Virol. 2008, 80, 2046–2052. [Google Scholar] [CrossRef]
- Wynyard, S.; Nathu, D.; Garkavenko, O.; Denner, J.; Elliott, R. Microbiological safety of the first clinical pig islet xenotransplantation trial in New Zealand. Xenotransplantation 2014, 21, 309–323. [Google Scholar] [CrossRef]
- Morozov, V.A.; Wynyard, S.; Matsumoto, S.; Abalovich, A.; Denner, J.; Elliott, R. No PERV transmission during a clinical trial of pig islet cell transplantation. Virus Res. 2017, 227, 34–40. [Google Scholar] [CrossRef]
- Garkavenko, O.; Wynyard, S.; Nathu, D.; Simond, D.; Muzina, M.; Muzina, Z.; Scobie, L.; Hector, R.D.; Croxson, M.C.; Tan, P.; et al. Porcine endogenous retrovirus (PERV) and its transmission characteristics: A study of the New Zealand designated pathogen-free herd. Cell Transpl. 2008, 17, 1381–1388. [Google Scholar] [CrossRef]
- Jhelum, H.; Kaufer, B.; Denner, J. Application of methods detecting xenotransplantation-relevant viruses for screening German slaughterhouse pigs. Viruses 2024, 16, 1119. [Google Scholar] [CrossRef] [PubMed]
- Dieckhoff, B.; Kessler, B.; Jobst, D.; Kues, W.; Petersen, B.; Pfeifer, A.; Kurth, R.; Niemann, H.; Wolf, E.; Denner, J. Distribution and expression of porcine endogenous retroviruses in multi-transgenic pigs generated for xenotransplantation. Xenotransplantation 2009, 16, 64–73. [Google Scholar] [CrossRef]
- Preuss, T.; Fischer, N.; Boller, K.; Tonjes, R.R. Isolation and characterization of an infectious replication-competent molecular clone of ecotropic porcine endogenous retrovirus class C. J. Virol. 2006, 80, 10258–10261. [Google Scholar] [CrossRef]
- Denner, J.; Längin, M.; Reichart, B.; Krüger, L.; Fiebig, U.; Mokelke, M.; Radan, J.; Mayr, T.; Milusev, A.; Luther, F.; et al. Impact of porcine cytomegalovirus on long-term orthotopic cardiac xenotransplant survival. Sci. Rep. 2020, 10, 17531. [Google Scholar] [CrossRef]
- Scobie, L.; Taylor, S.; Wood, J.C.; Suling, K.M.; Quinn, G.; Meikle, S.; Patience, C.; Schuurman, H.J.; Onions, D.E. Absence of replication-competent human-tropic porcine endogenous retroviruses in the germ line DNA of inbred miniature Swine. J. Virol. 2004, 78, 2502–2509. [Google Scholar] [CrossRef]
- Duvigneau, J.; Hartl, R.; Groiss, S.; Gemeiner, M. Quantitative simultaneous multiplex real-time PCR for the detection of porcine cytokines. J. Immunol. Methods 2005, 306, 16–27. [Google Scholar] [CrossRef]
- Dieckhoff, B.; Karlas, A.; Hofmann, A.; Kues, W.A.; Petersen, B.; Pfeifer, A.; Niemann, H.; Kurth, R.; Denner, J. Inhibition of porcine endogenous retroviruses (PERVs) in primary porcine cells by RNA interference using lentiviral vectors. Arch. Virol. 2007, 152, 629–634. [Google Scholar] [CrossRef]
- Krüger, L.; Kristiansen, Y.; Reuber, E.; Möller, L.; Laue, M.; Reimer, C.; Denner, J. A Comprehensive Strategy for Screening for Xenotransplantation-Relevant Viruses in a Second Isolated Population of Göttingen Minipigs. Viruses 2019, 12, 38. [Google Scholar] [CrossRef]
- Halecker, S.; Krabben, L.; Kristiansen, Y.; Krüger, L.; Möller, L.; Becher, D.; Laue, M.; Kaufer, B.; Reimer, C.; Denner, J. Rare isolation of human-tropic recombinant porcine endogenous retroviruses PERV-A/C from Göttingen minipigs. Virol. J. 2022, 19, 30. [Google Scholar] [CrossRef]
- Karlas, A.; Irgang, M.; Votteler, J.; Specke, V.; Ozel, M.; Kurth, R.; Denner, J. Characterisation of a human cell-adapted porcine endogenous retrovirus PERV-A/C. Ann. Transpl. 2010, 15, 45–54. [Google Scholar]
- Wu, J.; Ma, Y.; Lv, M.; Yang, Y.; Guo, Y.; Yu, X.; Tian, K.; Zhang, J. Large-scale survey of porcine endogenous retrovirus in Chinese miniature pigs. Comp. Immunol. Microbiol. Infect. Dis. 2008, 31, 367–371. [Google Scholar] [CrossRef] [PubMed]
- Denner, J. What does the PERV copy number tell us? Xenotransplantation 2022, 29, e12732. [Google Scholar] [CrossRef] [PubMed]
- Gemeniano, M.; Mpanju, O.; Salomon, D.R.; Eiden, M.V.; Wilson, C.A. The infectivity and host range of the ecotropic porcine endogenous retrovirus, PERV-C, is modulated by residues in the C-terminal region of its surface envelope protein. Virology 2006, 346, 108–117. [Google Scholar] [CrossRef] [PubMed]
- Yang, L.; Güell, M.; Niu, D.; George, H.; Lesha, E.; Grishin, D.; Aach, J.; Shrock, E.; Xu, W.; Poci, J.; et al. Genome-wide inactivation of porcine endogenous retroviruses (PERVs). Science 2015, 350, 1101–1104. [Google Scholar] [CrossRef]
- Niu, D.; Wei, H.J.; Lin, L.; George, H.; Wang, T.; Lee, I.H.; Zhao, H.Y.; Wang, Y.; Kan, Y.; Shrock, E.; et al. Inactivation of porcine endogenous retrovirus in pigs using CRISPR-Cas9. Science 2017, 357, 1303–1307. [Google Scholar] [CrossRef]
- Semaan, M.; Ivanusic, D.; Denner, J. Cytotoxic effects during knock out of multiple porcine endogenous retrovirus (PERV) sequences in the pig genome by zinc finger nucleases (ZFN). PLoS ONE 2015, 10, e0122059. [Google Scholar] [CrossRef]
- Denner, J. Why was PERV not transmitted during preclinical and clinical xenotransplantation trials and after inoculation of animals? Retrovirology 2018, 15, 28. [Google Scholar] [CrossRef]
- Issa, N.C.; Wilkinson, R.A.; Griesemer, A.; Cooper, D.K.; Yamada, K.; Sachs, D.H.; Fishman, J.A. Absence of replication of porcine endogenous retrovirus and porcine lymphotropic herpesvirus type 1 with prolonged pig cell microchimerism after pig-to-baboon xenotransplantation. J. Virol. 2008, 82, 12441–12448. [Google Scholar] [CrossRef]
- Plotzki, E.; Wolf-van Buerck, L.; Knauf, Y.; Becker, T.; Maetz-Rensing, K.; Schuster, M.; Baehr, A.; Klymiuk, N.; Wolf, E.; Seissler, J.; et al. Virus safety of islet cell transplantation from transgenic pigs to marmosets. Virus Res. 2015, 204, 95–102. [Google Scholar] [CrossRef]
- Morozov, V.A.; Ludwig, S.; Ludwig, B.; Rotem, A.; Barkai, U.; Bornstein, S.R.; Denner, J. Islet cell transplantation from Gottingen minipigs to cynomolgus monkeys: Analysis of virus safety. Xenotransplantation 2016, 23, 320–327. [Google Scholar] [CrossRef]
- Denner, J.; Schuurman, H.J.; Patience, C. The International Xenotransplantation Association consensus statement on conditions for undertaking clinical trials of porcine islet products in type 1 diabetes—Chapter 5: Strategies to prevent transmission of porcine endogenous retroviruses. Xenotransplantation 2009, 16, 239–248. [Google Scholar] [CrossRef] [PubMed]
- Mohiuddin, M.M.; Singh, A.K.; Scobie, L.; Goerlich, C.E.; Grazioli, A.; Saharia, K.; Crossan, C.; Burke, A.; Drachenberg, C.; Oguz, C.; et al. Graft dysfunction in compassionate use of genetically engineered pig-to-human cardiac xenotransplantation: A case report. Lancet 2023, 402, 397–410. [Google Scholar] [CrossRef] [PubMed]
- Archer, G.S.; Dindot, S.; Friend, T.H.; Walker, S.; Zaunbrecher, G.; Lawhorn, B.; Piedrahita, J.A. Hierarchical phenotypic and epigenetic variation in cloned swine. Biol. Reprod. 2003, 69, 430–436. [Google Scholar] [CrossRef]
- Triantaphyllopoulos, K.A.; Ikonomopoulos, I.; Bannister, A.J. Epigenetics and inheritance of phenotype variation in livestock. Epigenetics Chromatin 2016, 9, 31. [Google Scholar] [CrossRef]
- Wang, M.; Feng, S.; Ma, G.; Miao, Y.; Zuo, B.; Ruan, J.; Zhao, S.; Wang, H.; Du, X.; Liu, X. Whole-Genome Methylation Analysis Reveals Epigenetic Variation in Cloned and Donor Pigs. Front. Genet. 2020, 11, 23. [Google Scholar] [CrossRef]
- Godehardt, A.W.; Fischer, N.; Rauch, P.; Gulich, B.; Boller, K.; Church, G.M.; Tönjes, R.R. Characterization of porcine endogenous retrovirus particles released by the CRISPR/Cas9 inactivated cell line PK15 clone. Xenotransplantation 2020, 27, e12563. [Google Scholar] [CrossRef]
- Spadafora, C. A Reverse Transcriptase-Dependent Mechanism Plays Central Roles in Fundamental Biological Processes. Syst. Biol. Reprod. Med. 2008, 54, 11–21. [Google Scholar] [CrossRef]
- Baldwin, E.T.; Götte, M.; Tchesnokov, E.P.; Arnold, E.; Hagel, M.; Nichols, C.; Dossang, P.; Lamers, M.; Wan, P.; Steinbacher, S.; et al. Human Endogenous Retrovirus-K (HERV-K) Reverse Transcriptase (RT) Structure and Biochemistry Reveals Remarkable Similarities to HIV-1 RT and Opportunities for HERV-K-Specific Inhibition. Proc. Natl. Acad. Sci. USA 2022, 119, e2200260119. [Google Scholar] [CrossRef]
- Anand, R.P.; Layer, J.V.; Heja, D.; Hirose, T.; Lassiter, G.; Firl, D.J.; Paragas, V.B.; Akkad, A.; Chhangawala, S.; Colvin, R.B.; et al. Design and testing of a humanized porcine donor for xenotransplantation. Nature 2023, 622, 393–401. [Google Scholar] [CrossRef]
- Wolf, E.; Reichart, B. Kidney xenotransplantation edges closer to the clinic. Nat. Rev. Nephrol. 2024, 20, 204–205. [Google Scholar] [CrossRef]
- Massachusetts General Hospital. Available online: https://www.massgeneral.org/news/press-release/worlds-first-genetically-edited-pig-kidney-transplant-into-living-recipient (accessed on 7 January 2025).
- Zhao, W. Pig organs in humans: A forum on xenotransplantation. Natl. Sci. Rev. 2024, 11, nwae208. [Google Scholar] [CrossRef] [PubMed]




| Pigs, Pig Cells | Origin | Characterization |
|---|---|---|
| Indigenous Greek black pigs | Farm 1 located near Drama, North Greece [22] | These animals had been screened for different porcine viruses using real-time PCR (PCMV/PRV, PCV2, PCV3, PCV4, PLHV-1, PLHV-2, and PLHV-3), as well as real-time RT-PCR (HEV genotype 3), using liver and spleen tissues from 4 animals. |
| Auckland Island pigs | Prof. Eckhard Wolf and Dr. Barbara Keßler, Chair for Molecular Animal Breeding and Biotechnology and CiMM, Munich | Three female animals born in June 2023; they are the F1 generation of the animals born in April 2019 and were obtained by somatic cell nuclear transfer (SCNT) using PERV-C-negative kidney cells [21]. PBMCs were isolated from blood samples by gradient centrifugation, as described in [32]. |
| German slaughterhouse pigs | Slaughterhouse near Berlin | Liver and spleen tissues from 10 animals aged 6 months. |
| Porcine kidney cell line PK15 | Leibniz Institute DSMZ German Collection of Microorganisms and Cell lines, Braunschweig, Germany (ACC 640) | Using droplet digital PCR (ddPCR), 55 (52.5–60.1) PERV copies were detected in PK15 cells using porcine GAPDH as a reference gene, or 37 (35.0–39.1) copies using porcine beta actin (ACTB) as a reference [17]. |
| Mean ct | 260/280 nm Values a | ||
|---|---|---|---|
| PERV-C | pGAPDH | ||
| Indigenous Greek black pigs, farm 1 | |||
| Pig 1 spleen | 25.07 | 19.16 | 1.85 |
| liver | 26.38 | 19.86 | 1.89 |
| Pig 2 spleen | 21.06 | 19.14 | 1.90 |
| liver | 21.47 | 19.92 | 1.80 |
| Pig 3 spleen | 26.92 | 19.93 | 1.87 |
| liver | 26.23 | 19.98 | 1.82 |
| Pig 4 spleen | 21.29 | 19.92 | 1.91 |
| liver | 20.70 | 19.20 | 1.86 |
| Positive control | 19.25 | 19.93 | n.t. |
| Auckland Island pigs | |||
| 13947 | n.d. | 19.53 | 1.81 |
| 13980 | n.d. | 19.03 | 1.89 |
| 13983 | n.d. | 19.19 | 1.90 |
| Positive control | 21.39 | 20.99 | n.t. |
| German slaughterhouse pigs | |||
| Pig 1 spleen | 24.57 | 18.52 | 1.83 |
| liver | 28.66 | 20.12 | 1.91 |
| Pig 2 spleen | 21.67 | 17.68 | 1.80 |
| liver | 22.00 | 18.30 | 1.83 |
| Pig 3 spleen | 26.43 | 17.51 | 1.92 |
| liver | 31.05 | 20.08 | 1.84 |
| Pig 4 spleen | 25.11 | 18.20 | 1.86 |
| liver | 26.46 | 19.24 | 1.90 |
| Pig 5 spleen | 25.78 | 19.02 | 1.87 |
| liver | 28.90 | 20.00 | 1.93 |
| Pig 6 spleen | 26.36 | 19.39 | 1.89 |
| liver | 26.19 | 19.97 | 1.90 |
| Pig 7 spleen | 25.78 | 19.22 | 1.81 |
| liver | 27.42 | 20.17 | 1.82 |
| Pig 8 spleen | 23.49 | 19.59 | 1.85 |
| liver | 23.05 | 20.10 | 1.92 |
| Pig 9 spleen | 29.40 | 19.06 | 1.84 |
| liver | 31.68 | 19.84 | 1.93 |
| Pig 10 spleen | 27.12 | 19.12 | 1.87 |
| liver | 33.57 | 20.25 | 1.91 |
| Positive control | 22.03 | 20.10 | n.t. |
| PK15 | 24.40 | 18.89 | n.t. |
| PCR | Fwd/Rev | |||
|---|---|---|---|---|
| 1 | fwd | Primer | CTGACCTGGATTAGAACTGG | |
| Pig 3 | disrupted | PCR8 | ||
| Pig 4 | CTGACCTGGATTAGAACTGG | PCR8 | ||
| 1 | rev | Primer | CCAGGACCATCCTCTAACAT | |
| Pig 3 | disrupted | PCR8 | ||
| Pig 4 | CCAGGACCATCCTCTAACAT | PCR8 | ||
| 4 | fwd | Primer | GATTAGAACTGGAAGCCCCAAGTGCTCT | |
| Pig 3 | disrupted | PCR8 | ||
| Pig 4 | GATTAGAACTGGAAGCCCCAAGTGCTCT | PCR8 | ||
| rev | Primer | ACCATCCTCTAACATAACTTCTGGATCAGA | ||
| Pig 3 | disrupted | PCR8 | ||
| Pig 4 | ACCATCCTCTAACATAACTTCTGGATCAGA | PCR8 | ||
| 5 | fwd | Primer | CTATTCGCCTCAAAATAAACCAG | |
| Pig 3 | CTATTCGCCTCAGAATAGAAACTCAG | PCR8 | ||
| Pig 4 | CTATTCGCCTCAAAATAAACCAG | PCR8 | ||
| rev | Primer | CATAGAGACCAATGCACATG | ||
| 6 | fwd | Primer | CCAGGACCACCAAATAATGG | |
| Pig 3 | not available | PCR8 | ||
| Pig 4 | not available | PCR8 | ||
| rev | Primer | ACTAAAATGGGGGCAAAACTT | ||
| Pig 3 | ATTAAAACAGGGGCGAAACTT | PCR8 | ||
| Pig 4 | ACTAAAATGGGGGCAAAACTT | PCR8 | ||
| Real-time PCR | fwd | Primer | CCCCAACCCAAGGACCAG | |
| Pig 3 | CTCCAATCCAAGAACCGA | PCR8 | ||
| Pig 4 | CCCCAACCCAAGGACCAG | PCR8 | ||
| probe | Probe | CTCTAACATAACTTCTGGATCAGACCC | ||
| Pig 3 | TTACAATACAACCTCTGGATCAGTCCC | PCR8 | ||
| Pig 4 | CTCTAACATAACTTCTGGATCAGACCC | PCR8 | ||
| rev | Primer | ACTAAAATGGGGGCAAAACTT | ||
| Pig 3 | ATTAAAACAGGGGCGAAACTT | PCR8 | ||
| Pig 4 | ACTAAAATGGGGGCAAAACTT | PCR8 | ||
| 7 | fwd corresponds to fwd primer of PCR5 | |||
| rev corresponds to the rev primer of the real-time PCR | ||||
| 8 | fwd corresponds to fwd primer of PCR6 | |||
| rev corresponds to the rev primer of PCR5 | ||||
| 9 | fwd corresponds to the fwd primer of the real-time PCR | |||
| rev corresponds to the reverse primer of PCR5 | ||||
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Jhelum, H.; Kunec, D.; Papatsiros, V.; Kaufer, B.B.; Denner, J. Reliable Polymerase Chain Reaction Methods for Screening for Porcine Endogenous Retroviruses-C (PERV-C) in Pigs. Viruses 2025, 17, 164. https://doi.org/10.3390/v17020164
Jhelum H, Kunec D, Papatsiros V, Kaufer BB, Denner J. Reliable Polymerase Chain Reaction Methods for Screening for Porcine Endogenous Retroviruses-C (PERV-C) in Pigs. Viruses. 2025; 17(2):164. https://doi.org/10.3390/v17020164
Chicago/Turabian StyleJhelum, Hina, Dusan Kunec, Vasileios Papatsiros, Benedikt B. Kaufer, and Joachim Denner. 2025. "Reliable Polymerase Chain Reaction Methods for Screening for Porcine Endogenous Retroviruses-C (PERV-C) in Pigs" Viruses 17, no. 2: 164. https://doi.org/10.3390/v17020164
APA StyleJhelum, H., Kunec, D., Papatsiros, V., Kaufer, B. B., & Denner, J. (2025). Reliable Polymerase Chain Reaction Methods for Screening for Porcine Endogenous Retroviruses-C (PERV-C) in Pigs. Viruses, 17(2), 164. https://doi.org/10.3390/v17020164

