Association Between Single-Nucleotide Polymorphisms in Toll-like Receptor 3 (tlr3), tlr7, tlr8 and tirap Genes with Severe Symptoms in Children Presenting COVID-19
Abstract
1. Introduction
2. Material and Methods
2.1. Declarations
2.2. Study
2.2.1. Design and Sampling
2.2.2. DNA Extraction, Amplification, and Sequencing
2.2.3. Sequencing Analysis
2.2.4. Criteria for Severity Classification
2.2.5. Statistical Analysis
3. Results
3.1. Characterization of Hospitalized Children with COVID-19: Age-Related Vulnerabilities, Comorbidities, and Diagnostic Methods
3.2. Symptom Overlap and Clinical Outcomes in Pediatric COVID-19: Symptomatology, Severity, and Mortality Analysis
3.3. Comparison of SNP Allelic Frequencies in Children with COVID-19: Population and Sex-Based Variations
3.4. Analysis of SNP Frequency Distribution Based on Severity of Symptoms in Children Presenting COVID-19
3.5. Impact of SNP Mutations on Severity of Symptoms in Children Presenting COVID-19: Risk Analysis
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- World Health Organization. COVID-19 Epidemiological Update—12 April 2024. 12 April 2024. Available online: https://www.who.int/publications/m/item/covid-19-epidemiological-update-edition-166 (accessed on 14 July 2024).
- United Nations Children’s Fund (UNICEF). COVID-19 and Children. 2024. Available online: https://data.unicef.org/topic/child-survival/covid-19/ (accessed on 14 July 2024).
- Brasil. Ministério da Saúde. Painel Coronavírus. Available online: https://covid.saude.gov.br/ (accessed on 7 November 2024).
- Butantan. COVID-19 já Matou Mais de 1.400 Crianças de Zero a 11 Anos no Brasil e Deixou Milhares com Sequelas. Instituto Butantan. 2022. Available online: https://butantan.gov.br/noticias/covid-19-ja-matou-mais-de-1.400-criancas-de-zero-a-11-anos-no-brasil-e-deixou-outras-milhares-com-sequelas (accessed on 16 September 2024).
- Waghmare, A.; Hijano, D.R. SARS-CoV-2 infection and COVID-19 in children. Clin. Chest Med. 2023, 44, 359–371. [Google Scholar] [CrossRef] [PubMed]
- Sun, Y.K.; Wang, C.; Lin, P.Q.; Hu, L.; Ye, J.; Gao, Z.G.; Lin, R.; Li, H.M.; Shu, Q.; Huang, L.S.; et al. Severe pediatric COVID-19: A review from the clinical and immunopathophysiological perspectives. World J. Pediatr. 2024, 20, 307–324. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
- CDC COVID-19 Response Team. Severe outcomes among patients with coronavirus disease 2019 (COVID-19)—United States, February 12–March 16, 2020. MMWR. Morb. Mortal. Wkly. Rep. 2020, 69, 382–386. [Google Scholar] [CrossRef] [PubMed]
- Pessoa, N.L.; Bentes, A.A.; de Carvalho, A.L.; de Souza Silva, T.B.; Alves, P.A.; de Sousa Reis, E.V.; Rodrigues, T.A.; Kroon, E.G.; Campos, M.A. Case report: Hepatitis in a child infected with SARS-CoV-2 presenting toll-like receptor 7 Gln11Leu single nucleotide polymorphism. Virol. J. 2021, 18, 202. [Google Scholar] [CrossRef]
- Pessoa, N.L.; Diniz, L.M.O.; Andrade, A.S.; Kroon, E.G.; Bentes, A.A.; Campos, M.A. Children with sickle cell disease and severe COVID-19 presenting single nucleotide polymorphisms in innate immune response genes—A case report. EJHaem 2021, 3, 199–202. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
- Tezer, H.; Bedir Demirdağ, T. Novel coronavirus disease (COVID-19) in children. Turk. J. Med. Sci. 2020, 50, 592–603. [Google Scholar] [CrossRef]
- Zhang, Q.; Matuozzo, D.; Le Pen, J.; Lee, D.; Moens, L.; Casanova, J.L. Recessive inborn errors of type I IFN immunity in children with COVID-19 pneumonia. J. Exp. Med. 2022, 219, e20220131. [Google Scholar] [CrossRef] [PubMed]
- Ravi, V.; Saxena, S.; Panda, P.S. Basic virology of SARS-CoV 2. Indian J. Med. Microbiol. 2022, 40, 182–186. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
- Campos, R.K.; Camargos, V.; Azar, S.; Haines, C.; Eyzaguirre, E.; Rossi, S. SARS-CoV-2 infects hamster testes. Microorganisms 2021, 9, 1318. [Google Scholar] [CrossRef]
- Janeway, C.A., Jr.; Medzhitov, R. Innate immune recognition. Annu. Rev. Immunol. 2002, 20, 197–216. [Google Scholar] [CrossRef] [PubMed]
- Beutler, B. Toll-like receptors: How they work and what they do. Curr. Opin. Hematol. 2002, 9, 2–10. [Google Scholar] [CrossRef] [PubMed]
- Campos, M.A.; de Pádua Zolini, G.; Kroon, E.G. Impact of Toll-Like Receptors (TLRs) and TLR signaling proteins in trigeminal ganglia impairing Herpes Simplex Virus 1 (HSV-1) progression to encephalitis: Insights from mouse models. Front. Biosci. Landmark Ed. 2024, 29, 102. [Google Scholar] [CrossRef] [PubMed]
- Diamond, M.S.; Kanneganti, T.D. Innate immunity: The first line of defense against SARS-CoV-2. Nat. Immunol. 2022, 23, 165–176. [Google Scholar] [CrossRef]
- Kawai, T.; Ikegawa, M.; Ori, D.; Akira, S. Decoding Toll-like receptors: Recent insights and perspectives in innate immunity. Immunity 2024, 57, 649–673. [Google Scholar] [CrossRef] [PubMed]
- Lucinda, N. Células Dendríticas, Macrófagos, Natural Killer e Linfócitos t CD8+ Desempenham Papel Fundamental no Controle do HSV-1 no Gânglio Trigêmeo Produzindo IL-1 Beta, iNOS e Granzima B. Ph.D. Thesis, Instituto René Rachou, Fundação Oswaldo Cruz, Belo Horizonte, Brazil, 2017; p. 111. [Google Scholar]
- Bender, A.T.; Tzvetkov, E.; Pereira, A.; Wu, Y.; Kasar, S.; Przetak, M.M.; Vlach, J.; Niewold, T.B.; Jensen, M.A.; Okitsu, S.L. TLR7 and TLR8 differentially activate the IRF and NF-κB pathways in specific cell types to promote inflammation. Immunohorizons 2020, 4, 93–107. [Google Scholar] [CrossRef] [PubMed]
- Mantovani, S.; Daga, S.; Fallerini, C.; Baldassarri, M.; Benetti, E.; Picchiotti, N.; Fava, F.; Gallì, A.; Zibellini, S.; Bruttini, M. Rare variants in Toll-like receptor 7 result in functional impairment and downregulation of cytokine-mediated signaling in COVID-19 patients. Genes Immun. 2022, 23, 51–56. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
- Singh, S.; Anshita, D.; Ravichandiran, V. MCP-1: Function, regulation, and involvement in disease. Int. Immunopharmacol. 2021, 101, 107598. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
- Duan, T.; Du, Y.; Xing, C.; Wang, H.Y.; Wang, R.F. Toll-like receptor signaling and its role in cell-mediated immunity. Front. Immunol. 2022, 13, 812774. [Google Scholar] [CrossRef]
- Nilsen, K.E.; Skjesol, A.; Frengen Kojen, J.; Espevik, T.; Stenvik, J.; Yurchenko, M. TIRAP/Mal positively regulates TLR8-mediated signaling via IRF5 in human cells. Biomedicines 2022, 10, 1476. [Google Scholar] [CrossRef]
- Naushad, S.M.; Mandadapu, G.; Ramaiah, M.J.; Almajhdi, F.N.; Hussain, T. The role of TLR7 agonists in modulating COVID-19 severity in subjects with loss-of-function TLR7 variants. Sci. Rep. 2023, 13, 13078. [Google Scholar] [CrossRef] [PubMed]
- Mukherjee, S.; Huda, S.; Sinha Babu, S.P. Toll-like receptor polymorphism in host immune response to infectious diseases: A review. Scand. J. Immunol. 2019, 90, e12771. [Google Scholar] [CrossRef] [PubMed]
- Van der Made, C.I.; Simons, A.; Schuurs-Hoeijmakers, J.; van den Heuvel, G.; Mantere, T.; Kersten, S.; van Deuren, R.C.; Steehouwer, M.; van Reijmersdal, S.V.; Jaeger, M.; et al. Presence of genetic variants among young men with severe COVID-19. JAMA 2020, 324, 663–673. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
- Bagheri-Hosseinabadi, Z.; Rezazadeh Zarandi, E.; Mirabzadeh, M.; Amiri, A.; Abbasifard, M. mRNA expression of toll-like receptors 3, 7, 8, and 9 in the nasopharyngeal epithelial cells of coronavirus disease 2019 patients. BMC Infect. Dis. 2022, 22, 448. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
- Møller-Larsen, S.; Nyegaard, M.; Haagerup, A.; Vestbo, J.; Kruse, T.A.; Børglum, A.D. Association analysis identifies TLR7 and TLR8 as novel risk genes in asthma and related disorders. Thorax 2008, 63, 1064–1069. [Google Scholar] [CrossRef] [PubMed]
- Wang, C.H.; Eng, H.L.; Lin, K.H.; Liu, H.C.; Chang, C.H.; Lin, T.M. Functional polymorphisms of TLR8 are associated with hepatitis C virus infection. Immunology 2014, 141, 540–548. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
- Sanger, F.; Nicklen, S.; Coulson, A. DNA sequencing with chain-terminating inhibitors. Proc. Nati. Acad. Sci. USA 1977, 74, 5463–5467. [Google Scholar] [CrossRef] [PubMed]
- Santos, C.N.O.; Ribeiro, D.R.; Cardoso Alves, J.; Cazzaniga, R.A.; Magalhães, L.S.; de Souza, M.S.F.; Fonseca, A.B.L.; Bispo, A.J.B.; Porto, R.L.S.; Santos, C.A.D.; et al. Association between Zika virus microcephaly in newborns with the rs3775291 variant in Toll-like receptor 3 and rs1799964 variant at tumor necrosis factor-α gene. J. Infect. Dis. 2019, 220, 1797–1801. [Google Scholar] [CrossRef]
- Alagarasu, K.; Bachal, R.V.; Memane, R.S.; Shah, P.S.; Cecilia, D. Polymorphisms in RNA sensing toll-like receptor genes and its association with clinical outcomes of dengue virus infection. Immunobiology 2015, 220, 164–168. [Google Scholar] [CrossRef] [PubMed]
- Chowdhury, P.; Khan, S.A. Significance of CCL2, CCL5 and CCR2 polymorphisms for adverse prognosis of Japanese encephalitis from an endemic population of India. Sci. Rep. 2017, 7, 13716. [Google Scholar] [CrossRef]
- Stucky, B. Seq Trace: A graphical tool for rapidly processing DNA sequencing chromatograms. J. Biomol. Tech. 2012, 23, 90–93. [Google Scholar] [CrossRef]
- Yehya, N.; Khemani, R.G.; Erickson, S.; Smith, L.S.; Rowan, C.M.; Jouvet, P.; Willson, D.F.; Cheifetz, I.M.; Ward, S.; Thomas, N.J.; et al. Respiratory dysfunction criteria in critically ill children: The PODIUM consensus conference. Pediatrics 2022, 149 (Suppl. S1), S48–S52. [Google Scholar] [CrossRef] [PubMed]
- Agresti, A. A Survey of Exact Inference for Contingency Tables. Stat. Sci. 1992, 7, 131–153. [Google Scholar] [CrossRef]
- Fagerland, M.W.; Lydersen, S.; Laake, P. Recommended confidence intervals for two independent binomial proportions. Stat. Methods Med. Res. 2015, 24, 224–254. [Google Scholar] [CrossRef] [PubMed]
- Cimolai, N. COVID-19 among infants: Key clinical features and remaining controversies. Clin. Exp. Pediatr. 2024, 67, 1–16. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
- Chatterjee, S.; Nalla, L.V.; Sharma, M.; Sharma, N.; Singh, A.A.; Malim, F.M.; Ghatage, M.; Mukarram, M.; Pawar, A.; Parihar, N.; et al. Association of COVID-19 with Comorbidities: An Update. ACS Pharmacol. Transl. Sci. 2023, 6, 334–354. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
- Bain, V.; Abramczyk, M.L.; Costa, R.L.S.; Paixão, M.R.; Souza Junior, J.L. Pediatric COVID-19: Clinical and Epidemiological Data of 1303 Cases in a General Hospital in Brazil. Rev. Paul. Pediatr. 2023, 42, e2023031. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
- Mentor, G.; Farrar, D.S.; Di Chiara, C.; Dufour, M.K.; Valois, S.; Taillefer, S.; Drouin, O.; Renaud, C.; Kakkar, F. The Effect of Age and Comorbidities: Children vs. Adults in Their Response to SARS-CoV-2 Infection. Viruses 2024, 16, 801. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
- Centers for Disease Control and Prevention; Havers, F.P. COVID-19–Associated Hospitalizations Among Infants, Children, and Adults—COVID-NET, January–August 2023. Available online: https://www.cdc.gov/other/media.html (accessed on 16 September 2024).
- Alwani, M.; Yassin, A.; Al-Zoubi, R.M.; Aboumarzouk, O.M.; Nettleship, J.; Kelly, D.; Al-Qudimat, A.R.; Shabsigh, R. Sex-based differences in severity and mortality in COVID-19. Rev. Med. Virol. 2021, 31, e2223. [Google Scholar] [CrossRef] [PubMed]
- Iwasaki, A.; Pillai, P.S. Innate immunity to influenza virus infection. Nat. Rev. Immunol. 2014, 14, 315–328. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
- Witsø, E.; Cinek, O.; Tapia, G.; Brorsson, C.A.; Stene, L.C.; Gjessing, H.K.; Rasmussen, T.; Bergholdt, R.; Pociot, F.M.; Rønningen, K.S. Genetic determinants of enterovirus infections: Polymorphisms in type 1 diabetes and innate immune genes in the MIDIA study. Viral Immunol. 2015, 28, 556–563. [Google Scholar] [CrossRef] [PubMed]
- Santos, A.O.R.; Lucarevschi, B.R.; Bajerl, M.H.; Pires, L.O.; Ubriaco, D.C.; Nascimento, L.F.C. SARS-CoV-2 infection in children and adolescents: A Brazilian experience. Rev. Paul. Pediatr. 2022, 40, e2021172. [Google Scholar] [CrossRef] [PubMed]
- Pacheco, G.V.; Nakazawa Ueji, Y.E.; Bello, J.R.; Barbosa Cobos, R.E.; Jiménez Becerra, E.D.; González Herrera, L.J.; Pérez Mendoza, G.J.; Rivero Cárdenas, N.A.; Angulo Ramírez, A.V.; López Villanueva, R.F. Copy number variation and frequency of rs179008 in TLR7 gene associated with systemic lupus erythematosus in two Mexican populations. J. Immunol. Res. 2022, 2022, 2553901. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
- Masselli, E.; Carubbi, C.; Pozzi, G.; Percesepe, A.; Campanelli, R.; Villani, L.; Gobbi, G.; Bonomini, S.; Roti, G.; Rosti, V.; et al. Impact of the rs1024611 polymorphism of CCL2 on the pathophysiology and outcome of primary myelofibrosis. Cancers 2021, 13, 2552. [Google Scholar] [CrossRef]
- Zhou, Y.; Zhang, M. Associations between genetic polymorphisms of TLRs and susceptibility to tuberculosis: A meta-analysis. Innate Immun. 2020, 26, 75–83. [Google Scholar] [CrossRef] [PubMed]
- Barkhash, A.V.; Voevoda, M.I.; Romaschenko, A.G. Association of single nucleotide polymorphism rs3775291 in the coding region of the TLR3 gene with predisposition to tick-borne encephalitis in a Russian population. Antivir. Res. 2013, 99, 136–138. [Google Scholar] [CrossRef]
- Song, Z.; Tong, C.; Sun, Z.; Shen, Y.; Yao, C.; Jiang, J.; Yin, J.; Gao, L.; Song, Y.; Bai, C. Genetic variants in the TIRAP gene are associated with increased risk of sepsis-associated acute lung injury. BMC Med. Genet. 2010, 11, 168. [Google Scholar] [CrossRef] [PubMed]
- Posadas-Sánchez, R.; Velázquez-Sánchez, F.; Reyes-Barrera, J.; Cardoso-Saldaña, G.; Velázquez-Argueta, F.; Antonio-Villa, N.E.; Fragoso, J.M.; Vargas-Alarcón, G. MCP-1 rs1024611 Polymorphism, MCP-1 Concentrations, and Premature Coronary Artery Disease: Results of the Genetics of Atherosclerotic Disease (GEA) Mexican Study. Biomedicines 2024, 12, 1292. [Google Scholar] [CrossRef]
- Shadrina, A.S.; Smetanina, M.A.; Sevost’ianova, K.S.; Seliverstov, E.I.; Ilyukhin, E.A.; Voronina, E.N.; Zolotukhin, I.A.; Filipenko, M.L. Functional polymorphism rs1024611 in the MCP1 gene is associated with the risk of varicose veins of lower extremities. J. Vasc. Surg. Venous Lymphat. Disord. 2017, 5, 561–566. [Google Scholar] [CrossRef] [PubMed]
Gene Ref. | Primers | Tm | SNP | Location | Nucleotide Change | |
---|---|---|---|---|---|---|
tlr8 (1) [1] | F | GGCAACAGCTAAGAAATCAC | 54 °C | rs3764879 | chrX: 12906578 | 129 C>G |
R | CGCTTTACCTGCATTTACAGT | |||||
tlr8 (2) [2] | F | GGTAGAATTAGTTTTCAGTGGCAA | 54 °C | rs2407992 | chrX: 12920993 | 2040 G>C |
R | GGTGGTGGTCTTAGTTTCAA | |||||
tlr7 [3] | F | AGAGAGGCAGCAAATGGGAA | 55 °C | rs179008 | chrX: 12885540 | 11 A>T |
R | TAGGAAACCATCTAGCCCCA | |||||
tlr3 [4] | F | TCTTGGGACTAAAGTGGACA | 55 °C | rs3775291 | chr4: 186082920 | 412 C>T |
R | CCCAACCAAGAGAAAGCATC | |||||
tirap [5] | F | GGTGCAAGTACCAGATGCT | 58 °C | rs8177374 | chr11: 126292948 | 180 C>T |
R | CAACGCATGACAGCTTCTTT | |||||
mcp1 [6] | F | CTTTCCCTTGTGTGTCCCC | 58 °C | rs1024611 | chr17: 34252769 | −2518 A>B |
R | ACAGTAAACACAGGGAAGGT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Andrade, A.S.; Bentes, A.A.; Diniz, L.M.; Carvalho, S.H.; Kroon, E.G.; Campos, M.A. Association Between Single-Nucleotide Polymorphisms in Toll-like Receptor 3 (tlr3), tlr7, tlr8 and tirap Genes with Severe Symptoms in Children Presenting COVID-19. Viruses 2025, 17, 35. https://doi.org/10.3390/v17010035
Andrade AS, Bentes AA, Diniz LM, Carvalho SH, Kroon EG, Campos MA. Association Between Single-Nucleotide Polymorphisms in Toll-like Receptor 3 (tlr3), tlr7, tlr8 and tirap Genes with Severe Symptoms in Children Presenting COVID-19. Viruses. 2025; 17(1):35. https://doi.org/10.3390/v17010035
Chicago/Turabian StyleAndrade, Adriana Souza, Aline Almeida Bentes, Lilian Martins Diniz, Silvia Hees Carvalho, Erna Geessien Kroon, and Marco Antonio Campos. 2025. "Association Between Single-Nucleotide Polymorphisms in Toll-like Receptor 3 (tlr3), tlr7, tlr8 and tirap Genes with Severe Symptoms in Children Presenting COVID-19" Viruses 17, no. 1: 35. https://doi.org/10.3390/v17010035
APA StyleAndrade, A. S., Bentes, A. A., Diniz, L. M., Carvalho, S. H., Kroon, E. G., & Campos, M. A. (2025). Association Between Single-Nucleotide Polymorphisms in Toll-like Receptor 3 (tlr3), tlr7, tlr8 and tirap Genes with Severe Symptoms in Children Presenting COVID-19. Viruses, 17(1), 35. https://doi.org/10.3390/v17010035