In-Depth Comparison of Adeno-Associated Virus Containing Fractions after CsCl Ultracentrifugation Gradient Separation
Abstract
1. Introduction
2. Materials and Methods
2.1. AAV Production and Purification
2.2. Transduction Efficiency
2.3. Transmission Electron Microscopy (TEM)
2.4. Analytical Ultracentrifugation (AUC)
2.5. Batch Dynamic Light-Scattering (DLS) Measurements
2.6. SEC-MALS-DLS-RI Measurements
2.7. Viral Genome Titer Determination
2.8. Viral Capsid Titer Determination
2.9. Determination of Host Cell Impurities
2.10. Multi-Angle Dynamic Light Scattering (MADLS)
2.11. High-Throughput Sequencing (HTS)
2.12. Graphical Representation
3. Results
3.1. CsCl Extracted Fractions Showed Unexpectedly Similar Transduction Efficiencies
3.2. Different Viral Particle Populations Were Identified by TEM and AUC in All Fractions
3.3. Complexity of Viral Particle Content Was Confirmed by Several Different and Orthogonal Approaches
3.4. Duplex ddPCR Reveals High Levels of Vector Genome Fragmentation
3.5. Host Cell Residuals and Viral Particle Aggregates Were Observed in All Fractions
3.6. High-Throughput Sequencing (HTS) Holds Tremendous Potential for the Characterization of Unwanted DNA Impurities in rAAVs
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Au, H.K.E.; Isalan, M.; Mielcarek, M. Gene Therapy Advances: A Meta-Analysis of AAV Usage in Clinical Settings. Front. Med. 2022, 8, 809118. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gene, Cell, + RNA Therapy Landscape Report. Q4 2023 Quarterly Data Report. Available online: https://www.asgct.org/global/documents/asgct-citeline-q4-2023-report.aspx (accessed on 25 April 2024).
- El Andari, J.; Grimm, D. Production, Processing, and Characterization of Synthetic AAV Gene Therapy Vectors. Biotechnol. J. 2021, 16, 2000025. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fu, X.; Chen, W.-C.; Argento, C.; Clarner, P.; Bhatt, V.; Dickerson, R.; Bou-Assaf, G.; Bakhshayeshi, M.; Lu, X.; Bergelson, S.; et al. Analytical Strategies for Quantification of Adeno-Associated Virus Empty Capsids to Support Process Development. Hum. Gene Ther. Methods 2019, 30, 144–152. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dobnik, D. Moving Towards Genome Integrity Evaluation of Gene Therapy Viral Vectors. Available online: https://www.americanpharmaceuticalreview.com/Featured-Articles/596311-Moving-Towards-Genome-Integrity-Evaluation-of-Gene-Therapy-Viral-Vectors/ (accessed on 20 July 2023).
- Werle, A.K.; Powers, T.W.; Zobel, J.F.; Wappelhorst, C.N.; Jarrold, M.F.; Lyktey, N.A.; Sloan, C.D.K.; Wolf, A.J.; Adams-Hall, S.; Baldus, P.; et al. Comparison of Analytical Techniques to Quantitate the Capsid Content of Adeno-Associated Viral Vectors. Mol. Ther.-Methods Clin. Dev. 2021, 23, 254–262. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gimpel, A.L.; Katsikis, G.; Sha, S.; Maloney, A.J.; Hong, M.S.; Nguyen, T.N.T.; Wolfrum, J.; Springs, S.L.; Sinskey, A.J.; Manalis, S.R.; et al. Analytical Methods for Process and Product Characterization of Recombinant Adeno-Associated Virus-Based Gene Therapies. Mol. Ther.-Methods Clin. Dev. 2021, 20, 740–754. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hutanu, A.; Boelsterli, D.; Schmidli, C.; Montealegre, C.; Dang Thai, M.H.N.; Bobaly, B.; Koch, M.; Schwarz, M.A. Stronger Together: Analytical Techniques for Recombinant Adeno Associated Virus. Electrophoresis 2022, 43, 1107–1117. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kumar, P.; Wang, M.; Kumru, O.S.; Hickey, J.M.; Sanmiguel, J.; Zabaleta, N.; Vandenberghe, L.H.; Joshi, S.B.; Volkin, D.B. Correlating Physicochemical and Biological Properties to Define Critical Quality Attributes of a rAAV Vaccine Candidate. Mol. Ther. Methods Clin. Dev. 2023, 30, 103–121. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- McColl-Carboni, A.; Dollive, S.; Laughlin, S.; Lushi, R.; MacArthur, M.; Zhou, S.; Gagnon, J.; Smith, C.A.; Burnham, B.; Horton, R.; et al. Analytical Characterization of Full, Intermediate, and Empty AAV Capsids. Gene Ther. 2024, 31, 285–294. [Google Scholar] [CrossRef] [Scilit]
- Colomb-Delsuc, M.; Raim, R.; Fiedler, C.; Reuberger, S.; Lengler, J.; Nordström, R.; Ryner, M.; Folea, I.M.; Kraus, B.; Hernandez Bort, J.A.; et al. Assessment of the Percentage of Full Recombinant Adeno-Associated Virus Particles in a Gene Therapy Drug Using CryoTEM. PLoS ONE 2022, 17, e0269139. [Google Scholar] [CrossRef] [Scilit]
- Sommer, J.M.; Smith, P.H.; Parthasarathy, S.; Isaacs, J.; Vijay, S.; Kieran, J.; Powell, S.K.; McClelland, A.; Wright, J.F. Quantification of Adeno-Associated Virus Particles and Empty Capsids by Optical Density Measurement. Mol. Ther. 2003, 7, 122–128. [Google Scholar] [CrossRef] [Scilit]
- Cole, L.; Fernandes, D.; Hussain, M.T.; Kaszuba, M.; Stenson, J.; Markova, N. Characterization of Recombinant Adeno-Associated Viruses (rAAVs) for Gene Therapy Using Orthogonal Techniques. Pharmaceutics 2021, 13, 586. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dobnik, D.; Kogovšek, P.; Jakomin, T.; Košir, N.; Tušek Žnidarič, M.; Leskovec, M.; Kaminsky, S.M.; Mostrom, J.; Lee, H.; Ravnikar, M. Accurate Quantification and Characterization of Adeno-Associated Viral Vectors. Front. Microbiol. 2019, 10, 1570. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, Y.; Menon, N.; Shen, S.; Feschenko, M.; Bergelson, S. A qPCR Method for AAV Genome Titer with ddPCR-Level of Accuracy and Precision. Mol. Ther.-Methods Clin. Dev. 2020, 19, 341–346. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wada, M.; Uchida, N.; Posadas-Herrera, G.; Hayashita-Kinoh, H.; Tsunekawa, Y.; Hirai, Y.; Okada, T. Large-Scale Purification of Functional AAV Particles Packaging the Full Genome Using Short-Term Ultracentrifugation with a Zonal Rotor. Gene Ther. 2023, 30, 641–648. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- McIntosh, N.L.; Berguig, G.Y.; Karim, O.A.; Cortesio, C.L.; De Angelis, R.; Khan, A.A.; Gold, D.; Maga, J.A.; Bhat, V.S. Comprehensive Characterization and Quantification of Adeno Associated Vectors by Size Exclusion Chromatography and Multi Angle Light Scattering. Sci. Rep. 2021, 11, 3012. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Xie, Y.; Butler, M. Multi-Attribute Analysis of Adeno-Associated Virus by Size Exclusion Chromatography with Fluorescence and Triple-Wavelength UV Detection. Anal. Biochem. 2023, 680, 115311. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Barnes, L.F.; Draper, B.E.; Chen, Y.-T.; Powers, T.W.; Jarrold, M.F. Quantitative Analysis of Genome Packaging in Recombinant AAV Vectors by Charge Detection Mass Spectrometry. Mol. Ther.-Methods Clin. Dev. 2021, 23, 87–97. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pilely, K.; Johansen, M.R.; Lund, R.R.; Kofoed, T.; Jørgensen, T.K.; Skriver, L.; Mørtz, E. Monitoring Process-Related Impurities in Biologics–Host Cell Protein Analysis. Anal. Bioanal. Chem. 2022, 414, 747–758. [Google Scholar] [CrossRef] [Scilit]
- Lecomte, E.; Leger, A.; Penaud-Budloo, M.; Ayuso, E. Single-Stranded DNA Virus Sequencing (SSV-Seq) for Characterization of Residual DNA and AAV Vector Genomes. In Adeno-Associated Virus Vectors: Design and Delivery; Castle, M.J., Ed.; Methods in Molecular Biology; Springer: New York, NY, USA, 2019; pp. 85–106. ISBN 978-1-4939-9139-6. [Google Scholar]
- Lecomte, E.; Saleun, S.; Bolteau, M.; Guy-Duché, A.; Adjali, O.; Blouin, V.; Penaud-Budloo, M.; Ayuso, E. The SSV-Seq 2.0 PCR-Free Method Improves the Sequencing of Adeno-Associated Viral Vector Genomes Containing GC-Rich Regions and Homopolymers. Biotechnol. J. 2021, 16, 2000016. [Google Scholar] [CrossRef] [Scilit]
- Troxell, B.; Jaslow, S.L.; Tsai, I.-W.; Sullivan, C.; Draper, B.E.; Jarrold, M.F.; Lindsey, K.; Blue, L. Partial Genome Content within rAAVs Impacts Performance in a Cell Assay-Dependent Manner. Mol. Ther.-Methods Clin. Dev. 2023, 30, 288–302. [Google Scholar] [CrossRef] [Scilit]
- Arsic, N.; Zacchigna, S.; Zentilin, L.; Ramirez-Correa, G.; Pattarini, L.; Salvi, A.; Sinagra, G.; Giacca, M. Vascular Endothelial Growth Factor Stimulates Skeletal Muscle Regeneration in Vivo. Mol. Ther. 2004, 10, 844–854. [Google Scholar] [CrossRef] [Scilit]
- Inagaki, K.; Fuess, S.; Storm, T.A.; Gibson, G.A.; Mctiernan, C.F.; Kay, M.A.; Nakai, H. Robust Systemic Transduction with AAV9 Vectors in Mice: Efficient Global Cardiac Gene Transfer Superior to That of AAV8. Mol. Ther. 2006, 14, 45–53. [Google Scholar] [CrossRef] [Scilit]
- Ayuso, E.; Mingozzi, F.; Montane, J.; Leon, X.; Anguela, X.M.; Haurigot, V.; Edmonson, S.A.; Africa, L.; Zhou, S.; High, K.A.; et al. High AAV Vector Purity Results in Serotype- and Tissue-Independent Enhancement of Transduction Efficiency. Gene Ther. 2010, 17, 503–510. [Google Scholar] [CrossRef] [Scilit]
- Schuck, P. Size-Distribution Analysis of Macromolecules by Sedimentation Velocity Ultracentrifugation and Lamm Equation Modeling. Biophys. J. 2000, 78, 1606–1619. [Google Scholar] [CrossRef] [Scilit]
- Mohr, J.; Chuan, Y.P.; Wu, Y.; Lua, L.H.L.; Middelberg, A.P.J. Virus-like Particle Formulation Optimization by Miniaturized High-Throughput Screening. Methods 2013, 60, 248–256. [Google Scholar] [CrossRef] [Scilit]
- Dashti, N.H.; Sainsbury, F. Virus-Derived Nanoparticles. In Protein Nanotechnology: Protocols, Instrumentation, and Applications; Gerrard, J.A., Domigan, L.J., Eds.; Methods in Molecular Biology; Springer US: New York, NY, USA, 2020; pp. 149–162. ISBN 978-1-4939-9869-2. [Google Scholar]
- Selvaraj, N.; Wang, C.-K.; Bowser, B.; Broadt, T.; Shaban, S.; Burns, J.; Saptharishi, N.; Pechan, P.; Golebiowski, D.; Alimardanov, A.; et al. Detailed Protocol for the Novel and Scalable Viral Vector Upstream Process for AAV Gene Therapy Manufacturing. Hum. Gene Ther. 2021, 32, 850–861. [Google Scholar] [CrossRef] [Scilit]
- Wagner, C.; Innthaler, B.; Lemmerer, M.; Pletzenauer, R.; Birner-Gruenberger, R. Biophysical Characterization of Adeno-Associated Virus Vectors Using Ion-Exchange Chromatography Coupled to Light Scattering Detectors. Int. J. Mol. Sci. 2022, 23, 12715. [Google Scholar] [CrossRef] [Scilit]
- Chen, M. AN1617: Quantifying Quality Attributes of AAV Gene Therapy Vectors by SEC-UV-MALS-dRI. Available online: https://www.wyatt.com/library/application-notes/an1617-aav-critical-quality-attribute-analysis-by-sec-mals.html (accessed on 24 July 2023).
- Zentilin, L.; Marcello, A.; Giacca, M. Involvement of Cellular Double-Stranded DNA Break Binding Proteins in Processing of the Recombinant Adeno-Associated Virus Genome. J. Virol. 2001, 75, 12279–12287. [Google Scholar] [CrossRef] [Scilit]
- De, B.P.; Chen, A.; Salami, C.O.; Van de Graaf, B.; Rosenberg, J.B.; Pagovich, O.E.; Sondhi, D.; Crystal, R.G.; Kaminsky, S.M. In Vivo Potency Assay for Adeno-Associated Virus–Based Gene Therapy Vectors Using AAVrh.10 as an Example. Hum. Gene Ther. Methods 2018, 29, 146–155. [Google Scholar] [CrossRef] [Scilit]
- Furuta-Hanawa, B.; Yamaguchi, T.; Uchida, E. Two-Dimensional Droplet Digital PCR as a Tool for Titration and Integrity Evaluation of Recombinant Adeno-Associated Viral Vectors. Hum. Gene Ther. Methods 2019, 30, 127–136. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Regan, J.F.; Kamitaki, N.; Legler, T.; Cooper, S.; Klitgord, N.; Karlin-Neumann, G.; Wong, C.; Hodges, S.; Koehler, R.; Tzonev, S.; et al. A Rapid Molecular Approach for Chromosomal Phasing. PLoS ONE 2015, 10, e0118270. [Google Scholar] [CrossRef] [Scilit]
- Grieger, J.C.; Soltys, S.M.; Samulski, R.J. Production of Recombinant Adeno-Associated Virus Vectors Using Suspension HEK293 Cells and Continuous Harvest of Vector from the Culture Media for GMP FIX and FLT1 Clinical Vector. Mol. Ther. 2016, 24, 287–297. [Google Scholar] [CrossRef] [Scilit]
- Blessing, D.; Vachey, G.; Pythoud, C.; Rey, M.; Padrun, V.; Wurm, F.M.; Schneider, B.L.; Déglon, N. Scalable Production of AAV Vectors in Orbitally Shaken HEK293 Cells. Mol. Ther.-Methods Clin. Dev. 2019, 13, 14–26. [Google Scholar] [CrossRef] [Scilit]
- Strobel, B.; Miller, F.D.; Rist, W.; Lamla, T. Comparative Analysis of Cesium Chloride- and Iodixanol-Based Purification of Recombinant Adeno-Associated Viral Vectors for Preclinical Applications. Hum. Gene Ther. Methods 2015, 26, 147–157. [Google Scholar] [CrossRef] [Scilit]
- François, A.; Bouzelha, M.; Lecomte, E.; Broucque, F.; Penaud-Budloo, M.; Adjali, O.; Moullier, P.; Blouin, V.; Ayuso, E. Accurate Titration of Infectious AAV Particles Requires Measurement of Biologically Active Vector Genomes and Suitable Controls. Mol. Ther. Methods Clin. Dev. 2018, 10, 223–236. [Google Scholar] [CrossRef] [Scilit]
- Hamilton, B.A.; Li, X.; Pezzulo, A.A.; Abou Alaiwa, M.H.; Zabner, J. Polarized AAVR Expression Determines Infectivity by AAV Gene Therapy Vectors. Gene Ther. 2019, 26, 240–249. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Nussinovitch, U.; Gepstein, L. Optogenetics for in Vivo Cardiac Pacing and Resynchronization Therapies. Nat. Biotechnol. 2015, 33, 750–754. [Google Scholar] [CrossRef] [Scilit]
- Rajasekaran, S.; Thatte, J.; Periasamy, J.; Javali, A.; Jayaram, M.; Sen, D.; Krishnagopal, A.; Jayandharan, G.R.; Sambasivan, R. Infectivity of Adeno-Associated Virus Serotypes in Mouse Testis. BMC Biotechnol. 2018, 18, 70. [Google Scholar] [CrossRef] [Scilit]
- Ambrosi, C.M.; Sadananda, G.; Han, J.L.; Entcheva, E. Adeno-Associated Virus Mediated Gene Delivery: Implications for Scalable in Vitro and in Vivo Cardiac Optogenetic Models. Front. Physiol. 2019, 10, 168. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Potter, M.; Lins, B.; Mietzsch, M.; Heilbronn, R.; Van Vliet, K.; Chipman, P.; Agbandje-McKenna, M.; Cleaver, B.D.; Clément, N.; Byrne, B.J.; et al. A Simplified Purification Protocol for Recombinant Adeno-Associated Virus Vectors. Mol. Ther.-Methods Clin. Dev. 2014, 1, 14034. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Richter, K.; Wurm, C.; Strasser, K.; Bauer, J.; Bakou, M.; VerHeul, R.; Sternisha, S.; Hawe, A.; Salomon, M.; Menzen, T.; et al. Purity and DNA Content of AAV Capsids Assessed by Analytical Ultracentrifugation and Orthogonal Biophysical Techniques. Eur. J. Pharm. Biopharm. 2023, 189, 68–83. [Google Scholar] [CrossRef] [Scilit]
- Tomono, T.; Hirai, Y.; Okada, H.; Miyagawa, Y.; Adachi, K.; Sakamoto, S.; Kawano, Y.; Chono, H.; Mineno, J.; Ishii, A.; et al. Highly Efficient Ultracentrifugation-Free Chromatographic Purification of Recombinant AAV Serotype 9. Mol. Ther.-Methods Clin. Dev. 2018, 11, 180–190. [Google Scholar] [CrossRef] [Scilit]
- Maruno, T.; Usami, K.; Ishii, K.; Torisu, T.; Uchiyama, S. Comprehensive Size Distribution and Composition Analysis of Adeno-Associated Virus Vector by Multiwavelength Sedimentation Velocity Analytical Ultracentrifugation. J. Pharm. Sci. 2021, 110, 3375–3384. [Google Scholar] [CrossRef] [Scilit]
- Radukic, M.T.; Brandt, D.; Haak, M.; Müller, K.M.; Kalinowski, J. Nanopore Sequencing of Native Adeno-Associated Virus (AAV) Single-Stranded DNA Using a Transposase-Based Rapid Protocol. NAR Genomics Bioinforma. 2020, 2, lqaa074. [Google Scholar] [CrossRef] [Scilit]
- Fagone, P.; Wright, J.F.; Nathwani, A.C.; Nienhuis, A.W.; Davidoff, A.M.; Gray, J.T. Systemic Errors in Quantitative Polymerase Chain Reaction Titration of Self-Complementary Adeno-Associated Viral Vectors and Improved Alternative Methods. Hum. Gene Ther. Methods 2012, 23, 1–7. [Google Scholar] [CrossRef] [Scilit]
- Wright, J.F.; Le, T.; Prado, J.; Bahr-Davidson, J.; Smith, P.H.; Zhen, Z.; Sommer, J.M.; Pierce, G.F.; Qu, G. Identification of Factors That Contribute to Recombinant AAV2 Particle Aggregation and Methods to Prevent Its Occurrence during Vector Purification and Formulation. Mol. Ther. 2005, 12, 171–178. [Google Scholar] [CrossRef] [Scilit]
- Tai, P.W.L.; Xie, J.; Fong, K.; Seetin, M.; Heiner, C.; Su, Q.; Weiand, M.; Wilmot, D.; Zapp, M.L.; Gao, G. Adeno-Associated Virus Genome Population Sequencing Achieves Full Vector Genome Resolution and Reveals Human-Vector Chimeras. Mol. Ther.-Methods Clin. Dev. 2018, 9, 130–141. [Google Scholar] [CrossRef] [Scilit]
- Tran, N.T.; Lecomte, E.; Saleun, S.; Namkung, S.; Robin, C.; Weber, K.; Devine, E.; Blouin, V.; Adjali, O.; Ayuso, E.; et al. Human and Insect Cell-Produced Recombinant Adeno-Associated Viruses Show Differences in Genome Heterogeneity. Hum. Gene Ther. 2022, 33, 371–388. [Google Scholar] [CrossRef] [Scilit]













| Target | Label | DNA Sequence of Oligonucleotide (5′ to 3′) | Reference |
|---|---|---|---|
| CMV a | FP-CMV | GTCAATGGGTGGAGTATTTACGG | [34] |
| RP-CMV | GCATTATGCCCAGTACATGACCT | ||
| P-CMV | FAM-CAAGTGTAT/ZEN/CATATGCCAAGTACGCCCCC-BkFQ | ||
| GFP b | FP_GFP_nib | CAGGAGCGCACCATCTTCTT | This study |
| RP_GFP_nib | CGATGCCCTTCAGCTCGAT | ||
| P_GFP_nib | FAM-ACGGCAACT/ZEN/ACAAGACCCGCGC-BkFQ | ||
| SV40 a | FP_SV40 | AGCAATAGCATCACAAATTTCACAA | [34] |
| RP_SV40 | CCAGACATGATAAGATACATTGATGAGTT | ||
| P_SV40 | FAM-AGCATTTTT/ZEN/TTCACTGCATTCTAGTTGTGGTTTGTC-BkFQ |
| Viral Vector | Fraction | % of GFP Positive Cells | Viral Titer (Copies/mL) |
|---|---|---|---|
| ssAAV | Heavy | 14.6 | 4.6 × 1011 |
| Full | 22.0 | 4.3 × 1012 | |
| Intermediate | 23.0 | 1.5 × 1012 | |
| Empty | 21.8 | 3.7 × 1011 | |
| scAAV | Heavy | 16.1 | 4.4 × 1012 |
| Full | 21.5 | 1.7 × 1013 | |
| Intermediate | 13.9 | 8.5 × 1012 | |
| Empty | 17.3 | 1.2 × 1012 |
| Viral Vector | Fraction | Radius (nm) | Hydrodynamic Diameter (nm) | Particle Concentration (Particles/mL) |
|---|---|---|---|---|
| ssAAV | Heavy | 9.1 | 18.3 | 3.05 × 10 12 |
| Full | 15.9 | 31.7 | 1.19 × 10 12 | |
| Intermediate | 14.5 | 29.0 | 1.41 × 10 12 | |
| Empty | 11.7 | 23.4 | 3.98 × 10 12 | |
| scAAV | Heavy | 11.7 | 23.4 | 2.67 × 10 12 |
| Full | 13.7 | 27.5 | 4.73 × 10 12 | |
| Intermediate | 13.8 | 27.6 | 6.57 × 10 12 | |
| Empty | 13.3 | 26.6 | 2.11 × 10 13 |
| Viral Vector | Fraction | Molar Mass Total (kDa) | Molar Mass Protein (kDa) | Molar Mass Nucleic Acid (kDa) | Full to Total Ratio (Vg/Cp) |
|---|---|---|---|---|---|
| ssAAV | Heavy | 4418 | 3720 | 698.1 | 0.953 |
| Full | 4547 | 3738 | 782.2 | 1.114 | |
| Intermediate | 4666 | 3951 | 715.1 | 0.961 | |
| Empty | 4208 | 3906 | 302.0 | 0.407 | |
| scAAV | Heavy | 4575 | 3728 | 847.3 | 0.625 |
| Full | 5006 | 3711 | 1296 | 0.955 | |
| Intermediate | 4643 | 3836 | 807.4 | 0.575 | |
| Empty | 3803 | 3718 | 85.4 | 0.062 |
| Viral Vector | Fraction | Technical Replicate | qPCR vs CMV ddPCR | qPCR vs GFP ddPCR | GFP vs CMV ddPCR |
|---|---|---|---|---|---|
| ssAAV | Heavy | 1 | 12.2 | 11.0 | 0.9 |
| 2 | 11.4 | 10.0 | 0.9 | ||
| Full | 1 | 3.1 | 2.4 | 0.8 | |
| 2 | 3.0 | 2.2 | 0.7 | ||
| Intermediate | 1 | 2.5 | 1.9 | 0.7 | |
| 2 | 2.5 | 1.9 | 0.8 | ||
| Empty | 1 | 2.5 | 1.8 | 0.8 | |
| 2 | 2.5 | 2.0 | 0.8 | ||
| scAAV | Heavy | 1 | 18.9 | 36.2 | 1.9 |
| 2 | 15.2 | 25.3 | 1.7 | ||
| Full | 1 | 7.7 | 10.7 | 1.4 | |
| 2 | 8.3 | 11.6 | 1.4 | ||
| Intermediate | 1 | 4.0 | 5.3 | 1.3 | |
| 2 | 4.1 | 6.2 | 1.5 | ||
| Empty | 1 | 1.1 | 5.3 | 4.6 | |
| 2 | 1.1 | 4.8 | 4.4 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Janc, M.; Zevnik, K.; Dolinar, A.; Jakomin, T.; Štalekar, M.; Bačnik, K.; Kutnjak, D.; Žnidarič, M.T.; Zentilin, L.; Fedorov, D.; et al. In-Depth Comparison of Adeno-Associated Virus Containing Fractions after CsCl Ultracentrifugation Gradient Separation. Viruses 2024, 16, 1235. https://doi.org/10.3390/v16081235
Janc M, Zevnik K, Dolinar A, Jakomin T, Štalekar M, Bačnik K, Kutnjak D, Žnidarič MT, Zentilin L, Fedorov D, et al. In-Depth Comparison of Adeno-Associated Virus Containing Fractions after CsCl Ultracentrifugation Gradient Separation. Viruses. 2024; 16(8):1235. https://doi.org/10.3390/v16081235
Chicago/Turabian StyleJanc, Mojca, Kaja Zevnik, Ana Dolinar, Tjaša Jakomin, Maja Štalekar, Katarina Bačnik, Denis Kutnjak, Magda Tušek Žnidarič, Lorena Zentilin, Dmitrii Fedorov, and et al. 2024. "In-Depth Comparison of Adeno-Associated Virus Containing Fractions after CsCl Ultracentrifugation Gradient Separation" Viruses 16, no. 8: 1235. https://doi.org/10.3390/v16081235
APA StyleJanc, M., Zevnik, K., Dolinar, A., Jakomin, T., Štalekar, M., Bačnik, K., Kutnjak, D., Žnidarič, M. T., Zentilin, L., Fedorov, D., & Dobnik, D. (2024). In-Depth Comparison of Adeno-Associated Virus Containing Fractions after CsCl Ultracentrifugation Gradient Separation. Viruses, 16(8), 1235. https://doi.org/10.3390/v16081235

