Cordycepin Inhibits Enterovirus A71 Replication and Protects Host Cell from Virus-Induced Cytotoxicity through Adenosine Action Pathway
Abstract
1. Introduction
2. Materials and Methods
2.1. Cells and Viruses
2.2. Chemicals
2.3. Virus Infection
2.4. Plaque Assay
2.5. RNA Extraction and Real-Time Reverse Transcription-Polymerase Chain Reaction (RT-PCR)
2.6. Cell Viability Test
2.7. CPE Protection Assay
2.8. Time of Addition Assay
2.9. Immunofluorescence Assay
2.10. Adenosine Competition Assay
2.11. Statistical Analysis
3. Results
3.1. Cordycepin Reduces the Viral Load of EV-A71 in Vero Cells
3.2. EV-A71 RNA Level Is Decreased in Virus-Infected Vero Cells in the Presence of Cordycepin
3.3. EV-A71-Mediated Cytotoxicity in Vero Cells Is Decreased in the Presence of Cordycepin
3.4. TCID50 Values of EV-A71 in Vero and Caco-2 Cells Are Increased in the Presence of Cordycepin
3.5. Cordycepin Inhibits EV-A71 Replication after Cellular Entry
3.6. Exogenous Adenosine Reduces the Anti-EV-A71 Effect of Cordycepin
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Nayak, G.; Bhuyan, S.K.; Bhuyan, R.; Sahu, A.; Kar, D.; Kuanar, A. Global emergence of enterovirus 71: A systematic review. Beni. Suef Univ. J. Basic Appl. Sci. 2022, 11, 78. [Google Scholar] [CrossRef] [Scilit]
- Hu, K.; Onintsoa Diarimalala, R.; Yao, C.; Li, H.; Wei, Y. EV-A71 mechanism of entry: Receptors/co-receptors, related pathways and inhibitors. Viruses 2023, 15, 785. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liu, B. Universal PCR primers are critical for direct sequencing-based enterovirus genotyping. J. Clin. Microbiol. 2017, 55, 339–340. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liu, B.M.; Mulkey, S.B.; Campos, J.M.; DeBiasi, R.L. Laboratory diagnosis of CNS infections in children due to emerging and re-emerging neurotropic viruses. Pediatr. Res. 2024, 95, 543–550. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dunn, J.J. Enteroviruses and parechoviruses. Microbiol. Spectr. 2016, 4, 3. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kinobe, R.; Wiyatno, A.; Artika, I.M.; Safari, D. Insight into the enterovirus A71: A review. Rev. Med. Virol. 2022, 32, e2361. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Xing, J.; Wang, K.; Wang, G.; Li, N.; Zhang, Y. Recent advances in enterovirus A71 pathogenesis: A focus on fatal human enterovirus A71 infection. Arch. Virol. 2022, 167, 2483–2501. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kobayashi, K.; Koike, S. Cellular receptors for enterovirus A71. J. Biomed. Sci. 2020, 27, 23. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lee, T.C.; Guo, H.R.; Su, H.J.; Yang, Y.C.; Chang, H.L.; Chen, K.T. Diseases caused by enterovirus 71 infection. Pediatr. Infect. Dis. J. 2009, 28, 904–910. [Google Scholar] [CrossRef] [Scilit]
- Ooi, M.H.; Wong, S.C.; Lewthwaite, P.; Cardosa, M.J.; Solomon, T. Clinical features, diagnosis, and management of enterovirus 71. Lancet Neurol. 2010, 9, 1097–1105. [Google Scholar] [CrossRef] [Scilit]
- Weng, K.F.; Chen, L.L.; Huang, P.N.; Shih, S.R. Neural pathogenesis of enterovirus 71 infection. Microbes Infect. 2010, 12, 505–510. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Podduturi, S.; Vemula, D.; Singothu, S.; Bhandari, V. In-silico investigation of E8 surface protein of the monkeypox virus to identify potential therapeutic agents. J. Biomol. Struct. Dyn. 2023, 1–14. [Google Scholar] [CrossRef] [Scilit]
- Samantaray, M.; Pattabiraman, R.; Murthy, T.P.K.; Ramaswamy, A.; Murahari, M.; Krishna, S.; Kumar, S.B. Structure-based virtual screening of natural compounds against wild and mutant (R1155K, A1156T and D1168A) NS3-4A protease of hepatitis C virus. J. Biomol. Struct. Dyn. 2023, 1–18. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lee, E.M.; Titus, S.A.; Xu, M.; Tang, H.; Zheng, W. High-throughput Zika viral titer assay for rapid screening of antiviral drugs. Assay. Drug Dev. Technol. 2019, 17, 128–139. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rabie, A.M. Teriflunomide: A possible effective drug for the comprehensive treatment of COVID-19. Curr. Res. Pharmacol. Drug Discov. 2021, 2, 100055. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rabie, A.M. Potent inhibitory activities of the adenosine analogue cordycepin on SARS-CoV-2 replication. ACS Omega 2022, 7, 2960–2969. [Google Scholar] [CrossRef] [Scilit]
- Liu, X.; Xu, Z.; Liang, J.; Xu, T.; Zou, W.; Zhu, L.; Wu, Y.; Dong, C.; Lan, K.; Wu, S.; et al. Rational design and optimization of acylthioureas as novel potent influenza virus non-nucleoside polymerase inhibitors. Eur. J. Med. Chem. 2023, 259, 115678. [Google Scholar] [CrossRef] [Scilit]
- Okafor, S.N.; Meyer, A.; Gadsden, J.; Ahmed, F.; Guzmán, L.; Ahmed, H.; Romero, J.A.F.; Angsantikul, P. Drug reprofiling to identify potential HIV-1 protease inhibitors. Molecules 2023, 28, 6330. [Google Scholar] [CrossRef] [Scilit]
- Chapman, N.S.; Hulswit, R.J.G.; Westover, J.L.B.; Stass, R.; Paesen, G.C.; Binshtein, E.; Reidy, J.X.; Engdahl, T.B.; Handal, L.S.; Flores, A.; et al. Multifunctional human monoclonal antibody combination mediates protection against Rift Valley fever virus at low doses. Nat. Commun. 2023, 14, 5650. [Google Scholar] [CrossRef] [Scilit]
- Bowden-Reid, E.; Ledger, S.; Zhang, Y.; Di Giallonardo, F.; Aggarwal, A.; Stella, A.O.; Akerman, A.; Milogiannakis, V.; Walker, G.; Rawlinson, W.; et al. Novel siRNA therapeutics demonstrate multi-variant efficacy against SARS-CoV-2. Antiviral. Res. 2023, 217, 105677. [Google Scholar] [CrossRef] [Scilit]
- Chen, N.; Jiang, D.; Shao, B.; Bai, T.; Chen, J.; Liu, Y.; Zhang, Z.; Zhou, Y.; Wang, X.; Zhu, Z. Anti-BVDV activity of traditional Chinese medicine monomers targeting NS5B (RNA-dependent RNA polymerase) in vitro and in vivo. Molecules 2023, 28, 3413. [Google Scholar] [CrossRef] [Scilit]
- Liu, M.L.; Lee, Y.P.; Wang, Y.F.; Lei, H.Y.; Liu, C.C.; Wang, S.M.; Su, I.J.; Wang, J.R.; Yeh, T.M.; Chen, S.H.; et al. Type I interferons protect mice against enterovirus 71 infection. J. Gen. Virol. 2005, 86, 3263–3269. [Google Scholar] [CrossRef] [Scilit]
- Yi, L.; He, Y.; Chen, Y.; Kung, H.F.; He, M.L. Potent inhibition of human enterovirus 71 replication by type I interferon subtypes. Antivir. Ther. 2011, 16, 51–58. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Huang, X.; Zhang, X.; Wang, F.; Wei, H.; Ma, H.; Sui, M.; Lu, J.; Wang, H.; Dumler, J.S.; Sheng, G.; et al. Clinical efficacy of therapy with recombinant human interferon α1b in hand, foot, and mouth disease with enterovirus 71 infection. PLoS ONE 2016, 11, e0148907. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, S.M. Milrinone in enterovirus 71 brain stem encephalitis. Front. Pharmacol. 2016, 7, 82. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lee, K.Y. Enterovirus 71 infection and neurological complications. Korean J. Pediatr. 2016, 59, 395–401. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wu, C.Y.; Wang, H.C.; Wang, K.T.; Weng, S.C.; Chang, W.H.; Shih, D.Y.; Lo, C.F.; Wang, D.Y. Neutralization of five subgenotypes of enterovirus 71 by Taiwanese human plasma and Taiwanese plasma derived intravenous immunoglobulin. Biologicals 2013, 41, 154–157. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jiao, W.; Tan, S.R.; Huang, Y.F.; Mu, L.H.; Yang, Y.; Wang, Y.; Wu, X.E. The effectiveness of different doses of intravenous immunoglobulin on severe hand, foot and mouth disease: A meta-analysis. Med. Princ. Pract. 2019, 28, 256–263. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wu, H.; Li, L. Clinical efficacy of early administration of human immunoglobulin on children with severe hand-foot-mouth disease. J. Coll. Physicians Surg. Pak. 2023, 33, 234–236. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, G.; Zhou, F.; Gu, B.; Ding, C.; Feng, D.; Xie, F.; Wang, J.; Zhang, C.; Cao, Q.; Deng, Y.; et al. In vitro and in vivo evaluation of ribavirin and pleconaril antiviral activity against enterovirus 71 infection. Arch. Virol. 2012, 157, 669–679. [Google Scholar] [CrossRef] [Scilit]
- Lee, Y.R.; Chang, C.M.; Yeh, Y.C.; Huang, C.F.; Lin, F.M.; Huang, J.T.; Hsieh, C.C.; Wang, J.R.; Liu, H.S. Honeysuckle aqueous extracts induced let-7a suppress EV71 replication and pathogenesis in vitro and in vivo and is predicted to inhibit SARS-CoV-2. Viruses 2021, 13, 308. [Google Scholar] [CrossRef] [Scilit]
- Wang, X.; Wang, P.; Du, H.; Li, N.; Jing, T.; Zhang, R.; Qi, W.; Hu, Y.; Liu, T.; Zhang, L.; et al. Prediction of the active components and mechanism of forsythia suspensa leaf against respiratory syncytial virus based on network pharmacology. Evid. Based Complement. Alternat. Med. 2022, 2022, 5643345. [Google Scholar] [CrossRef] [Scilit]
- Zhang, Y.; Zhang, G.; Ling, J. Medicinal fungi with antiviral effect. Molecules 2022, 27, 4457. [Google Scholar] [CrossRef] [Scilit]
- Chien, M.; Anderson, T.K.; Jockusch, S.; Tao, C.; Li, X.; Kumar, S.; Russo, J.J.; Kirchdoerfer, R.N.; Ju, J. Nucleotide analogues as inhibitors of SARS-CoV-2 polymerase, a key drug target for COVID-19. J. Proteome Res. 2020, 19, 4690–4697. [Google Scholar] [CrossRef] [Scilit]
- Radhi, M.; Ashraf, S.; Lawrence, S.; Tranholm, A.A.; Wellham, P.A.D.; Hafeez, A.; Khamis, A.S.; Thomas, R.; McWilliams, D.; de Moor, C.H. A systematic review of the biological effects of cordycepin. Molecules 2021, 26, 5886. [Google Scholar] [CrossRef] [Scilit]
- Tuli, H.S.; Sharma, A.K.; Sandhu, S.S.; Kashyap, D. Cordycepin: A bioactive metabolite with therapeutic potential. Life Sci. 2013, 93, 863–869. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Panya, A.; Songprakhon, P.; Panwong, S.; Jantakee, K.; Kaewkod, T.; Tragoolpua, Y.; Sawasdee, N.; Lee, V.S.; Nimmanpipug, P.; Yenchitsomanus, P.T. Cordycepin inhibits virus replication in Dengue virus-infected Vero cells. Molecules 2021, 26, 3118. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ryu, E.; Son, M.; Lee, M.; Lee, K.; Cho, J.Y.; Cho, S.; Lee, S.K.; Lee, Y.M.; Cho, H.; Sung, G.H.; et al. Cordycepin is a novel chemical suppressor of Epstein-Barr virus replication. Oncoscience 2014, 1, 866–881. [Google Scholar] [CrossRef] [Scilit]
- Nair, C.N.; Panicali, D.L. Polyadenylate sequences of human rhinovirus and poliovirus RNA and cordycepin sensitivity of virus replication. J. Virol. 1976, 20, 170–176. [Google Scholar] [CrossRef] [Scilit]
- Verma, A.K. Cordycepin: A bioactive metabolite of Cordyceps militaris and polyadenylation inhibitor with therapeutic potential against COVID-19. J. Biomol. Struct. Dyn. 2022, 40, 3745–3752. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Harvala, H.; Simmonds, P. Human parechoviruses: Biology, epidemiology and clinical significance. J. Clin. Virol. 2009, 45, 1–9. [Google Scholar] [CrossRef] [Scilit]
- Baer, A.; Kehn-Hall, K. Viral concentration determination through plaque assays: Using traditional and novel overlay systems. J. Vis. Exp. 2014, 93, e52065. [Google Scholar] [CrossRef] [Scilit]
- Asghar, N.; Lee, Y.P.; Nilsson, E.; Lindqvist, R.; Melik, W.; Kroger, A.; Overby, A.K.; Johansson, M. The role of the poly(A) tract in the replication and virulence of tick-borne encephalitis virus. Sci. Rep. 2016, 6, 39265. [Google Scholar] [CrossRef] [Scilit]
- Lei, C.; Yang, J.; Hu, J.; Sun, X. On the calculation of TCID(50) for quantitation of virus infectivity. Virol. Sin. 2021, 36, 141–144. [Google Scholar] [CrossRef] [Scilit]
- Das, G.; Shin, H.S.; Leyva-Gómez, G.; Prado-Audelo, M.L.D.; Cortes, H.; Singh, Y.D.; Panda, M.K.; Mishra, A.P.; Nigam, M.; Saklani, S.; et al. Cordyceps spp.: A review on its immune-stimulatory and other biological potentials. Front. Pharmacol. 2020, 11, 602364. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rabie, A.M.; Abdalla, M. Forodesine and riboprine exhibit strong anti-SARS-CoV-2 repurposing potential: In silico and in vitro studies. ACS Bio Med. Chem. Au 2022, 2, 565–585. [Google Scholar] [CrossRef] [Scilit]
- Eltayb, W.A.; Abdalla, M.; Rabie, A.M. Novel investigational anti-SARS-CoV-2 agent ensitrelvir “S-217622”: A very promising potential universal broad-spectrum antiviral at the therapeutic frontline of coronavirus species. ACS Omega 2023, 8, 5234–5246. [Google Scholar] [CrossRef] [Scilit]
- Rabie, A.M. Efficacious preclinical repurposing of the nucleoside analogue didanosine against COVID-19 polymerase and exonuclease. ACS Omega 2022, 7, 21385–21396. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sun, J.; Li, Y.; Wang, Y.; Liu, Y.; Liu, Y.; Wang, X. Comparison of anti-HBV regimen with or without adefovir on hepatocellular carcinoma development of chronic hepatitis B patients with compensated cirrhosis: A retrospective cohort study. Infect. Agent. Cancer 2018, 13, 17. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Borea, P.A.; Gessi, S.; Merighi, S.; Vincenzi, F.; Varani, K. Pharmacology of adenosine receptors: The state of the art. Physiol. Rev. 2018, 98, 1591–1625. [Google Scholar] [CrossRef] [Scilit]
- Hu, Z.; Lee, C.I.; Shah, V.K.; Oh, E.H.; Han, J.Y.; Bae, J.R.; Lee, K.; Chong, M.S.; Hong, J.T.; Oh, K.W. Cordycepin increases nonrapid eye movement sleep via adenosine receptors in rats. Evid. Based Complement. Alternat. Med. 2013, 2013, 840134. [Google Scholar] [CrossRef] [Scilit]
- Cao, H.L.; Liu, Z.J.; Chang, Z. Cordycepin induces apoptosis in human bladder cancer cells via activation of A3 adenosine receptors. Tumour. Biol. 2017, 39, 1010428317706915. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Nishat, S.; Shabir, H.; Azmi, A.S.; Ansari, H.R. A(3) adenosine receptor: A plausible therapeutic target for cardio-protection in diabetes. Recent Pat. Cardiovasc. Drug Discov. 2012, 7, 59–70. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kletzien, R.F. Nucleocytoplasmic transport of RNA. The effect of 3′-deoxyadenosine triphosphate on RNA release from isolated nuclei. Biochem. J. 1980, 192, 753–759. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Vignuzzi, M.; Stone, J.K.; Arnold, J.J.; Cameron, C.E.; Andino, R. Quasispecies diversity determines pathogenesis through cooperative interactions in a viral population. Nature 2006, 439, 344–348. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- You, L.; Chen, J.; Liu, W.; Xiang, Q.; Luo, Z.; Wang, W.; Xu, W.; Wu, K.; Zhang, Q.; Liu, Y.; et al. Enterovirus 71 induces neural cell apoptosis and autophagy through promoting ACOX1 downregulation and ROS generation. Virulence 2020, 11, 537–553. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chen, Y.Y.; Chen, C.H.; Lin, W.C.; Tung, C.W.; Chen, Y.C.; Yang, S.H.; Huang, B.M.; Chen, R.J. The role of autophagy in anti-cancer and health promoting effects of cordycepin. Molecules 2021, 26, 4954. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zheng, B.; Zhou, X.; Tian, L.; Wang, J.; Zhang, W. IFN-β1b induces OAS3 to inhibit EV71 via IFN-β1b/JAK/STAT1 pathway. Virol. Sin. 2022, 37, 676–684. [Google Scholar] [CrossRef] [Scilit]
- Doetsch, P.W.; Suhadolnik, R.J.; Sawada, Y.; Mosca, J.D.; Flick, M.B.; Reichenbach, N.L.; Dang, A.Q.; Wu, J.M.; Charubala, R.; Pfleiderer, W.; et al. Core (2′-5′)oligoadenylate and the cordycepin analog: Inhibitors of Epstein--Barr virus-induced transformation of human lymphocytes in the absence of interferon. Proc. Natl. Acad. Sci. USA 1981, 78, 6699–6703. [Google Scholar] [CrossRef] [Scilit]
- Black, P.L.; Henderson, E.E.; Pfleiderer, W.; Charubala, R.; Suhadolnik, R.J. 2′,5′-Oligoadenylate trimer core and the cordycepin analog augment the tumoricidal activity of human natural killer cells. J. Immunol. 1984, 133, 2773–2777. [Google Scholar] [CrossRef] [Scilit]
- Panicali, D.L.; Nair, C.N. Effect of cordycepin triphosphate on in vitro RNA synthesis by picornavirus polymerase complexes. J. Virol. 1978, 25, 124–128. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Richardson, L.S.; Ting, R.C.; Gallo, R.C.; Wu, A.M. Effect of cordycepin on the replication of type-c RNA tumor viruses. Int. J. Cancer 1975, 15, 451–456. [Google Scholar] [CrossRef] [Scilit] [PubMed]








| Target Gene | Forward Primer | Reverse Primer |
|---|---|---|
| Simian GADPH | GGGAGCCAAAAGGGTCATCA | CGTGGACTGTGGTCATGAGT |
| EV-A71/MP4 | GAGAGTTCTATAGGGGACAGT | AGCTGTGCTATGTGAATTAAGAA |
| EV-A71/Tainan/4643/98 | GAGAGTTCTATAGGGGACAGT | AGCTGTACTATGTGAATTAAGAA |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Lee, Y.-P.; Yu, C.-K.; Wong, T.-W.; Chen, L.-C.; Huang, B.-M. Cordycepin Inhibits Enterovirus A71 Replication and Protects Host Cell from Virus-Induced Cytotoxicity through Adenosine Action Pathway. Viruses 2024, 16, 352. https://doi.org/10.3390/v16030352
Lee Y-P, Yu C-K, Wong T-W, Chen L-C, Huang B-M. Cordycepin Inhibits Enterovirus A71 Replication and Protects Host Cell from Virus-Induced Cytotoxicity through Adenosine Action Pathway. Viruses. 2024; 16(3):352. https://doi.org/10.3390/v16030352
Chicago/Turabian StyleLee, Yi-Ping, Chun-Keung Yu, Tak-Wah Wong, Li-Ching Chen, and Bu-Miin Huang. 2024. "Cordycepin Inhibits Enterovirus A71 Replication and Protects Host Cell from Virus-Induced Cytotoxicity through Adenosine Action Pathway" Viruses 16, no. 3: 352. https://doi.org/10.3390/v16030352
APA StyleLee, Y.-P., Yu, C.-K., Wong, T.-W., Chen, L.-C., & Huang, B.-M. (2024). Cordycepin Inhibits Enterovirus A71 Replication and Protects Host Cell from Virus-Induced Cytotoxicity through Adenosine Action Pathway. Viruses, 16(3), 352. https://doi.org/10.3390/v16030352

