Next Article in Journal
Has COVID-19 Affected the Course of Chickenpox in Children?
Next Article in Special Issue
The Influence of the Temperature on Effectiveness of Selected Disinfectants Against African Swine Fever Virus (ASFV)
Previous Article in Journal
Understanding Perceptions of Hepatitis C and Its Management Among People with Experience of Incarceration in Quebec, Canada: A Qualitative Study Guided by the Common Sense Self-Regulation Model
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Brief Report

Assessment of the Effect of Deleting the African Swine Fever Virus Gene R298L on Virus Replication and Virulence of the Georgia2010 Isolate

by
Elizabeth Ramirez-Medina
1,2,*,
Lauro Velazquez-Salinas
1,2,
Alyssa Valladares
1,3,
Ediane Silva
1,2,
Leeanna Burton
1,2,
Douglas P. Gladue
1,*,† and
Manuel V. Borca
1,*
1
Foreign Animal Disease Research Unit, Plum Island Animal Disease Center (PIADC), Agricultural Research Service, U.S. Department of Agriculture, P.O. Box 848, Greenport, NY 11944, USA
2
Foreign Animal Disease Research Unit, National Bio and Agro-Defense Facility, Agricultural Research Service, U.S. Department of Agriculture, Manhattan, KS 66502, USA
3
Oak Ridge Institute for Science and Education (ORISE), Oak Ridge, TN 37830, USA
*
Authors to whom correspondence should be addressed.
Current Affiliation: Seek Labs, 350 W 800 N Suite 220, Salt Lake City, UT 84103, USA.
Viruses 2024, 16(12), 1911; https://doi.org/10.3390/v16121911
Submission received: 3 November 2024 / Revised: 3 December 2024 / Accepted: 5 December 2024 / Published: 13 December 2024
(This article belongs to the Collection African Swine Fever Virus (ASFV))

Abstract

:
African swine fever (ASF) is a lethal disease of domestic pigs that is currently challenging swine production in large areas of Eurasia. The causative agent, ASF virus (ASFV), is a large, double-stranded and structurally complex virus. The ASFV genome encodes for more than 160 proteins; however, the functions of most of these proteins are still in the process of being characterized. The ASF gene R298L, which has previously been characterized as able to encode a functional serine protein kinase, is expressed late in the virus infection cycle and may be part of the virus particle. There is no description of the importance of the R298L gene in basic virus functions such as replication or virulence in the natural host. Based on its evolution, it is proposed that there are four different phenotypes of R298L of ASFV in nature, which may have potential implications for R298L functionality. We report here that a recombinant virus lacking the R298L gene in the Georgia 2010 isolate, ASFV-G-∆R298L, does not exhibit significant changes in its replication in primary cultures of swine macrophages. In addition, when experimentally inoculated in pigs, ASFV-G-∆R298L induced a fatal form of the disease similar to that caused by the parental virulent ASFV-G. Therefore, deletion of R298L does not significantly affect virus replication and virulence in domestic pigs of the ASFV Georgia 2010 isolate.

1. Introduction

African swine fever (ASF) is a contagious disease of domestic and wild swine that can exhibit different clinical presentations depending on the virus isolate involved and the characteristics of the infected host [1]. ASF is currently distributed across Asia and Europe and has been recently detected in the Dominican Republic and Haiti [1]. Since 2007, ASF has significantly affected pig production and caused food shortages worldwide [1].
The causative agent of ASF, the ASF virus (ASFV), is a large and structurally complex double enveloped virus. The internal membrane surrounds a protein capsid that harbors a large double-stranded DNA genome of approximately 180–190 kilobase pairs capable of encoding more than 150 genes [2]. Many of these viral genes have not been experimentally characterized, and thus their function remains unknown, especially their role in virus functions such as replication and disease production in domestic swine. The understanding of gene function in ASFV has drastically improved with the development of recombinant viruses containing the deletion of the gene/s under study. This approach has been frequently used to evaluate gene function in the context of virus/cell interactions [3,4,5,6,7]. In addition, the identification of ASFV genes involved in virus virulence in domestic pigs, using such recombinant viruses, constituted an important primary stage in rational development of live attenuated ASFV vaccine candidates [8,9,10,11,12].
One of the genes that has not been studied in the context of virus infection either in vitro or in vivo is R298L. ASFV R298L encodes a functional serine protein kinase that is expressed late in the virus infection cycle and may be part of the virus particle [13]. It has been demonstrated that ASFV DNA synthesis in the nuclei of G0 cells is preceded by the activation of the viral genes K196R, A240L, E165R, F334L, F778R, and R298L, which are believed to be involved in the synthesis of nucleotides and the regulation of the cell cycle [14]. Therefore, it is possible that the ASFV R298L gene may be important in several of the virus functions.
Here we report that a recombinant virus harboring a deletion of the R289L gene, derived from the genome of the highly virulent Georgia isolate (ASFV-G), ASFV-G-∆R298L, showed the same replication ability in primary swine macrophage cultures as the parental virus. In addition, ASFV-G-∆R298L showed an almost indistinguishable virulent phenotype from that shown by ASFV-G. Therefore, under the conditions evaluated in this report, the R298L gene does not appear to play a significant role in ASFV replication or disease production in domestic pigs.

2. Materials and Methods

2.1. Viruses and Cells

Primary cultures of swine macrophages, at a density of 5 × 106 cells per ml, were prepared as previously described [15]. ASFV Georgia (ASFV-G) is a virulent field strain kindly provided by Dr. Nino Vepkhvadze, from the Laboratory of the Ministry of Agriculture (LMA) in Tbilisi, Republic of Georgia [15]. Comparative growth curves between ASFV-G-∆R298L and the parental ASFV-G were conducted in primary swine macrophage cell cultures using a multiplicity of infection (MOI) of 0.01 HAD50 (hemadsorbing doses, as previously determined in primary swine macrophage cell cultures) [4]. Sample points were taken at 2, 24, 48, 72, 96, and 120 hours post infection (hpi), cells were frozen at ≤−70 °C, thawed, and the cell lysates titrated using primary swine macrophages in 96-well plates. The presence of virus infected cells was assessed by hemadsorption (HA) and the virus titers were calculated as previously described [16].

2.2. Development of the ASFV R298L Gene Deletion Mutant

ASFV-G-∆R298L, a recombinant ASFV with deletion of the ASFV gene R298L, was produced by homologous recombination using a recombination transfer vector (named p72mCherryΔR298L) as previously described [17]. The recombination vector p72mCherryΔR298L contains the ASFV-G genomic regions flanking the R298L gene: the left arm extends for approximately 1000 base pairs toward the left of nucleotide position 157,060 while the right arm extends approximately 1000 base pairs toward the right from nucleotide position 157,923, along with the reporter gene cassette including the mCherry fluorescent protein (mCherry) gene under the control of the ASFV p72 late gene promoter [18]. p72mCherryΔR298L was developed by DNA synthesis (Epoch Life Sciences, Sugar Land, TX, USA). Recombinant ASFV-G-∆R298L harbors a complete deletion of the R298L gene (between nucleotide positions 157,066–157,922). ASFV-G-∆R298L was purified by several limiting dilution steps based on mCherry activity detection and the recombinant virus stock full-length genome was sequenced using next-generation sequencing (NGS) following exactly the procedures previously described [3,4,5,6].

2.3. Detection of R298L Gene Transcription Kinetics

Transcription kinetics of the R298L gene were evaluated using a real-time PCR assay (qPCR) during the infection of ASFV-G in porcine macrophage cultures as previously described [18]. The expression of the early CP204L (p30) and late B646L (p72) ASFV genes was used as the reference. Porcine macrophage cultures were infected at an MOI of 10 with ASFV-G. RNA extraction was performed at 0–8 and 24 hpi using an RNeasy Kit (QIAGEN, Hilden, Germany). Extracted material was treated with 2 units of DNase I (BioLabs, San Diego, CA, USA) and then purified using the Monarch® RNA Cleanup Kit (New England BioLabs, Inc., Ipswich, MA, USA). One ug of RNA was used to produce cDNA using qScript cDNA SuperMix (Quanta bio, Beverly, MA, USA), and then it was used for the qPCR. Primers and probes for the detection of the R298L gene were designed using the genome of ASFV Georgia 2007/1 strain (GenBank Accession #NC_044959.2). Primer forward: 5′-CCCGTCTCTGAAATGTTCTCG-3′, reverse: 5′-ACCAGCTTCCTTTAACCGTG-3′ and probe: 5′-FAM/TTAACCGCGACCATACCTATCGTCCA/MGBNFQ-3′. Primers and probes for the detection of B646L (p72) gene: forward 5′-CTTCGGCGAGCGCTTTATCAC-3′, reverse: 5′-GGAAATTCATTCACCAAATCCTT-3′ and probe: 5′-FAM-CGATGCAAGCTTTAT-MGB NFQ-3′. Primers and probes for the detection of CP204L (p30) gene: forward 5′-GACGGAATCCTCAGCATCTTC-3′, reverse: 5′-CAGCTTGGAGTCTTTAGGTACC-3′ and probe: 5′-FAM-TGTTTGAGCAAGAGCCCTCATCGG-MGB NFQ-3′. Primers and probes for the detection of the β-actin gene: forward 5′-GACCTGACCGACTACCTCATG-3′, reverse: 5′-TCTCCTTGATGTCCCGCAC-3′ and probe: 5′-FAM-CTACAGCTTCACCACCACGGC NFQ-3′. All qPCRs were conducted using the TaqMan Universal PCR Master Mix (Applied Biosystems, Wakefield, RI, USA) using the following amplification conditions: one step at 55 °C for 2 min, followed by one denaturation step at 95 °C for 10 min, then 40 cycles of denaturation at 95 °C for 15 s and annealing/extension at 65 °C for 1 min. Levels of transcription of different genes were quantified as relative quantities of mRNA accumulation (estimated by 2−ΔΔCt). The β-actin gene was used to normalize the transcription levels of different ASFV genes. Based on a previous validation in our laboratory, it was determined that values ≤ 18.44 2−ΔΔCt were due to DNA background.

2.4. Evaluation of ASFV-G-ΔR298LR Virulence in Domestic Pigs

The virulence of ASFV-G-ΔR298L was assessed in 35–40 kg commercial breed swine. Groups of 5 pigs were intramuscularly (IM) inoculated with 102 HAD50 of ASFV-G-∆R298L and compared with a group of animals inoculated with 102 HAD50 of the virulent parental virus ASFV-G. The presence of clinical signs associated with ASF (such as anorexia, depression, fever, purple skin discoloration, staggering gait, diarrhea, and cough) as well as body temperature values were recorded daily throughout the experiment. Experiments with pigs were performed under biosafety level 3 conditions in the animal facilities at Plum Island Animal Disease Center, following a strict protocol approved by the Institutional Animal Care and Use Committee (225.06-19-R_090716, approved on 09-06-19).

3. Results and Discussion

3.1. Evolutionary Dynamics of R298L Gene of ASFV in Nature

The ASFV R298L gene encodes a serine protein kinase in ASFV [13]. To obtain more insights about the evolutionary dynamics of this gene in nature, we conducted a BLAST [19] analysis using the R298L gene of the isolate Georgia 2007/1 as the query. As a result, a total of 22 representative sequences were retrieved from the GenBank database. These sequences included ASFV lineages I, II, III, IV, V, VII, VIII, IX, X, XV and XX (Figure 1). Phylogenetic analyses inferred using the neighbor-joining method and the maximum composite likelihood method as a substitution model indicated that the R298L gene of ASFV has diverged in at least three distinct phylogenetic groups in nature (Figure 1A). The Georgia 2007/1 isolate used in this study as a parental strain to produce the recombinant virus ASFV-G-ΔR298L was associated with the conserved phylogenetic group A, sharing high levels of nucleotide and amino acid identities with isolates associated with the other six ASFV lineages (Figure 1A). Overall, pairwise distance conducted among representative isolates reflected the high conservation of this gene in nature (0.956 ± 0.004). When we conducted this analysis between phylogenetic groups, we found that the greatest distance at both the nucleotide (Figure 1B) and amino acid (Figure 1C) levels was between group A and the other two groups, suggesting that R298L in nature might be evolving into different isoforms.
In terms of the evolution of R298L within lineage II, pairwise distance analysis carried out between the two representative strains associated with this lineage showed extremely high conservation of this gene during the evolution of this lineage in nature (nucleotide: 0.998 ± 0.010 and amino acid: 1.000). The only change during the evolution of this lineage has implicated the synonymous substitution GCG-GCA at codon 20, indicating that R298L is not promoting the divergence of lineage II during pandemics. To identify potential isoforms of R298L in nature and how these are related at the phylogenetic level, we conducted a phylogenetic analysis using the maximum likelihood method and JTT matrix-based model using the amino acid sequences of the representative isolates. Overall, a total of 12 possible distinct isoforms of R298L were found distributed among the different phylogenetic groups (Figure 1D). Interestingly, the amino acid sequence of the representative isolates linked with lineage II (Geogia 2007/1 and ASFV/Ulyanovsk 19/WB-5699) appeared 100% identical to the sequence displayed by the strain Liv13/33 (Genotype I), isolated in 1983 from a tick in Zambia, Africa [20]. The statement above suggests that the protein sequence of R298L present in the lineage II has remained unchanged for at least 40 years.
Overall, the amino acid aligment of R298L showed the high conservation of this protein among ASFV strains in nature. A total of 40 variable sites were predicted in the aligment (Figure 2). From these, site 49 is characterized by the presence of an insertion (arginine/R), which is characteristic of the isolates comprising the phylogenetic groups B and C. A different insertion (glycine/G) at this site was also found in a single isolate of the phylogentic group A (spencer). Interestingly, these insertions are located in the the protein kinase/catalytic domain (spanning between residues 46 and 277), suggesting that the presence of these insertions could have a possible effect in the funcionality of this domine. In general, there is high conservation among the 18 residues associated with the ATP binding sites (Figure 2). The only exception is residue 64, which represents a variable site, showing an isoleucine/I in isolates related to phylogenetic group A, while isolates from groups B and C are associated with the presence of a valine/V (Figure 2). In this sense, not only the presence of the insertions but also the differences at ATP binding site 64 may be proposed as a potential markers for diagnostic or epidemiologic purposes. Future experimental studies are needed to evaluate the possible biological significance of insertions and differences at binding site 64 found in R298L.

3.2. Effect of Natural Selection in the Evolution of R298L

To identify critical codon sites during the evolution of R298L, we conducted multiple selection detection methods, including single likelihood ancestor counting (SLAC) [21], fixed effects likelihood (FEL) [21], and mixed effects model of evolution (MEME) [22]. These methods detect codon sites under diversifying (selection favoring the fixation of nonsynonymous changes) or negative selection (selection against the fixation of nonsynonymous changes) by inferring rates of synonymous (dS) and nonsynonymous (dN) substitutions on a per-site basis in a codon-based phylogenetic framework [23]. An overall dN/dS rate equal to 0.189 indicates that negative selection is dominating the evolution of R298L in nature. This result is consistent with the increased substitution rate at synonymous codon sites, which was calculated to be 5.11 times higher than the one observed at nonsynonymous sites (Figure 3A). Overall, a total of 39 codon sites along the R298L gene were identified as being under negative selection by FEL (Figure 3B). Most of these codons (82.05%) are located in the protein kinase/catalytic domain. Interestingly, when we conducted FEL analysis at internal nodes, we found strong evidence of negative selection at the population level in 25 out of 39 codons previously predicted (Figure 3B), highlighting the potential relevance of these codon sites for the functionality of R298L. Among these sites, we found evidence of negative selection at the population level at two codons associated with highly conserved ATP binding residues (see the alignment in Figure 2): V53 (alleles in the population GTA, GTC, and GTT), and I110 (alleles in the population ATT and ATC), stressing the importance of the conservation of these residues during the evolution of R298L of ASFV. Furthermore, considering the time of collection of some of the representative ASFVs included in these analyses, like Kenya 1950 (Figure 1), we may state that the conservation of the amino acid residues linked to the 39 codon sites identified under negative selection at R298L have remained in the same state for at least 70 years, emphasizing their possible relevance in maintaining the functionality of R298L during its evolution in nature.
Overall, based on the strong evidence of negative selection at the population level, we consider that the codons identified during our study represent an excellent framework for future experimental studies attempting to identify new functional sites in R298L. We used MEME to identify codon sites under positive selection. As a result, three codons associated with the encoded residues 36, 137 and 182 were found to promote the adaptation of R298L in nature; furthermore, 137 and 182 are part of the protein kinase/catalytic domain (Figure 3B).
To get more insights about the impact of the selection of these codons in the divergence of different phylogenetic groups using SLAC, we conducted an ancestral reconstruction analysis (Figure 4). Overall, based on the selection of codon 36, we observed that representative isolates can be divided into two different phenotypes: M36 and S36 (Figure 4-1).
The allele ATG(M) appeared highly conserved among ancestral predicted sequences at internal nodes and representative ASFV linked to group A. Conversely, allele TCG(S) was representative of ancestral states and ASFV associated with groups B and C. However, the only exception was the strain NAM/P1/1995, collected from a pig in Namibia [24] (related to phylogenetic group B), which evolved with selection of the allele ATG(M), suggesting that convergent/parallel evolution is implicated in the presentation of the phenotype M36 in nature. On the other hand, selection of codons 137 and 182 were implicated in the divergence of phylogenetic groups B and C, respectively (Figure 4-2,3). Interestingly, when we conducted FEL at internal nodes, we found evidence of positive selection at the population level (p ≤ 0.1) in codon 182, stressing the relevance of this codon during the adaptation of R298L in nature. Experimental analyses are needed to get more insight about the potential role of the codons identified under positive selection in the functionality of R298L. Based on the results obtained by MEME, we may propose the existence of four different phenotypes of R298L of ASFV in nature. Phenotype 1: M36-L137-T182 (Group A), phenotype 2: S36-M137-T182 (Group B), phenotype 3: M36-M137-T182 (Group B), and phenotype 4: S36-L137-D182 (Group C). In light of these results, we may state that the identification of these phenotypes may have two potential implications. First, at the epidemiologic level to support the characterization of the genetic origin of ASFV, linked to specific phylogenetic groups based on the R298L classification proposed in this study. Second, the potential existence of different phenotypes may imply that R298L proteins present in ASFV at different phylogenetic groups might show differences in their functionality, potentially impacting their pathogenesis in pigs. Future experimental studies are needed to evaluate this hypothesis.

3.3. Effects of Epistasis/Co-Evolution at R298L

Furthermore, to identify evidence of epistasis/co-evolution in R298L, we conducted the SpiderMonkey-Bayesian Graphical Model (BGM) [25]. BGM is deduced from reconstructed substitutions at each branch/site combination to infer conditional evolutionary dependencies of sites in the alignments, denoting interactions among variable residues in proteins [25]. BMG found evidence of two pairs of co-evolving sites (posterior probability > 0.5) at R298L (Figure 5A). All four sites constituting the two pairs of co-evolving sites are located in the protein kinase/catalytic domain, highlighting the relevance of these interactions. Interestingly, we found that positive selection at codon 137 was influenced by the evolution of site 114 (Figure 5B). Not only all representative ASFVs, but also the predicted sequences at ancestral nodes, showed the phenotypes V114-L137 and I114-M137 consistently, stressing the relevance of this result at population level. Similar results were observed in the second pair of co-evolving sites (Figure 5C). There, the phenotypes R238-E256 and G238-D256 were observed. The above data strongly suggest that epistasis should be considered as an evolutionary mechanism of R298L of ASFV in nature. No evidence of recombination was found in R298L after conducting the genetic algorithm for recombination detection [26].

3.4. Transcription of the R298L Gene in ASFV Infected Macrophages

The transcription kinetics of the R298L gene was evaluated during the virus replication cycle in swine macrophages infected with ASFV strain Georgia. Swine macrophage cultures were infected (MOI = 10) with ASFV-G and cell lysates were obtained from 0–8 and 24 hpi. The presence of R298L transcripts was evaluated by RT-PCR. As a reference, we used the well-characterized ASFV early protein p30 (CP204L gene) and the late protein p72 (B646L gene). Overall, similar transcriptional kinetics were observed between R298L and p72 (B646L), indicating that R298L is a late transcribed gene (Figure 6). In both genes, low initial transcription levels were observed at 7 hpi and then they gradually increased until the end of the experment. These results are consistent with a previous report that indicated that R298L is classified as a low to mid transcribed gene [13].

3.5. Development of the Recombinant ASFV-G-ΔR298L

Since ASFV gene R298L encodes for a functional serine protein kinase that may be part of the virus particle and has been proposed to be involved in virus DNA synthesis [13], it could be assumed that this gene may play an important role in processes such as virus replication or virulence in domestic pigs.
To understand the potential role of the R298L gene in these processes, a recombinant virus was developed harboring the deletion of the R298L gene (ASFV-G-∆R298L) using as parental virus the highly virulent ASFV Georgia 2010 isolate (ASFV-G). The R298L gene was completely deleted and then substituted by the p72mCherry cassette [18]. An area covering 687 bp (involving nucleotide positions 157,066 and 157,922) was deleted from the ASFV-G genome and substituted with a 1226-bp cassette containing the p72mCherry construct (see Section 2) (Figure 7). The recombinant ASFV-G-∆R298L stock was purified by limiting dilution, using primary swine macrophage cell cultures as the cell substrate.
The nature of the modifications introduced into the ASFV-G-∆R298L genome was assessed by analyzing the full genome sequence by NGS using an Illumina NextSeq® 500. The results of the analysis indicated a deletion of 861 nucleotides and an insertion of 1226 nucleotides corresponding to the p72-mCherry cassette sequence. There were no undesired additional genomic modifications detected in the stock of ASFV-G-∆R298L. NGS revealed no evidence of the potential contamination of the parental ASFV-G genome into the ASFV-G-∆R298L stock.

3.6. Replication of ASFV-G-∆R298L in Primary Swine Macrophages

To evaluate the importance of the R298L gene during the process of virus replication in swine macrophages, the replication ability of ASFV-G-∆R298L in swine macrophage cultures was studied and compared to that of the parental ASFV-G. A multistep growth curve study was performed, infecting swine macrophage cultures with an MOI of 0.01 with either ASFV-G-∆R298L or ASFV-G and virus yields were quantified at 2, 24, 48, 72, 96, and 120 hpi. The results demonstrated that ASFV-G-∆R298L replicates as efficiently as the parental ASFV-G does with similar virus titers at all of the sample points tested (Figure 8), indicating that deletion of the R298L gene from the genome of the ASFV-G does not significantly impact the ability of the virus to replicate in swine macrophage cultures.

3.7. Assessment of ASFV-G-∆R298L Virulence in Swine

To evaluate the potential role of the R298L gene in the production of disease by the ASFV-G isolate, the recombinant ASFV-G-∆R298L was experimentally inoculated by the IM route into a group of five pigs at a dose of 102 HAD50. A control group of four animals was inoculated under the same conditions with the virulent parental ASFV-G isolate. The appearance of clinical signs associated with ASF was observed in both groups of animals for a 28-day period.
Animals inoculated with the virulent parental ASFV-G showed an increase in body temperature (>40 °C) on day 4–5 pi and quickly progressed to a full clinical disease (depression, anorexia, staggering gait, diarrhea, and purple skin discoloration) (Figure 9 and Figure 10), with all pigs euthanized on day 5–6 post infection (pi).
Similarly, pigs IM inoculated with ASFV-G-∆R298L presented a lethal form of the disease like that in animals inoculated with ASFV-G. Animals showed increased body temperature over 40 °C (dash line indicates the top limit of normal body temperature) on days 4 to 6 pi with the clinical disease promptly worsening, with all animals being euthanized between days 6 and 8 post infection due to the severity of the clinical disease. Therefore, deletion of the R298L gene from the ASFV-G genome does not produce alterations in virus virulence when tested in experimentally infected domestic swine under the experimental conditions described here.
The degree of replication of ASFV-G-∆R298L in the experimentally infected pigs was evaluated by measuring the levels of viremia in comparison to the viremia values shown in the pigs infected with the parental virulent ASFV-G (Figure 11). Pigs experimentally infected with ASFV-G showed high viremia titers (ranging from 105.55–108 HAD50/mL) at day 4 pi. High values (ranging from 107.55–108.2 HAD50/mL) lasted until day 5 or 6 pi when all animals were euthanized. Similarly, viremia titers in animals inoculated with ASFV-G-∆R298L also presented high viremia titers. These animals presented a wide range in titer values (between 102–108.2 HAD50/mL by day 4 pi, drastically increasing their viremias titers (ranging from 107–108.2 HAD50/mL) by day (5 to 7 pi), when all of them had to be euthanized due to the severity of the clinical disease.
It should be remarked that the genomic sequence of the virus obtained in blood samples taken from these five animals inoculated with ASFV-G-∆R298L confirmed that the virus present in each of the samples sequenced by NGS was ASFV-G-∆R298L. These results confirm that in these animals, the clinical disease was in fact induced by ASFV-G-∆R298L and not due to potential cross contamination with the parental ASFV-G not completely eliminated during the process of ASFV-G-∆R298L purification. In addition, no unexpected genomic modifications (mutations or genomic rearrangements) were observed in the genome of the viruses isolated from the ASFV-G-∆R298L inoculated animals. Therefore, ASFV-G-∆R298L developed a systemic infection in experimentally inoculated animals that resembles that induced by the parental ASFV-G.
The results reported here clearly show that deletion of the R298L gene from the genome of the highly virulent isolate Georgia 2010 does not affect basic ASFV functions such as virus replication in macrophages (both in cell cultures and pigs experimentally infected) or its virulence in domestic pigs. It is possible that other viral genes that have not been fully characterized yet may have similar or partially overlapping functions with the R298L gene. It is interesting to note this is another example where an ASFV gene, which was previously shown to have a defined structure and/or function that would presuppose a critical role in important functions of the virus, is shown not only to be non-essential for virus viability, but its absence also does not affect virus replication or disease production in the natural host. Similar situations have been observed with other ASFV genes initially demonstrated to have a specific function using experimental in vitro approaches [3,27,28,29,30,31,32,33,34,35,36,37,38,39]. This fact emphasizes the importance of evaluating the roles and functions of gene function in the context of the interaction between the virus and the host (either cell cultures and/or susceptible animals) rather than encoded proteins as isolated factors within in vitro models.

Author Contributions

Conceptualization, M.V.B. and D.P.G.; methodology, L.V.-S. and E.R.-M.; investigation, L.V.-S., E.R.-M., A.V. and E.S.; data curation, L.V.-S., E.R.-M. and L.B.; writing—original draft preparation, M.V.B. and D.P.G.; writing—review and editing, M.V.B., D.P.G., L.V.-S. and E.R.-M.; funding acquisition, M.V.B. and D.P.G. All authors have read and agreed to the published version of the manuscript.

Funding

This project was funded through an interagency agreement with the Science and Technology Directorate of the U.S. Department of Homeland Security under Award Number 70RSAT19KPM000056.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

All data are included in the manuscript.

Acknowledgments

We thank the Plum Island Animal Disease Center Animal Care Unit staff for their excellent technical assistance. We wish to particularly thank Carmen V. Borca-Carrillo for editing the manuscript. This research was supported in part by an appointment to the Plum Island Animal Disease Center (PIADC) Research Participation Program administered by the Oak Ridge Institute for Science and Education (ORISE) through an interagency agreement between the U.S. Department of Energy (DOE) and the U.S. Department of Agriculture (USDA). ORISE is managed by ORAU under DOE contract number DE-SC0014664. All opinions expressed in this paper are the author’s and do not necessarily reflect the policies and views of USDA, ARS, APHIS, DOE, or ORAU/ORISE.

Conflicts of Interest

Author Douglas P. Gladue was employed by the company Seek Labs. The remaining authors declare that this research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

References

  1. Gonzales, W.; Moreno, C.; Duran, U.; Henao, N.; Bencosme, M.; Lora, P.; Reyes, R.; Nunez, R.; De Gracia, A.; Perez, A.M. African swine fever in the Dominican Republic. Transbound. Emerg. Dis. 2021, 68, 3018–3019. [Google Scholar] [CrossRef]
  2. Tulman, E.R.; Delhon, G.A.; Ku, B.K.; Rock, D.L. African Swine Fever Virus. In Lesser Known Large dsDNA Viruses; Etten, V., Ed.; Current Topics in Microbiology and Immunology; Springer: Berlin/Heidelberg, Germany, 2009; Volume 328, pp. 43–87. [Google Scholar]
  3. Ramirez-Medina, E.; Vuono, E.A.; Pruitt, S.; Rai, A.; Espinoza, N.; Velazquez-Salinas, L.; Gladue, D.P.; Borca, M.V. Evaluation of an ASFV RNA Helicase Gene A859L for Virus Replication and Swine Virulence. Viruses 2021, 14, 10. [Google Scholar] [CrossRef]
  4. Vuono, E.A.; Ramirez-Medina, E.; Pruitt, S.; Rai, A.; Espinoza, N.; Velazquez-Salinas, L.; Gladue, D.P.; Borca, M.V. Evaluation of the Function of the ASFV KP177R Gene, Encoding for Structural Protein p22, in the Process of Virus Replication and in Swine Virulence. Viruses 2021, 13, 986. [Google Scholar] [CrossRef] [PubMed]
  5. Ramirez-Medina, E.; Vuono, E.; Pruitt, S.; Rai, A.; Silva, E.; Espinoza, N.; Zhu, J.; Velazquez-Salinas, L.; Borca, M.V.; Gladue, D.P. Development and In Vivo Evaluation of a MGF110-1L Deletion Mutant in African Swine Fever Strain Georgia. Viruses 2021, 13, 286. [Google Scholar] [CrossRef]
  6. Ramirez-Medina, E.; Vuono, E.A.; Rai, A.; Pruitt, S.; Silva, E.; Velazquez-Salinas, L.; Zhu, J.; Gladue, D.P.; Borca, M.V. Evaluation in Swine of a Recombinant African Swine Fever Virus Lacking the MGF-360-1L Gene. Viruses 2020, 12, 1193. [Google Scholar] [CrossRef] [PubMed]
  7. Borca, M.V.; O’Donnell, V.; Holinka, L.G.; Risatti, G.R.; Ramirez-Medina, E.; Vuono, E.A.; Shi, J.; Pruitt, S.; Rai, A.; Silva, E.; et al. Deletion of CD2-like gene from the genome of African swine fever virus strain Georgia does not attenuate virulence in swine. Sci. Rep. 2020, 10, 494. [Google Scholar] [CrossRef] [PubMed]
  8. Borca, M.V.; Ramirez-Medina, E.; Silva, E.; Vuono, E.; Rai, A.; Pruitt, S.; Espinoza, N.; Velazquez-Salinas, L.; Gay, C.G.; Gladue, D.P. ASFV-G-I177L as an Effective Oral Nasal Vaccine against the Eurasia Strain of Africa Swine Fever. Viruses 2021, 13, 765. [Google Scholar] [CrossRef] [PubMed]
  9. Borca, M.V.; Ramirez-Medina, E.; Silva, E.; Vuono, E.; Rai, A.; Pruitt, S.; Holinka, L.G.; Velazquez-Salinas, L.; Zhu, J.; Gladue, D.P. Development of a Highly Effective African Swine Fever Virus Vaccine by Deletion of the I177L Gene Results in Sterile Immunity against the Current Epidemic Eurasia Strain. J. Virol. 2020, 94, e02017-19. [Google Scholar] [CrossRef]
  10. Gladue, D.P.; Ramirez-Medina, E.; Vuono, E.; Silva, E.; Rai, A.; Pruitt, S.; Espinoza, N.; Velazquez-Salinas, L.; Borca, M.V. Deletion of the A137R Gene from the Pandemic Strain of African Swine Fever Virus Attenuates the Strain and Offers Protection against the Virulent Pandemic Virus. J. Virol. 2021, 95, e0113921. [Google Scholar] [CrossRef]
  11. O’Donnell, V.; Holinka, L.G.; Krug, P.W.; Gladue, D.P.; Carlson, J.; Sanford, B.; Alfano, M.; Kramer, E.; Lu, Z.; Arzt, J.; et al. African swine fever virus Georgia 2007 with a deletion of virulence-associated gene 9GL (B119L), when administered at low doses, leads to virus attenuation in swine and induces an effective protection against homologous challenge. J. Virol. 2015, 89, 8556–8566. [Google Scholar] [CrossRef]
  12. Monteagudo, P.L.; Lacasta, A.; Lopez, E.; Bosch, L.; Collado, J.; Pina-Pedrero, S.; Correa-Fiz, F.; Accensi, F.; Navas, M.J.; Vidal, E.; et al. BA71DeltaCD2: A New Recombinant Live Attenuated African Swine Fever Virus with Cross-Protective Capabilities. J. Virol. 2017, 91, e01058-17. [Google Scholar] [CrossRef] [PubMed]
  13. Cackett, G.; Portugal, R.; Matelska, D.; Dixon, L.; Werner, F. African Swine Fever Virus and Host Response: Transcriptome Profiling of the Georgia 2007/1 Strain and Porcine Macrophages. J. Virol. 2022, 96, e0193921. [Google Scholar] [CrossRef] [PubMed]
  14. Avagyan, R.H.; Hakobyan, S.A.; Poghosyan, A.A.; Bayramyan, N.V.; Arzumanyan, H.A.; Abroyan, L.O.; Avetisyan, A.S.; Hakobyan, L.A.; Karalova, E.M.; Karalyan, Z.A. African Swine Fever Virus Manipulates the Cell Cycle of G0-Infected Cells to Access Cellular Nucleotides. Viruses 2022, 14, 1593. [Google Scholar] [CrossRef]
  15. Borca, M.V.; Berggren, K.A.; Ramirez-Medina, E.; Vuono, E.A.; Gladue, D.P. CRISPR/Cas Gene Editing of a Large DNA Virus: African Swine Fever Virus. Bio-Protocol 2018, 8, e2978. [Google Scholar] [CrossRef] [PubMed]
  16. Reed, L.J.; Muench, H. A simple method of estimating fifty percent endpoints. Am. J. Hyg. 1938, 27, 493–497. [Google Scholar]
  17. O’Donnell, V.; Risatti, G.R.; Holinka, L.G.; Krug, P.W.; Carlson, J.; Velazquez-Salinas, L.; Azzinaro, P.A.; Gladue, D.P.; Borca, M.V. Simultaneous deletion of the 9GL and UK genes from the African swine fever virus Georgia 2007 isolate offers increased safety and protection against homologous challenge. J. Virol. 2017, 91, e01760-16. [Google Scholar] [CrossRef]
  18. Borca, M.V.; O’Donnell, V.; Holinka, L.G.; Sanford, B.; Azzinaro, P.A.; Risatti, G.R.; Gladue, D.P. Development of a fluorescent ASFV strain that retains the ability to cause disease in swine. Sci. Rep. 2017, 7, 46747. [Google Scholar] [CrossRef] [PubMed]
  19. Altschul, S.F.; Gish, W.; Miller, W.; Myers, E.W.; Lipman, D.J. Basic local alignment search tool. J. Mol. Biol. 1990, 215, 403–410. [Google Scholar] [CrossRef] [PubMed]
  20. Dixon, L.K.; Wilkinson, P.J. Genetic diversity of African swine fever virus isolates from soft ticks (Ornithodoros moubata) inhabiting warthog burrows in Zambia. J. Gen. Virol. 1988, 69, 2981–2993. [Google Scholar] [CrossRef]
  21. Kosakovsky Pond, S.L.; Frost, S.D. Not so different after all: A comparison of methods for detecting amino acid sites under selection. Mol. Biol. Evol. 2005, 22, 1208–1222. [Google Scholar] [CrossRef]
  22. Murrell, B.; Wertheim, J.O.; Moola, S.; Weighill, T.; Scheffler, K.; Kosakovsky Pond, S.L. Detecting individual sites subject to episodic diversifying selection. PLoS Genet. 2012, 8, e1002764. [Google Scholar] [CrossRef] [PubMed]
  23. Weaver, S.; Shank, S.D.; Spielman, S.J.; Li, M.; Muse, S.V.; Kosakovsky Pond, S.L. Datamonkey 2.0: A Modern Web Application for Characterizing Selective and Other Evolutionary Processes. Mol. Biol. Evol. 2018, 35, 773–777. [Google Scholar] [CrossRef] [PubMed]
  24. Goatley, L.C.; Freimanis, G.L.; Tennakoon, C.; Bastos, A.; Heath, L.; Netherton, C.L. African swine fever virus NAM P1/95 is a mixture of genotype I and genotype VIII viruses. Microbiol. Resour. Announc. 2024, 13, e0006724. [Google Scholar] [CrossRef] [PubMed]
  25. Poon, A.F.; Lewis, F.I.; Pond, S.L.; Frost, S.D. An evolutionary-network model reveals stratified interactions in the V3 loop of the HIV-1 envelope. PLoS Comput. Biol. 2007, 3, e231. [Google Scholar] [CrossRef]
  26. Kosakovsky Pond, S.L.; Posada, D.; Gravenor, M.B.; Woelk, C.H.; Frost, S.D. GARD: A genetic algorithm for recombination detection. Bioinformatics 2006, 22, 3096–3098. [Google Scholar] [CrossRef] [PubMed]
  27. Borca, M.V.; Irusta, P.M.; Kutish, G.F.; Carillo, C.; Afonso, C.L.; Burrage, A.T.; Neilan, J.G.; Rock, D.L. A structural DNA binding protein of African swine fever virus with similarity to bacterial histone-like proteins. Arch. Virol. 1996, 141, 301–313. [Google Scholar] [CrossRef] [PubMed]
  28. Frouco, G.; Freitas, F.B.; Coelho, J.; Leitao, A.; Martins, C.; Ferreira, F. DNA-Binding Properties of African Swine Fever Virus pA104R, a Histone-Like Protein Involved in Viral Replication and Transcription. J. Virol. 2017, 91, e02498-16. [Google Scholar] [CrossRef]
  29. Showalter, A.K.; Tsai, M.-D. A DNA Polymerase with specificity for five base pairs. J. Am. Chem. Assoc. 2001, 123, 1776–1777. [Google Scholar] [CrossRef]
  30. Redrejo-Rodríguez, M.; Rodríguez, J.M.; Suárez, C.; Salas, J.; Salas, M.L. Involvement of the reparative DNA polymerase Pol X of African swine fever virus in the maintenance of viral genome stability in vivo. J. Virol. 2013, 87, 9780–9787. [Google Scholar] [CrossRef] [PubMed]
  31. Ramirez-Medina, E.; Velazquez-Salinas, L.; Rai, A.; Espinoza, N.; Valladares, A.; Silva, E.; Burton, L.; Spinard, E.; Meyers, A.; Risatti, G.; et al. Evaluation of the Deletion of the African Swine Fever Virus Gene O174L from the Genome of the Georgia Isolate. Viruses 2023, 23, 2134. [Google Scholar] [CrossRef] [PubMed]
  32. Camacho, A.; Viñuela, E. Protein p22 of African swine fever virus: An early structural protein that is incorporated into the membrane of infected cells. Virology 1991, 181, 251–257. [Google Scholar] [CrossRef] [PubMed]
  33. Ramirez-Medina, E.; Vuono, E.A.; Rai, A.; Espinoza, N.; Valladares, A.; Spinard, E.; Velazquez-Salinas, L.; Gladue, D.P.; Borca, M.V. Evaluation of the Function of ASFV Gene E66L in the Process of Virus Replication and Virulence in Swine. Viruses 2023, 15, 566. [Google Scholar] [CrossRef] [PubMed]
  34. Oliveros, M.; García-Escudero, R.; Alejo, A.; Viñuela, E.; Salas, M.L.; Salas, J. African swine fever virus dUTPase is a highly specific enzyme required for efficient replication in swine macrophages. J. Virol. 1999, 73, 8934–8943. [Google Scholar] [CrossRef]
  35. Vuono, E.A.; Ramirez-Medina, E.; Pruitt, S.; Rai, A.; Espinoza, N.; Silva, E.; Velazquez-Salinas, L.; Gladue, D.P.; Borca, M.V. Deletion of the ASFV dUTPase Gene E165R from the Genome of Highly Virulent African Swine Fever Virus Georgia 2010 Does Not Affect Virus Replication or Virulence in Domestic Pigs. Viruses 2022, 14, 1409. [Google Scholar] [CrossRef] [PubMed]
  36. Redrejo-Rodríguez, M.; García-Escudero, R.; Yáñez-Muñoz, R.J.; Salas, M.L.; Salas, J. African swine fever virus protein pE296R is a DNA repair apurinic/apyrimidinic endonuclease required for virus growth in swine macrophages. J. Virol. 2006, 80, 4847–4857. [Google Scholar] [CrossRef]
  37. Vuono, E.A.; Ramirez-Medina, E.; Pruitt, S.; Rai, A.; Espinoza, N.; Spinard, E.; Valladares, A.; Silva, E.; Velazquez-Salinas, L.; Borca, M.V.; et al. Deletion of the EP296R Gene from the Genome of Highly Virulent African Swine Fever Virus Georgia 2010 Does Not Affect Virus Replication or Virulence in Domestic Pigs. Viruses 2022, 14, 1682. [Google Scholar] [CrossRef]
  38. Freitas, F.B.; Frouco, G.; Martins, C.; Ferreira, F. The QP509L and Q706L superfamily II RNA helicases of African swine fever virus are required for viral replication, having non-redundant activities. Emerg. Microbes Infect. 2019, 8, 291–302. [Google Scholar] [CrossRef]
  39. Ramirez-Medina, E.; Vuono, E.A.; Pruitt, S.; Rai, A.; Espinoza, N.; Spinard, E.; Valladares, A.; Silva, E.; Velazquez-Salinas, L.; Borca, M.V.; et al. Deletion of an African Swine Fever Virus ATP-Dependent RNA Helicase QP509L from the Highly Virulent Georgia 2010 Strain Does Not Affect Replication or Virulence. Viruses 2022, 14, 2548. [Google Scholar] [CrossRef] [PubMed]
Figure 1. Phylogenetic dynamics of R298L gene in nature. (A) Phylogenetic analysis conducted by the neighbor-joining method using the full-length sequence of the R298L gene indicates the existence of three potential phylogenetic groups. Numbers in the parenthesis indicate the genotype of different strains based on the B646L classification. Percentage of nucleotide (nt) and amino acid (AA) identities within groups are displayed. Pairwise distance analysis showing differences at the nucleotide (B) and amino acid level (C) between phylogenetic groups are exhibited. (D) Phylogenic tree reconstructed by the maximum likelihood method using full length amino acid sequences of R298L. ASFV labeled with the same shape indicates 100% amino acid sequence identity.
Figure 1. Phylogenetic dynamics of R298L gene in nature. (A) Phylogenetic analysis conducted by the neighbor-joining method using the full-length sequence of the R298L gene indicates the existence of three potential phylogenetic groups. Numbers in the parenthesis indicate the genotype of different strains based on the B646L classification. Percentage of nucleotide (nt) and amino acid (AA) identities within groups are displayed. Pairwise distance analysis showing differences at the nucleotide (B) and amino acid level (C) between phylogenetic groups are exhibited. (D) Phylogenic tree reconstructed by the maximum likelihood method using full length amino acid sequences of R298L. ASFV labeled with the same shape indicates 100% amino acid sequence identity.
Viruses 16 01911 g001
Figure 2. Amino acid similarities of R298L among ASFV representative strains. Amino acid alignment showing similarities of the R298L protein among a group of representative ASFV isolates. The protein kinase/catalytic domain spans between residues 46 and 277. Asterisks above specific sites indicate ATP binding residues in R298L. Conservation plot scores reflect the nature of the change in specific sites. Increased scores reflect substitutions between residues with similar biological properties. The analysis was conducted in the software Jalview version 2.11.1.7.
Figure 2. Amino acid similarities of R298L among ASFV representative strains. Amino acid alignment showing similarities of the R298L protein among a group of representative ASFV isolates. The protein kinase/catalytic domain spans between residues 46 and 277. Asterisks above specific sites indicate ATP binding residues in R298L. Conservation plot scores reflect the nature of the change in specific sites. Increased scores reflect substitutions between residues with similar biological properties. The analysis was conducted in the software Jalview version 2.11.1.7.
Viruses 16 01911 g002
Figure 3. Evolutionary dynamics of R298L gene in nature. (A) Comparison between synonymous (dS) and nonsynonymous (dN) substitutions rates during the evolution of the R298L gene. Significant differences between dS and dN were determined by the unpaired t-test. (B) Graphic representation obtained by SLAC analysis, showing the ratio dN-dS at specific codon sites in the R298L gene of ASFV. Identification of specific codon sites under positive selection (blue asterisks) and negative selection (green asterisks). Orange asterisks represent sites of negative selection at internal nodes. Results were obtained by MEME (p-value threshold of 0.1) and FEL (p-value threshold of 0.1). Numbers close to the asterisk indicate the specific codon position.
Figure 3. Evolutionary dynamics of R298L gene in nature. (A) Comparison between synonymous (dS) and nonsynonymous (dN) substitutions rates during the evolution of the R298L gene. Significant differences between dS and dN were determined by the unpaired t-test. (B) Graphic representation obtained by SLAC analysis, showing the ratio dN-dS at specific codon sites in the R298L gene of ASFV. Identification of specific codon sites under positive selection (blue asterisks) and negative selection (green asterisks). Orange asterisks represent sites of negative selection at internal nodes. Results were obtained by MEME (p-value threshold of 0.1) and FEL (p-value threshold of 0.1). Numbers close to the asterisk indicate the specific codon position.
Viruses 16 01911 g003
Figure 4. Ancestral reconstruction analysis of codon sites under positive selection at R298L. The analysis shows the evolutionary dynamics among the predicted phylogenetic groups in R298L at codon 36 (A), 137 (B) and 182 (C). Each phylogenetic tree displays the predicted codon sequences at internal nodes (most probable common ancestor sequence associated with the divergence between and within phylogenetic groups) and leaf nodes (represented by different isolates). Analysis was conducted using the algorithm MEME. Results were saved in json format and visualized in the MEME analysis result visualization tool (https://observablehq.com/@spond/meme, accessed on 25 October 2024).
Figure 4. Ancestral reconstruction analysis of codon sites under positive selection at R298L. The analysis shows the evolutionary dynamics among the predicted phylogenetic groups in R298L at codon 36 (A), 137 (B) and 182 (C). Each phylogenetic tree displays the predicted codon sequences at internal nodes (most probable common ancestor sequence associated with the divergence between and within phylogenetic groups) and leaf nodes (represented by different isolates). Analysis was conducted using the algorithm MEME. Results were saved in json format and visualized in the MEME analysis result visualization tool (https://observablehq.com/@spond/meme, accessed on 25 October 2024).
Viruses 16 01911 g004
Figure 5. Detection of epistasis/co-evolution in R298L. (A) Pairs of co-evolving sites identified by BMG analysis (posterior probability cutoff 0.5). P [Site 1 –> Site 2] indicates the probability of site 2 to be conditionally dependent on site 1. P [Site 2 –> Site 1] indicates the probability of site 1 to be conditionally dependent on site 2. P [Site 1 <–> Site 2] indicates the probability that sites 1 and 2 are not conditionally independent. Ancestral reconstruction analysis using MEME was conducted to show the evolutionary dynamics of pairs of co-evolving sites 114–137 (B) and 238–256 (C). For each phylogenetic tree, the predicted amino acid sequences at internal nodes are shown (most probable common ancestor sequence associated with the divergence between and within phylogenetic groups) and leaf nodes (represented by different isolates). Phylogenetic trees were obtained using the MEME analysis result visualization tool (https://observablehq.com/@spond/meme, accessed on 25 October 2024).
Figure 5. Detection of epistasis/co-evolution in R298L. (A) Pairs of co-evolving sites identified by BMG analysis (posterior probability cutoff 0.5). P [Site 1 –> Site 2] indicates the probability of site 2 to be conditionally dependent on site 1. P [Site 2 –> Site 1] indicates the probability of site 1 to be conditionally dependent on site 2. P [Site 1 <–> Site 2] indicates the probability that sites 1 and 2 are not conditionally independent. Ancestral reconstruction analysis using MEME was conducted to show the evolutionary dynamics of pairs of co-evolving sites 114–137 (B) and 238–256 (C). For each phylogenetic tree, the predicted amino acid sequences at internal nodes are shown (most probable common ancestor sequence associated with the divergence between and within phylogenetic groups) and leaf nodes (represented by different isolates). Phylogenetic trees were obtained using the MEME analysis result visualization tool (https://observablehq.com/@spond/meme, accessed on 25 October 2024).
Viruses 16 01911 g005
Figure 6. Expression of ASFV gene R298L in swine macrophages infected with ASFV-G. Reverse transcription qPCR was performed to assess the expression of the R298L gene at different time points post infection. Results obtained using specific qPCRs to detect the expression of ASFV genes encoding early protein p30 and late protein p72 are used as references. Transcription levels of different ASFV genes are expressed as relative quantities of mRNA accumulation (estimated by 2−ΔΔCt). Values are expressed in log10. Dashed line reflects the background (≤1.26 log10 2−ΔΔCt) associated with potential traces of DNA contamination after treatment of the RNA samples with DNase I.
Figure 6. Expression of ASFV gene R298L in swine macrophages infected with ASFV-G. Reverse transcription qPCR was performed to assess the expression of the R298L gene at different time points post infection. Results obtained using specific qPCRs to detect the expression of ASFV genes encoding early protein p30 and late protein p72 are used as references. Transcription levels of different ASFV genes are expressed as relative quantities of mRNA accumulation (estimated by 2−ΔΔCt). Values are expressed in log10. Dashed line reflects the background (≤1.26 log10 2−ΔΔCt) associated with potential traces of DNA contamination after treatment of the RNA samples with DNase I.
Viruses 16 01911 g006
Figure 7. Schematic for the development of ASFV-G-∆R298L. The recombinant vector, containing the mCherry reporter gene under the ASFV p72 promoter activity and the gene positions are shown. The nucleotide positions of the area that was deleted in the ASFV-G genome are indicated by the dashed lines. The resulting ASFV-G-∆R298L virus with the cassette inserted is shown on the bottom.
Figure 7. Schematic for the development of ASFV-G-∆R298L. The recombinant vector, containing the mCherry reporter gene under the ASFV p72 promoter activity and the gene positions are shown. The nucleotide positions of the area that was deleted in the ASFV-G genome are indicated by the dashed lines. The resulting ASFV-G-∆R298L virus with the cassette inserted is shown on the bottom.
Viruses 16 01911 g007
Figure 8. In vitro growth kinetics in primary swine macrophage cell cultures for ASFV-G-∆R298L and parental ASFV-G (MOI = 0.01). Data represent means and standard deviations of two replicas. Sensitivity using this methodology for detecting virus is ≥log101.8 HAD50/mL.
Figure 8. In vitro growth kinetics in primary swine macrophage cell cultures for ASFV-G-∆R298L and parental ASFV-G (MOI = 0.01). Data represent means and standard deviations of two replicas. Sensitivity using this methodology for detecting virus is ≥log101.8 HAD50/mL.
Viruses 16 01911 g008
Figure 9. Evolution of body temperature in animals (5 animals/group) IM infected with 102 HAD50 of either ASFV-G-∆R298L or parental ASFV-G.
Figure 9. Evolution of body temperature in animals (5 animals/group) IM infected with 102 HAD50 of either ASFV-G-∆R298L or parental ASFV-G.
Viruses 16 01911 g009
Figure 10. Evolution of mortality in animals IM infected with 102 HAD50 of either ASFV-G-∆R298L or parental virulent ASFV-G.
Figure 10. Evolution of mortality in animals IM infected with 102 HAD50 of either ASFV-G-∆R298L or parental virulent ASFV-G.
Viruses 16 01911 g010
Figure 11. Viremia titers detected in pigs IM inoculated with 102 HAD50 of either ASFV-G-∆R298L or ASFV-G. Each symbol represents individual viremia titers in each animal in the groups. Sensitivity of virus detection: ≥log10 1.8 TCID50/mL.
Figure 11. Viremia titers detected in pigs IM inoculated with 102 HAD50 of either ASFV-G-∆R298L or ASFV-G. Each symbol represents individual viremia titers in each animal in the groups. Sensitivity of virus detection: ≥log10 1.8 TCID50/mL.
Viruses 16 01911 g011
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Ramirez-Medina, E.; Velazquez-Salinas, L.; Valladares, A.; Silva, E.; Burton, L.; Gladue, D.P.; Borca, M.V. Assessment of the Effect of Deleting the African Swine Fever Virus Gene R298L on Virus Replication and Virulence of the Georgia2010 Isolate. Viruses 2024, 16, 1911. https://doi.org/10.3390/v16121911

AMA Style

Ramirez-Medina E, Velazquez-Salinas L, Valladares A, Silva E, Burton L, Gladue DP, Borca MV. Assessment of the Effect of Deleting the African Swine Fever Virus Gene R298L on Virus Replication and Virulence of the Georgia2010 Isolate. Viruses. 2024; 16(12):1911. https://doi.org/10.3390/v16121911

Chicago/Turabian Style

Ramirez-Medina, Elizabeth, Lauro Velazquez-Salinas, Alyssa Valladares, Ediane Silva, Leeanna Burton, Douglas P. Gladue, and Manuel V. Borca. 2024. "Assessment of the Effect of Deleting the African Swine Fever Virus Gene R298L on Virus Replication and Virulence of the Georgia2010 Isolate" Viruses 16, no. 12: 1911. https://doi.org/10.3390/v16121911

APA Style

Ramirez-Medina, E., Velazquez-Salinas, L., Valladares, A., Silva, E., Burton, L., Gladue, D. P., & Borca, M. V. (2024). Assessment of the Effect of Deleting the African Swine Fever Virus Gene R298L on Virus Replication and Virulence of the Georgia2010 Isolate. Viruses, 16(12), 1911. https://doi.org/10.3390/v16121911

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop