Innate Immune Response Against Batai Virus, Bunyamwera Virus, and Their Reassortants
Abstract
1. Introduction
2. Materials and Methods
2.1. Cell Culture
2.2. Differentiation of Murine BMDCs and Human DCs
2.3. Flow Cytometry Assay
2.4. Viruses Culture and Infection of Mammalian Cells
2.5. Viral Growth
2.6. RNA Extraction
2.7. Sequencing Analysis of Differential Expression and GO Term Enrichment
2.8. qRT-PCR, qPCR and Gene Expression Calculation
2.9. Data Visualization
2.10. Statistical Analyses
3. Results
3.1. Transcriptomic Analysis of OBV-Infected Murine BMDCs
3.2. Interspecies Differences of Innate Immunity Markers After OBV Infection
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Appendix A
Primer Name | Gene | Sequence (5′ to 3′) | Size (bp) | Gene Bank | Reference |
---|---|---|---|---|---|
OSM_1049 | Actb_fwd | GAGGCTCTCTTCCAGCCTTC | 98 | XM_060405599.1 | This study |
OSM_1050 | Actb_rev | CGTAGAGGTCCTTGCGGATG | |||
OSM_1041 | Ifna_fwd | GTGAGGAAATACTTCCACAGACTCACT | 107 | EU276064 | [101] |
OSM_1042 | Ifna_rev | TGARGAAGAGAAGGCTCTCATGA | |||
OSM_1056 | Ifnb2_fwd | AACAAAGGCGGAGCTCTGTGG | 97 | XM_004004400.6 | This study |
OSM_1057 | Ifnb2_rev | GGCATCTGGAAGTCCATCCTGAAC | |||
OSM_1047 | Isg15_fwd | AGGTGAAGATGCTAGGGGGC | 85 | NM_001009735.1 | This study |
OSM_1048 | Isg15_rev | TGGGCGATGAACTGCTTCAG | |||
OSM_1045 | Isg20_fwd | CAGTAGCTGAGAAAGGGGCAT | 99 | XM_027957054.3 | This study |
OSM_1046 | Isg20_rev | CTCACAGTCCATGGCTACCAC | |||
OSM_1037 | Cxcl9_fwd | GGAGTTCAAGGAATCCCAGCA | 120 | XM_004009924.6 | [102] |
OSM_1038 | Cxcl9_rev | ACAAGTAGGGCTTGGAGCAA | |||
OSM_1082 | Cxcl11_fwd | CCCAAGTCAAAGCAAGCAAAAGC | 91 | XM_027971095.3 | This study |
OSM_1083 | Cxcl11_rev | AGTCACAGTTACACTTGTTCTAGGT | |||
OSM_1039 | Cfh_fwd | CGGTGTCAGGCCTACTATGAACT | 71 | EU888587 | [103] |
OSM_1040 | Cfh_rev | GGTTCTGACCACTCTCCATTCC |
References
- O’Connor, T.W.; Hick, P.M.; Finlaison, D.S.; Kirkland, P.D.; Toribio, J. Revisiting the Importance of Orthobunyaviruses for Animal Health: A Scoping Review of Livestock Disease, Diagnostic Tests, and Surveillance Strategies for the Simbu Serogroup. Viruses 2024, 16, 294. [Google Scholar] [CrossRef] [PubMed]
- Windhaber, S.; Xin, Q.; Lozach, P.Y. Orthobunyaviruses: From Virus Binding to Penetration into Mammalian Host Cells. Viruses 2021, 13, 872. [Google Scholar] [CrossRef] [PubMed]
- Elliott, R.M. Orthobunyaviruses: Recent genetic and structural insights. Nat. Rev. Microbiol. 2014, 12, 673–685. [Google Scholar] [CrossRef] [PubMed]
- Girard, M.; Nelson, C.B.; Picot, V.; Gubler, D.J. Arboviruses: A global public health threat. Vaccine 2020, 38, 3989–3994. [Google Scholar] [CrossRef] [PubMed]
- Boruah, A.P.; Thakur, K.T. Arthropod-borne encephalitis: An overview for the clinician and emerging considerations. Postgrad. Med. J. 2023, 99, 826–833. [Google Scholar] [CrossRef]
- McDonald, E.; Martin, S.W.; Landry, K.; Gould, C.V.; Lehman, J.; Fischer, M.; Lindsey, N.P. West Nile Virus and Other Domestic Nationally Notifiable Arboviral Diseases—United States, 2018. MMWR Morb. Mortal Wkly. Rep. 2019, 68, 673–678. [Google Scholar] [CrossRef]
- Travassos da Rosa, J.F.; de Souza, W.M.; Pinheiro, F.P.; Figueiredo, M.L.; Cardoso, J.F.; Acrani, G.O.; Nunes, M.R.T. Oropouche Virus: Clinical, Epidemiological, and Molecular Aspects of a Neglected Orthobunyavirus. Am. J. Trop. Med. Hyg. 2017, 96, 1019–1030. [Google Scholar] [CrossRef]
- Moreira, H.M.; Sgorlon, G.; Queiroz, J.A.S.; Roca, T.P.; Ribeiro, J.; Teixeira, K.S.; Passos-Silva, A.M.; Araujo, A.; Gasparelo, N.W.F.; Dos Santos Ad, O.; et al. Outbreak of Oropouche virus in frontier regions in western Amazon. Microbiol. Spectr. 2024, 12, e0162923. [Google Scholar] [CrossRef]
- Kulkarni, M.A.; Berrang-Ford, L.; Buck, P.A.; Drebot, M.A.; Lindsay, L.R.; Ogden, N.H. Major emerging vector-borne zoonotic diseases of public health importance in Canada. Emerg. Microbes Infect. 2015, 4, e33. [Google Scholar] [CrossRef]
- Beer, M.; Conraths, F.J.; van der Poel, W.H. ‘Schmallenberg virus’—A novel orthobunyavirus emerging in Europe. Epidemiol. Infect. 2013, 141, 1–8. [Google Scholar] [CrossRef]
- Zhao, L.; Luo, H.; Huang, D.; Yu, P.; Dong, Q.; Mwaliko, C.; Atoni, E.; Nyaruaba, R.; Yuan, J.; Zhang, G.; et al. Pathogenesis and Immune Response of Ebinur Lake Virus: A Newly Identified Orthobunyavirus That Exhibited Strong Virulence in Mice. Front. Microbiol. 2020, 11, 625661. [Google Scholar] [CrossRef] [PubMed]
- Mohamed, M.; Azmi, M.A.; Sani, N.I.; Gilbert, G.; Reduan, M.F.H. Molecular identification and in vitro assessment of zoonotic-potential of a novel Orthobunyavirus isolated from broiler chicken in Malaysia. Trop. Biomed. 2023, 40, 194–198. [Google Scholar] [CrossRef]
- Hoffmann, B.; Scheuch, M.; Hoper, D.; Jungblut, R.; Holsteg, M.; Schirrmeier, H.; Eschbaumer, M.; Goller, K.V.; Wernike, K.; Fischer, M.; et al. Novel orthobunyavirus in Cattle, Europe, 2011. Emerg. Infect. Dis. 2012, 18, 469–472. [Google Scholar] [CrossRef] [PubMed]
- Hontz, R.D.; Guevara, C.; Halsey, E.S.; Silvas, J.; Santiago, F.W.; Widen, S.G.; Wood, T.G.; Casanova, W.; Vasilakis, N.; Watts, D.M.; et al. Itaya virus, a Novel Orthobunyavirus Associated with Human Febrile Illness, Peru. Emerg. Infect. Dis. 2015, 21, 781–788. [Google Scholar] [CrossRef] [PubMed]
- Edridge, A.W.D.; Deijs, M.; Namazzi, R.; Cristella, C.; Jebbink, M.F.; Maurer, I.; Kootstra, N.A.; Buluma, L.R.; van Woensel, J.B.M.; de Jong, M.D.; et al. Novel Orthobunyavirus Identified in the Cerebrospinal Fluid of a Ugandan Child with Severe Encephalopathy. Clin. Infect. Dis. 2019, 68, 139–142. [Google Scholar] [CrossRef]
- Aguilar, P.V.; Barrett, A.D.; Saeed, M.F.; Watts, D.M.; Russell, K.; Guevara, C.; Ampuero, J.S.; Suarez, L.; Cespedes, M.; Montgomery, J.M.; et al. Iquitos virus: A novel reassortant Orthobunyavirus associated with human illness in Peru. PLoS Negl. Trop. Dis. 2011, 5, e1315. [Google Scholar] [CrossRef]
- Soniya, K.; Yadav, S.; Boora, S.; Kaushik, S.; Yadav, J.P.; Kaushik, S. The Cat Que Virus: A resurfacing orthobunyavirus could lead to epidemics. Virusdisease 2021, 32, 635–641. [Google Scholar] [CrossRef]
- Barker, J.; daSilva, L.L.P.; Crump, C.M. Mechanisms of bunyavirus morphogenesis and egress. J. Gen. Virol. 2023, 104, 001845. [Google Scholar] [CrossRef]
- Kapuscinski, M.L.; Bergren, N.A.; Russell, B.J.; Lee, J.S.; Borland, E.M.; Hartman, D.A.; King, D.C.; Hughes, H.R.; Burkhalter, K.L.; Kading, R.C.; et al. Genomic characterization of 99 viruses from the bunyavirus families Nairoviridae, Peribunyaviridae, and Phenuiviridae, including 35 previously unsequenced viruses. PLoS Pathog. 2021, 17, e1009315. [Google Scholar] [CrossRef]
- McDonald, S.M.; Nelson, M.I.; Turner, P.E.; Patton, J.T. Reassortment in segmented RNA viruses: Mechanisms and outcomes. Nat. Rev. Microbiol. 2016, 14, 448–460. [Google Scholar] [CrossRef]
- Wesselmann, K.M.; Postigo-Hidalgo, I.; Pezzi, L.; de Oliveira-Filho, E.F.; Fischer, C.; de Lamballerie, X.; Drexler, J.F. Emergence of Oropouche fever in Latin America: A narrative review. Lancet Infect. Dis. 2024, 24, e439–e452. [Google Scholar] [CrossRef] [PubMed]
- Yanase, T.; Kato, T.; Aizawa, M.; Shuto, Y.; Shirafuji, H.; Yamakawa, M.; Tsuda, T. Genetic reassortment between Sathuperi and Shamonda viruses of the genus Orthobunyavirus in nature: Implications for their genetic relationship to Schmallenberg virus. Arch. Virol. 2012, 157, 1611–1616. [Google Scholar] [CrossRef] [PubMed]
- Gerrard, S.R.; Li, L.; Barrett, A.D.; Nichol, S.T. Ngari virus is a Bunyamwera virus reassortant that can be associated with large outbreaks of hemorrhagic fever in Africa. J. Virol. 2004, 78, 8922–8926. [Google Scholar] [CrossRef] [PubMed]
- Briese, T.; Bird, B.; Kapoor, V.; Nichol, S.T.; Lipkin, W.I. Batai and Ngari viruses: M segment reassortment and association with severe febrile disease outbreaks in East Africa. J. Virol. 2006, 80, 5627–5630. [Google Scholar] [CrossRef]
- Dutuze, M.F.; Nzayirambaho, M.; Mores, C.N.; Christofferson, R.C. A Review of Bunyamwera, Batai, and Ngari Viruses: Understudied Orthobunyaviruses With Potential One Health Implications. Front. Vet. Sci. 2018, 5, 69. [Google Scholar] [CrossRef]
- Tauro, L.B.; Rivarola, M.E.; Lucca, E.; Marino, B.; Mazzini, R.; Cardoso, J.F.; Barrandeguy, M.E.; Teixeira Nunes, M.R.; Contigiani, M.S. First isolation of Bunyamwera virus (Bunyaviridae family) from horses with neurological disease and an abortion in Argentina. Vet. J. 2015, 206, 111–114. [Google Scholar] [CrossRef]
- Cichon, N.; Eiden, M.; Schulz, J.; Gunther, A.; Wysocki, P.; Holicki, C.M.; Borgwardt, J.; Gaede, W.; Groschup, M.H.; Ziegler, U. Serological and Molecular Investigation of Batai Virus Infections in Ruminants from the State of Saxony-Anhalt, Germany, 2018. Viruses 2021, 13, 370. [Google Scholar] [CrossRef]
- Ziegler, U.; Groschup, M.H.; Wysocki, P.; Press, F.; Gehrmann, B.; Fast, C.; Gaede, W.; Scheuch, D.E.; Eiden, M. Seroprevalance of Batai virus in ruminants from East Germany. Vet. Microbiol. 2018, 227, 97–102. [Google Scholar] [CrossRef]
- Hubalek, Z. Mosquito-borne viruses in Europe. Parasitol. Res. 2008, 103 (Suppl. S1), S29–S43. [Google Scholar] [CrossRef]
- Jo, W.K.; Pfankuche, V.M.; Lehmbecker, A.; Martina, B.; Rubio-Garcia, A.; Becker, S.; Kruppa, J.; Jung, K.; Klotz, D.; Metzger, J.; et al. Association of Batai Virus Infection and Encephalitis in Harbor Seals, Germany, 2016. Emerg. Infect. Dis. 2018, 24, 1691–1695. [Google Scholar] [CrossRef]
- Blakqori, G.; van Knippenberg, I.; Elliott, R.M. Bunyamwera orthobunyavirus S-segment untranslated regions mediate poly(A) tail-independent translation. J. Virol. 2009, 83, 3637–3646. [Google Scholar] [CrossRef] [PubMed]
- Bridgen, A.; Weber, F.; Fazakerley, J.K.; Elliott, R.M. Bunyamwera bunyavirus nonstructural protein NSs is a nonessential gene product that contributes to viral pathogenesis. Proc. Natl. Acad. Sci. USA 2001, 98, 664–669. [Google Scholar] [CrossRef] [PubMed]
- Carlton-Smith, C.; Elliott, R.M. Viperin, MTAP44, and protein kinase R contribute to the interferon-induced inhibition of Bunyamwera Orthobunyavirus replication. J. Virol. 2012, 86, 11548–11557. [Google Scholar] [CrossRef] [PubMed]
- Charlton, F.W.; Hover, S.; Fuller, J.; Hewson, R.; Fontana, J.; Barr, J.N.; Mankouri, J. Cellular cholesterol abundance regulates potassium accumulation within endosomes and is an important determinant in bunyavirus entry. J. Biol. Chem. 2019, 294, 7335–7347. [Google Scholar] [CrossRef] [PubMed]
- Feng, J.; Wickenhagen, A.; Turnbull, M.L.; Rezelj, V.V.; Kreher, F.; Tilston-Lunel, N.L.; Slack, G.S.; Brennan, B.; Koudriakova, E.; Shaw, A.E.; et al. Interferon-Stimulated Gene (ISG)-Expression Screening Reveals the Specific Antibunyaviral Activity of ISG20. J. Virol. 2018, 92, 10-1128. [Google Scholar] [CrossRef]
- Hover, S.; King, B.; Hall, B.; Loundras, E.A.; Taqi, H.; Daly, J.; Dallas, M.; Peers, C.; Schnettler, E.; McKimmie, C.; et al. Modulation of Potassium Channels Inhibits Bunyavirus Infection. J. Biol. Chem. 2016, 291, 3411–3422. [Google Scholar] [CrossRef]
- Kohl, A.; Clayton, R.F.; Weber, F.; Bridgen, A.; Randall, R.E.; Elliott, R.M. Bunyamwera virus nonstructural protein NSs counteracts interferon regulatory factor 3-mediated induction of early cell death. J. Virol. 2003, 77, 7999–8008. [Google Scholar] [CrossRef]
- Leonard, V.H.; Kohl, A.; Hart, T.J.; Elliott, R.M. Interaction of Bunyamwera Orthobunyavirus NSs protein with mediator protein MED8: A mechanism for inhibiting the interferon response. J. Virol. 2006, 80, 9667–9675. [Google Scholar] [CrossRef]
- Li, M. Innate immune response against vector-borne bunyavirus infection and viral countermeasures. Front. Cell Infect. Microbiol. 2024, 14, 1365221. [Google Scholar] [CrossRef]
- Schoen, A.; Weber, F. Orthobunyaviruses and innate immunity induction: AlieNSs vs. PredatoRRs. Eur. J. Cell Biol. 2015, 94, 384–390. [Google Scholar] [CrossRef]
- Streitenfeld, H.; Boyd, A.; Fazakerley, J.K.; Bridgen, A.; Elliott, R.M.; Weber, F. Activation of PKR by Bunyamwera virus is independent of the viral interferon antagonist NSs. J. Virol. 2003, 77, 5507–5511. [Google Scholar] [CrossRef] [PubMed]
- Thomas, D.; Blakqori, G.; Wagner, V.; Banholzer, M.; Kessler, N.; Elliott, R.M.; Haller, O.; Weber, F. Inhibition of RNA polymerase II phosphorylation by a viral interferon antagonist. J. Biol. Chem. 2004, 279, 31471–31477. [Google Scholar] [CrossRef] [PubMed]
- Weber, F.; Bridgen, A.; Fazakerley, J.K.; Streitenfeld, H.; Kessler, N.; Randall, R.E.; Elliott, R.M. Bunyamwera bunyavirus nonstructural protein NSs counteracts the induction of alpha/beta interferon. J. Virol. 2002, 76, 7949–7955. [Google Scholar] [CrossRef] [PubMed]
- Lu, Z.; Yan, X.; Fan, G.; Li, L.; Sun, X.; Lu, H.; Jin, N.; Liu, H.; Sun, W. Molecular and serological investigations of Batai virus in cattle and goats in the border area of Yunnan, China (2021–2022). Front. Vet. Sci. 2024, 11, 1433699. [Google Scholar] [CrossRef]
- Hofmann, M.; Wietholter, A.; Blaha, I.; Jost, H.; Heinemann, P.; Lehmann, M.; Miller, T.; Cadar, D.; Yanase, T.; Kley, N.; et al. Surveillance of Batai virus in bovines from Germany. Clin. Vaccine Immunol. 2015, 22, 672–673. [Google Scholar] [CrossRef]
- Lambert, A.J.; Huhtamo, E.; Di Fatta, T.; De Andrea, M.; Borella, A.; Vapalahti, O.; Kosoy, O.; Ravanini, P. Serological evidence of Batai virus infections, bovines, northern Italy, 2011. Vector Borne Zoonotic. Dis. 2014, 14, 688–689. [Google Scholar] [CrossRef]
- Dutuze, M.F.; Mayton, E.H.; Macaluso, J.D.; Christofferson, R.C. Comparative characterization of the reassortant Orthobunyavirus Ngari with putative parental viruses, Bunyamwera and Batai: In vitro characterization and ex vivo stability. J. Gen. Virol. 2021, 102, 001523. [Google Scholar] [CrossRef]
- Mansfield, K.L.; Folly, A.J.; Hernandez-Triana, L.M.; Sewgobind, S.; Johnson, N. Batai Orthobunyavirus: An Emerging Mosquito-Borne Virus in Europe. Viruses 2022, 14, 1868. [Google Scholar] [CrossRef]
- Heitmann, A.; Gusmag, F.; Rathjens, M.G.; Maurer, M.; Frankze, K.; Schicht, S.; Jansen, S.; Schmidt-Chanasit, J.; Jung, K.; Becker, S.C. Mammals Preferred: Reassortment of Batai and Bunyamwera orthobunyavirus Occurs in Mammalian but Not Insect Cells. Viruses 2021, 13, 1702. [Google Scholar] [CrossRef]
- Zal, T.; Volkmann, A.; Stockinger, B. Mechanisms of tolerance induction in major histocompatibility complex class II-restricted T cells specific for a blood-borne self-antigen. J. Exp. Med. 1994, 180, 2089–2099. [Google Scholar] [CrossRef]
- Holken, J.M.; Teusch, N. The Monocytic Cell Line THP-1 as a Validated and Robust Surrogate Model for Human Dendritic Cells. Int. J. Mol. Sci. 2023, 24, 1452. [Google Scholar] [CrossRef] [PubMed]
- Jost, H.; Bialonski, A.; Schmetz, C.; Gunther, S.; Becker, N.; Schmidt-Chanasit, J. Isolation and phylogenetic analysis of Batai virus, Germany. Am. J. Trop. Med. Hyg. 2011, 84, 241–243. [Google Scholar] [CrossRef] [PubMed]
- Smithburn, K.C.; Haddow, A.J.; Mahaffy, A.F. A neurotropic virus isolated from Aedes mosquitoes caught in the Semliki forest. Am. J. Trop. Med. Hyg. 1946, 26, 189–208. [Google Scholar] [CrossRef] [PubMed]
- Reed, L.J.; Muench, H. A Simple Method of Estimating Fifty Per Cent Endpoints12. Am. J. Epidemiol. 1938, 27, 493–497. [Google Scholar] [CrossRef]
- Andrews, S. FastQC: A Quality Control Tool for High Throughput Sequence Data. 2010. Available online: https://www.bioinformatics.babraham.ac.uk/projects/fastqc/ (accessed on 31 July 2024).
- Dobin, A.; Davis, C.A.; Schlesinger, F.; Drenkow, J.; Zaleski, C.; Jha, S.; Batut, P.; Chaisson, M.; Gingeras, T.R. STAR: Ultrafast universal RNA-seq aligner. Bioinformatics 2013, 29, 15–21. [Google Scholar] [CrossRef]
- Love, M.I.; Huber, W.; Anders, S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol. 2014, 15, 550. [Google Scholar] [CrossRef]
- Benjamini, Y.; Hochberg, Y. Controlling the False Discovery Rate: A Practical and Powerful Approach to Multiple Testing. J. R. Stat. Soc. Series B Stat. Methodol. 1995, 57, 289–300. [Google Scholar] [CrossRef]
- Yu, G.; Wang, L.G.; Han, Y.; He, Q.Y. clusterProfiler: An R package for comparing biological themes among gene clusters. OMICS 2012, 16, 284–287. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Wickam, H. Ggplot2: Elegant Graphics for Data Analysis; Springer: Berlin/Heidelberg, Germany, 2016; Volume 16, p. 2021. [Google Scholar]
- Blighe, K.; Rana, S.; Lewis, M. EnhancedVolcano: Publication-Ready Volcano Plots with Enhanced Colouring and Labeling; R package Version 1.21.0. 2018. Available online: https://github.com/kevinblighe/EnhancedVolcano (accessed on 19 September 2024).
- Kolde, R. Pheatmap: Pretty Heatmaps. R Package Version 1.0.12. 2019. Available online: https://CRAN.R-project.org/package=pheatmap (accessed on 19 September 2024).
- Kassambara, A. Ggpubr: ‘Ggplot2′ Based Publication Ready Plots, R Package Version 0.6.0. 2023. Available online: https://rpkgs.datanovia.com/ggpubr/ (accessed on 19 September 2024).
- Kassambara, A. Rstatix: Pipe-Friendly Framework for Basic Statistical Tests, R Package Version 0.7.2. 2023. Available online: https://CRAN.R-project.org/package=rstatix (accessed on 19 September 2024).
- Livonesi, M.C.; de Sousa, R.L.; Badra, S.J.; Figueiredo, L.T. In vitro and in vivo studies of the Interferon-alpha action on distinct Orthobunyavirus. Antiviral Res. 2007, 75, 121–128. [Google Scholar] [CrossRef]
- Elliott, R.M.; Weber, F. Bunyaviruses and the type I interferon system. Viruses 2009, 1, 1003–1021. [Google Scholar] [CrossRef] [PubMed]
- Blakqori, G.; Delhaye, S.; Habjan, M.; Blair, C.D.; Sanchez-Vargas, I.; Olson, K.E.; Attarzadeh-Yazdi, G.; Fragkoudis, R.; Kohl, A.; Kalinke, U.; et al. La Crosse bunyavirus nonstructural protein NSs serves to suppress the type I interferon system of mammalian hosts. J. Virol. 2007, 81, 4991–4999. [Google Scholar] [CrossRef] [PubMed]
- Kraatz, F.; Wernike, K.; Hechinger, S.; Konig, P.; Granzow, H.; Reimann, I.; Beer, M. Deletion mutants of Schmallenberg virus are avirulent and protect from virus challenge. J. Virol. 2015, 89, 1825–1837. [Google Scholar] [CrossRef] [PubMed]
- Nair, N.; Osterhaus, A.; Rimmelzwaan, G.F.; Prajeeth, C.K. Rift Valley Fever Virus-Infection, Pathogenesis and Host Immune Responses. Pathogens 2023, 12, 1174. [Google Scholar] [CrossRef] [PubMed]
- Dunlop, J.I.; Szemiel, A.M.; Navarro, A.; Wilkie, G.S.; Tong, L.; Modha, S.; Mair, D.; Sreenu, V.B.; Da Silva Filipe, A.; Li, P.; et al. Development of reverse genetics systems and investigation of host response antagonism and reassortment potential for Cache Valley and Kairi viruses, two emerging orthobunyaviruses of the Americas. PLoS Negl. Trop. Dis. 2018, 12, e0006884. [Google Scholar] [CrossRef]
- Leventhal, S.S.; Wilson, D.; Feldmann, H.; Hawman, D.W. A Look into Bunyavirales Genomes: Functions of Non-Structural (NS) Proteins. Viruses 2021, 13, 314. [Google Scholar] [CrossRef]
- Ishihara, Y.; Shioda, C.; Bangphoomi, N.; Sugiura, K.; Saeki, K.; Tsuda, S.; Iwanaga, T.; Takenaka-Uema, A.; Kato, K.; Murakami, S.; et al. Akabane virus nonstructural protein NSm regulates viral growth and pathogenicity in a mouse model. J. Vet. Med. Sci. 2016, 78, 1391–1397. [Google Scholar] [CrossRef]
- Prescott, J.B.; Marzi, A.; Safronetz, D.; Robertson, S.J.; Feldmann, H.; Best, S.M. Immunobiology of Ebola and Lassa virus infections. Nat. Rev. Immunol. 2017, 17, 195–207. [Google Scholar] [CrossRef]
- Zong, L.; Yang, F.; Liu, S.; Gao, Y.; Xia, F.; Zheng, M.; Xu, Y. CD8(+) T cells mediate antiviral response in severe fever with thrombocytopenia syndrome. FASEB J. 2023, 37, e22722. [Google Scholar] [CrossRef]
- Bailey-Elkin, B.A.; van Kasteren, P.B.; Snijder, E.J.; Kikkert, M.; Mark, B.L. Viral OTU deubiquitinases: A structural and functional comparison. PLoS Pathog. 2014, 10, e1003894. [Google Scholar] [CrossRef]
- Capodagli, G.C.; McKercher, M.A.; Baker, E.A.; Masters, E.M.; Brunzelle, J.S.; Pegan, S.D. Structural analysis of a viral ovarian tumor domain protease from the Crimean-Congo hemorrhagic fever virus in complex with covalently bonded ubiquitin. J. Virol. 2011, 85, 3621–3630. [Google Scholar] [CrossRef] [PubMed]
- Fan, Y.; Sanyal, S.; Bruzzone, R. Breaking Bad: How Viruses Subvert the Cell Cycle. Front. Cell Infect. Microbiol. 2018, 8, 396. [Google Scholar] [CrossRef] [PubMed]
- Pacheco, B.; Fernandez-Oliva, A.; Garcia-Serradilla, M.; Risco, C. Digoxin is a potent inhibitor of Bunyamwera virus infection in cell culture. J. Gen. Virol. 2023, 104, 001838. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Q.; Jia, Q.; Gao, W.; Zhang, W. The Role of Deubiquitinases in Virus Replication and Host Innate Immune Response. Front. Microbiol. 2022, 13, 839624. [Google Scholar] [CrossRef] [PubMed]
- Melchjorsen, J.; Sorensen, L.N.; Paludan, S.R. Expression and function of chemokines during viral infections: From molecular mechanisms to in vivo function. J. Leukoc. Biol. 2003, 74, 331–343. [Google Scholar] [CrossRef]
- Morotti, A.; Phuah, C.L.; Anderson, C.D.; Jessel, M.J.; Schwab, K.; Ayres, A.M.; Pezzini, A.; Padovani, A.; Gurol, M.E.; Viswanathan, A.; et al. Leukocyte Count and Intracerebral Hemorrhage Expansion. Stroke 2016, 47, 1473–1478. [Google Scholar] [CrossRef]
- Bastug, A.; Kayaaslan, B.; Kazancioglu, S.; Aslaner, H.; But, A.; Akinci, E.; Yetkin, M.A.; Eren, S.; Bodur, H. Crimean-Congo Hemorrhagic Fever: Prognostic Factors and the Association of Leukocyte Counts with Mortality. Jpn. J. Infect. Dis. 2016, 69, 51–55. [Google Scholar] [CrossRef]
- Barry, G.; Varela, M.; Ratinier, M.; Blomstrom, A.L.; Caporale, M.; Seehusen, F.; Hahn, K.; Schnettler, E.; Baumgartner, W.; Kohl, A.; et al. NSs protein of Schmallenberg virus counteracts the antiviral response of the cell by inhibiting its transcriptional machinery. J. Gen. Virol. 2014, 95, 1640–1646. [Google Scholar] [CrossRef]
- Mukherjee, P.; Woods, T.A.; Moore, R.A.; Peterson, K.E. Activation of the innate signaling molecule MAVS by bunyavirus infection upregulates the adaptor protein SARM1, leading to neuronal death. Immunity 2013, 38, 705–716. [Google Scholar] [CrossRef]
- Harris, K.A.; Eglin, R.D.; Hayward, S.; Milnes, A.; Davies, I.; Cook, A.J.; Downs, S.H. Impact of Schmallenberg virus on British sheep farms during the 2011/2012 lambing season. Vet. Rec. 2014, 175, 172. [Google Scholar] [CrossRef]
- Kim, Y.H.; Kweon, C.H.; Tark, D.S.; Lim, S.I.; Yang, D.K.; Hyun, B.H.; Song, J.Y.; Hur, W.; Park, S.C. Development of inactivated trivalent vaccine for the teratogenic Aino, Akabane and Chuzan viruses. Biologicals 2011, 39, 152–157. [Google Scholar] [CrossRef] [PubMed]
- Wani, S.A.; Praharaj, M.R.; Sahu, A.R.; Khan, R.I.N.; Saxena, S.; Rajak, K.K.; Muthuchelvan, D.; Sahoo, A.; Mishra, B.; Singh, R.K.; et al. Systems Biology behind Immunoprotection of Both Sheep and Goats after Sungri/96 PPRV Vaccination. mSystems 2021, 6, e00820-20. [Google Scholar] [CrossRef] [PubMed]
- Schneider, W.M.; Chevillotte, M.D.; Rice, C.M. Interferon-stimulated genes: A complex web of host defenses. Annu. Rev. Immunol. 2014, 32, 513–545. [Google Scholar] [CrossRef] [PubMed]
- Ashley, R.L.; Henkes, L.E.; Bouma, G.J.; Pru, J.K.; Hansen, T.R. Deletion of the Isg15 gene results in up-regulation of decidual cell survival genes and down-regulation of adhesion genes: Implication for regulation by IL-1beta. Endocrinology 2010, 151, 4527–4536. [Google Scholar] [CrossRef] [PubMed]
- Henkes, L.; Pru, J.; Hansen, T. Pregnancy loss in IsG15 null mice is a maternal phenotype that is manifest during implantation. Biol. Reprod. 2007, 77, 102–103. [Google Scholar] [CrossRef]
- Domingues, R.R.; Andrade, J.P.N.; Cunha, T.O.; Madureira, G.; Hoppman, A.S.; Teixeira, N.N.; Monteiro, P.L.J.; Gomez-Leon, V.H.; Martins, J.P.N.; Wiltbank, M.C. Profiles of interferon-stimulated genes in multiple tissues and circulating pregnancy-associated glycoproteins and their association with pregnancy loss in dairy cowsdagger. Biol. Reprod. 2024, 110, 558–568. [Google Scholar] [CrossRef]
- Bocharov, G.; Ludewig, B.; Bertoletti, A.; Klenerman, P.; Junt, T.; Krebs, P.; Luzyanina, T.; Fraser, C.; Anderson, R.M. Underwhelming the immune response: Effect of slow virus growth on CD8+-T-lymphocyte responses. J. Virol. 2004, 78, 2247–2254. [Google Scholar] [CrossRef]
- Groseth, A.; Gardner, D.; Meade-White, K.; Amler, S.; Ebihara, H. Immunocompetent hamsters as a model for orthobunyavirus-induced neuroinvasion and neuropathology. PLoS Negl. Trop. Dis. 2023, 17, e0011355. [Google Scholar] [CrossRef]
- Voloshin, N.; Tyurin-Kuzmin, P.; Karagyaur, M.; Akopyan, Z.; Kulebyakin, K. Practical Use of Immortalized Cells in Medicine: Current Advances and Future Perspectives. Int. J. Mol. Sci. 2023, 24, 12716. [Google Scholar] [CrossRef]
- Sanjuán, R.; Illingworth, C.J.R.; Geoghegan, J.L.; Iranzo, J.; Zwart, M.P.; Ciota, A.T.; Moratorio, G.; Gago-Zachert, S.; Duffy, S.; Vijaykrishna, D. Five Challenges in the Field of Viral Diversity and Evolution. Front. Virol. 2021, 1, 684949. [Google Scholar] [CrossRef]
- Léger, P.; Lozach, P.-Y. Bunyaviruses: From Transmission by Arthropods to Virus Entry into the Mammalian Host First-Target Cells. Future Virol. 2015, 10, 859–881. [Google Scholar] [CrossRef]
- Albornoz, A.; Hoffmann, A.B.; Lozach, P.Y.; Tischler, N.D. Early Bunyavirus-Host Cell Interactions. Viruses 2016, 8, 143. [Google Scholar] [CrossRef] [PubMed]
- Lozach, P.Y.; Kuhbacher, A.; Meier, R.; Mancini, R.; Bitto, D.; Bouloy, M.; Helenius, A. DC-SIGN as a receptor for phleboviruses. Cell Host Microbe 2011, 10, 75–88. [Google Scholar] [CrossRef] [PubMed]
- Allgoewer, K. Determinants of public interest in emerging and re-emerging arboviral diseases in Europe: A spatio-temporal analysis of cross-sectional time series data. J. Prev. Med. Hyg. 2022, 63, E579–E597. [Google Scholar] [CrossRef] [PubMed]
- Gonzalez Altamiranda, E.A.; Arias, M.E.; Kaiser, G.G.; Mucci, N.C.; Odeon, A.C.; Felmer, R.N. Upregulation of interferon-alpha gene in bovine embryos produced in vitro in response to experimental infection with noncytophatic bovine-viral-diarrhea virus. Mol. Biol. Rep. 2020, 47, 9959–9965. [Google Scholar] [CrossRef]
- Shi, X.; Zhang, Y.; Chen, S.; Du, X.; Zhang, P.; Duan, X.; Fang, H.; Liu, S. Differential gene expression and immune cell infiltration in maedi-visna virus-infected lung tissues. BMC Genom. 2024, 25, 534. [Google Scholar] [CrossRef]
- Sow, F.B.; Gallup, J.M.; Meyerholz, D.K.; Ackermann, M.R. Gene profiling studies in the neonatal ovine lung show enhancing effects of VEGF on the immune response. Dev. Comp. Immunol. 2009, 33, 761–771. [Google Scholar] [CrossRef]
Virus | p-Value < 0.05 | p-Value < 0.05 |log2 Fold Change| > 1 | pFDR < 0.05 | pFDR < 0.05 |log2 Fold Change| > 1 |
---|---|---|---|---|
BATV | 1837 | 550 | 158 | 122 |
BUNV | 2983 | 879 | 179 | 86 |
lNRIV | 1372 | 474 | 1 | 0 |
BAYAV | 6179 | 2742 | 4465 | 2234 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zöller, D.D.J.A.; Säurich, J.; Metzger, J.; Jung, K.; Lepenies, B.; Becker, S.C. Innate Immune Response Against Batai Virus, Bunyamwera Virus, and Their Reassortants. Viruses 2024, 16, 1833. https://doi.org/10.3390/v16121833
Zöller DDJA, Säurich J, Metzger J, Jung K, Lepenies B, Becker SC. Innate Immune Response Against Batai Virus, Bunyamwera Virus, and Their Reassortants. Viruses. 2024; 16(12):1833. https://doi.org/10.3390/v16121833
Chicago/Turabian StyleZöller, David D. J. A., Josefin Säurich, Julia Metzger, Klaus Jung, Bernd Lepenies, and Stefanie C. Becker. 2024. "Innate Immune Response Against Batai Virus, Bunyamwera Virus, and Their Reassortants" Viruses 16, no. 12: 1833. https://doi.org/10.3390/v16121833
APA StyleZöller, D. D. J. A., Säurich, J., Metzger, J., Jung, K., Lepenies, B., & Becker, S. C. (2024). Innate Immune Response Against Batai Virus, Bunyamwera Virus, and Their Reassortants. Viruses, 16(12), 1833. https://doi.org/10.3390/v16121833