4D-DIA-Based Quantitative Proteomic Analysis Reveals the Involvement of TRPV2 Protein in Duck Tembusu Virus Replication
Abstract
1. Introduction
2. Materials and Methods
2.1. Cell Culture and Blind Passage of Virus
2.2. Virus Inoculation
2.3. Protein Extraction, Digestion, and Peptide Desalting
2.4. LC-MS/MS Analysis
2.5. Data Analysis
2.6. Bioinformatics Analysis
2.7. RNA Interference
2.8. RT-qPCR
2.9. Data Statistics
3. Results
3.1. Validation of the DF-1 Cell Line as an Infection Model for DTMUV
3.2. Analysis of Differentially Expressed Proteins in Cells via 4D-DIA LC-MS/MS
3.3. RT-qPCR Validation of Differentially Expressed Proteins
3.4. TRPV2 Modulates DTMUV Replication in DF-1 Cells
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Liu, M.; Chen, Y.Y.; Twu, N.C.; Wu, M.C.; Fang, Z.S.; Dubruel, A.; Chang, S.C.; Wu, C.F.; Lo, D.Y.; Chen, H.W. A novel goose-origin Tembusu virus exhibits pathogenicity in day-old chicks with evidence of direct contact transmission. Poult. Sci. 2024, 103, 103332. [Google Scholar] [CrossRef]
- Yang, Q.; Ding, Y.; Yao, W.; Chen, S.; Jiang, Y.; Yang, L.; Bao, G.; Yang, K.; Fan, S.; Du, Q.; et al. Pathogenicity and Interspecies Transmission of Cluster 3 Tembusu Virus Strain TMUV HQ-22 Isolated from Geese. Viruses 2023, 15, 2449. [Google Scholar] [CrossRef] [PubMed]
- Dong, H.V.; Tran, G.; Vu, T.; Le, N.H.T.; Nguyen, Y.; Rapichai, W.; Rattanasrisomporn, A.; Boonkaewwan, C.; Bui, D.; Rattanasrisomporn, J. Duck Tembusu virus in North Vietnam: Epidemiological and genetic analysis reveals novel virus strains. Front. Vet. Sci. 2024, 11, 1366904. [Google Scholar] [CrossRef] [PubMed]
- Tunterak, W.; Prakairungnamthip, D.; Ninvilai, P.; Tiawsirisup, S.; Oraveerakul, K.; Sasipreeyajan, J.; Amonsin, A.; Thontiravong, A. Patterns of duck Tembusu virus infection in ducks, Thailand: A serological study. Poult. Sci. 2021, 100, 537–542. [Google Scholar] [CrossRef]
- Li, C.; Liu, J.; Shaozhou, W.; Bai, X.; Zhang, Q.; Hua, R.; Liu, J.H.; Liu, M.; Zhang, Y. Epitope Identification and Application for Diagnosis of Duck Tembusu Virus Infections in Ducks. Viruses 2016, 8, 306. [Google Scholar] [CrossRef]
- Guo, H.Y.; Cheng, A.C.; Zhang, X.C.; Pan, Y.H.; Wang, M.S.; Huang, J.; Zhu, D.K.; Chen, S.; Liu, M.F.; Zhao, X.X.; et al. DEF Cell-Derived Exosomal miR-148a-5p Promotes DTMUV Replication by Negative Regulating TLR3 Expression. Viruses 2020, 12, 94. [Google Scholar] [CrossRef]
- He, D.L.; Zhang, X.; Chen, L.; Tang, Y.; Diao, Y.X. Development of an attenuated live vaccine candidate of duck Tembusu virus strain. Vet. Microbiol. 2019, 231, 218–225. [Google Scholar] [CrossRef] [PubMed]
- Hamel, R.; Phanitchat, T.; Wichit, S.; Morales Vargas, R.E.; Jaroenpool, J.; Diagne, C.T.; Pompon, J.; Missé, D. New Insights into the Biology of the Emerging Tembusu Virus. Pathogens 2021, 10, 1010. [Google Scholar] [CrossRef]
- Liu, M.; Chen, S.; Chen, Y.; Liu, C.; Chen, S.; Yin, X.; Li, G.; Zhang, Y. Adapted Tembusu-like virus in chickens and geese in China. J. Clin. Microbiol. 2012, 50, 2807–2809. [Google Scholar] [CrossRef]
- Yan, D.; Li, X.; Wang, Z.; Liu, X.; Dong, X.; Fu, R.; Su, X.; Xu, B.; Teng, Q.; Yuan, C.; et al. The emergence of a disease caused by a mosquito origin Cluster 3.2 Tembusu virus in chickens in China. Vet. Microbiol. 2022, 272, 109500. [Google Scholar] [CrossRef]
- Li, G.X.; Gao, X.Y.; Xiao, Y.L.; Liu, S.Q.; Peng, S.; Li, X.S.; Shi, Y.; Zhang, Y.; Yu, L.; Wu, X.G.; et al. Development of a live attenuated vaccine candidate against duck Tembusu viral disease. Virology 2014, 450–451, 233–242. [Google Scholar] [CrossRef] [PubMed]
- Maxwell, K.L.; Frappier, L. Viral proteomics. Microbiol. Mol. Biol. Rev. 2007, 71, 398–411. [Google Scholar] [CrossRef] [PubMed]
- Aviner, R.; Lidsky, P.V.; Xiao, Y.; Tassetto, M.; Kim, D.; Zhang, L.; Mcalpine, P.L.; Elias, J.; Frydman, J.; Andino, R. SARS-CoV-2 Nsp1 cooperates with initiation factors EIF1 and 1A to selectively enhance translation of viral RNA. PLoS Pathog. 2024, 20, e1011535. [Google Scholar] [CrossRef] [PubMed]
- Murigneux, E.; Softic, L.; Aube, C.; Grandi, C.; Judith, D.; Bruce, J.; Le Gall, M.; Guillonneau, F.; Schmitt, A.; Parissi, V.; et al. Proteomic analysis of SARS-CoV-2 particles unveils a key role of G3BP proteins in viral assembly. Nat. Commun. 2024, 15, 640. [Google Scholar] [CrossRef]
- Pahmeier, F.; Lavacca, T.; Goellner, S.; Neufeldt, C.J.; Prasad, V.; Cerikan, B.; Rajasekharan, S.; Mizzon, G.; Haselmann, U.; Funaya, C.; et al. Identification of host dependency factors involved in SARS-CoV-2 replication organelle formation through proteomics and ultrastructural analysis. J. Virol. 2023, 97, e87823. [Google Scholar] [CrossRef]
- Haas, K.M.; Mcgregor, M.J.; Bouhaddou, M.; Polacco, B.J.; Kim, E.Y.; Nguyen, T.T.; Newton, B.W.; Urbanowski, M.; Kim, H.; Williams, M.; et al. Proteomic and genetic analyses of influenza A viruses identify pan-viral host targets. Nat. Commun. 2023, 14, 6030. [Google Scholar] [CrossRef]
- Sadewasser, A.; Paki, K.; Eichelbaum, K.; Bogdanow, B.; Saenger, S.; Budt, M.; Lesch, M.; Hinz, K.P.; Herrmann, A.; Meyer, T.F.; et al. Quantitative Proteomic Approach Identifies Vpr Binding Protein as Novel Host Factor Supporting Influenza A Virus Infections in Human Cells. Mol. Cell. Proteom. 2017, 16, 728–742. [Google Scholar] [CrossRef]
- Benej, M.; Danchenko, M.; Oveckova, I.; Cervenak, F.; Tomaska, L.; Grossmannova, K.; Polcicova, K.; Golias, T.; Tomaskova, J. Quantitative Proteomics Reveal Peroxiredoxin Perturbation Upon Persistent Lymphocytic Choriomeningitis Virus Infection in Human Cells. Front. Microbiol. 2019, 10, 2438. [Google Scholar] [CrossRef]
- Xu, M.; Xu, H.; Wan, W.; Jian, X.; Jin, R.; Wang, L.; Wang, J.; Xiao, G.; Zhang, L.; Chen, H.; et al. PDIA4 Is a Host Factor Important for Lymphocytic Choriomeningitis Virus Infection. Viruses 2023, 15, 2343. [Google Scholar] [CrossRef]
- Liu, H.; Huang, C.X.; He, Q.; Li, D.; Luo, M.H.; Zhao, F.; Lu, W. Proteomics analysis of HSV-1-induced alterations in mouse brain microvascular endothelial cells. J. Neurovirol. 2019, 25, 525–539. [Google Scholar] [CrossRef]
- Wan, W.; Wang, L.; Chen, X.; Zhu, S.; Shang, W.; Xiao, G.; Zhang, L.K. A Subcellular Quantitative Proteomic Analysis of Herpes Simplex Virus Type 1-Infected HEK 293T Cells. Molecules 2019, 24, 4215. [Google Scholar] [CrossRef] [PubMed]
- Rios-Castro, E.; Souza, G.; Delgadillo-Alvarez, D.M.; Ramirez-Reyes, L.; Torres-Huerta, A.L.; Velasco-Suarez, A.; Cruz-Cruz, C.; Hernandez-Hernandez, J.M.; Tapia-Ramirez, J. Quantitative Proteomic Analysis of MARC-145 Cells Infected with a Mexican Porcine Reproductive and Respiratory Syndrome Virus Strain Using a Label-Free Based DIA approach. J. Am. Soc. Mass Spectrom. 2020, 31, 1302–1312. [Google Scholar] [CrossRef] [PubMed]
- Xu, P.; Li, W.; Zhao, S.; Cui, Z.; Chen, Y.; Zhang, Y.N.; Chen, J.; Xia, P. Proteomic Characterization of PAMs with PRRSV-ADE Infection. Viruses 2022, 15, 36. [Google Scholar] [CrossRef] [PubMed]
- Guo, T.; Aebersold, R. Recent advances of data-independent acquisition mass spectrometry-based proteomics. Proteomics 2023, 23, e2200011. [Google Scholar] [CrossRef]
- Meier, F.; Brunner, A.D.; Frank, M.; Ha, A.; Bludau, I.; Voytik, E.; Kaspar-Schoenefeld, S.; Lubeck, M.; Raether, O.; Bache, N.; et al. diaPASEF: Parallel accumulation-serial fragmentation combined with data-independent acquisition. Nat. Methods 2020, 17, 1229–1236. [Google Scholar] [CrossRef]
- Huang, Z.; Deng, C.; Ma, C.; He, G.; Tao, J.; Zhang, L.; Hu, X.; Mo, Y.; Qiu, L.; Zhang, N.; et al. Identification and validation of the surface proteins FIBG, PDGF-beta, and TGF-beta on serum extracellular vesicles for non-invasive detection of colorectal cancer: Experimental study. Int. J. Surg. 2024, 110, 4672–4687. [Google Scholar]
- Shen, H.P.; Dong, X.; Li, Z.B.; Wu, J.Z.; Zheng, C.M.; Hu, X.J.; Qian, C.; Wang, S.P.; Zhao, Y.L.; Li, J.C. Protein Profiles and Novel Molecular Biomarkers of Schizophrenia Based on 4D-DIA Proteomics. J. Proteome Res. 2024, 23, 2376–2385. [Google Scholar] [CrossRef]
- Zhang, L.K.; Chai, F.; Li, H.Y.; Xiao, G.; Guo, L. Identification of host proteins involved in Japanese encephalitis virus infection by quantitative proteomics analysis. J. Proteome Res. 2013, 12, 2666–2678. [Google Scholar] [CrossRef]
- Huang, J.; Shen, H.; Wang, Z.; Huang, S.; Li, Q.; Zhou, Q.; Qin, J.; Xie, Q.; Chen, F. Attenuation of duck Tembusu virus ZJSBL01 strain following serial passage in BHK-21 cells supplied with 5-Fluorouracil. Virus Res. 2019, 273, 197739. [Google Scholar] [CrossRef]
- Wen, L.; Zhang, A.; Li, Y.; Lai, H.; Li, H.; Luo, Q.; Jin, S.; Chen, R. Suspension culture of Marek’s disease virus and evaluation of its immunological effects. Avian Pathol. 2019, 48, 183–190. [Google Scholar] [CrossRef]
- Yu, Z.; Ren, H.; Sun, M.; Xie, W.; Sun, S.; Liang, N.; Wang, H.; Ying, X.; Sun, Y.; Wang, Y.; et al. Tembusu virus infection in laying chickens: Evidence for a distinct genetic cluster with significant antigenic variation. Transbound. Emerg. Dis. 2022, 69, e1130–e1141. [Google Scholar] [CrossRef] [PubMed]
- Qiao, Y.; Wang, Z.; Han, Z.; Shao, Y.; Ma, Y.; Liang, Y.; Chen, Z.; Wu, H.; Cui, L.; Zhang, Y.; et al. Global exploration of the metabolic requirements of gallid alphaherpesvirus 1. PLoS Pathog. 2020, 16, e1008815. [Google Scholar] [CrossRef] [PubMed]
- Wang, L.; Xue, Z.; Wang, J.; Jian, Y.; Lu, H.; Ma, H.; Wang, S.; Zeng, W.; Zhang, T. Targeted knockout of Mx in the DF-1 chicken fibroblast cell line impairs immune response against Newcastle disease virus. Poult. Sci. 2023, 102, 102855. [Google Scholar] [CrossRef]
- Han, K.; Zhao, D.; Liu, Q.; Liu, Y.; Huang, X.; Yang, J.; Zhang, L.; Li, Y. Transcriptome analysis reveals new insight of duck Tembusu virus (DTMUV)-infected DF-1 cells. Res. Vet. Sci. 2021, 137, 150–158. [Google Scholar] [CrossRef]
- Xiang, C.; Huang, M.; Xiong, T.; Rong, F.; Li, L.; Liu, D.X.; Chen, R.A. Transcriptomic Analysis and Functional Characterization Reveal the Duck Interferon Regulatory Factor 1 as an Important Restriction Factor in the Replication of Tembusu Virus. Front. Microbiol. 2020, 11, 2069. [Google Scholar] [CrossRef]
- Li, N.; Wang, Y.; Li, R.; Liu, J.Y.; Zhang, J.Z.; Cai, Y.M.; Liu, S.D.; Chai, T.J.; Wei, L.M. Immune responses of ducks infected with duck Tembusu virus. Front. Microbiol. 2015, 6, 425. [Google Scholar] [CrossRef]
- Li, N.; Jiang, S.; Zhao, J.; Yang, Y.; Deng, K.; Wei, L.; Cai, Y.; Li, B.; Liu, S. Molecular identification of duck DDX3X and its potential role in response to Tembusu virus. Dev. Comp. Immunol. 2020, 106, 103599. [Google Scholar] [CrossRef] [PubMed]
- Sun, X.; Wang, S.; Lin, X.; Zhao, L.; Zhang, D.; Yi, C.; Sun, X.; Chen, H.; Jin, M. Proteome analysis of Duck Tembusu virus (DTMUV)-infected BHK-21 cells. Proteomics 2017, 17, 10. [Google Scholar] [CrossRef]
- Guo, Y.Y.; Gao, Y.; Hu, Y.R.; Zhao, Y.; Jiang, D.; Wang, Y.; Zhang, Y.; Gan, H.; Xie, C.; Liu, Z.; et al. The Transient Receptor Potential Vanilloid 2 (TRPV2) Channel Facilitates Virus Infection Through the Ca2+-LRMDA Axis in Myeloid Cells. Adv. Sci. 2022, 9, e2202857. [Google Scholar] [CrossRef]
- Zhang, W.; Jiang, B.; Zeng, M.; Duan, Y.; Wu, Z.; Wu, Y.; Wang, T.; Wang, M.; Jia, R.; Zhu, D.; et al. Binding of Duck Tembusu Virus Nonstructural Protein 2A to Duck STING Disrupts Induction of Its Signal Transduction Cascade To Inhibit Beta Interferon Induction. J. Virol. 2020, 94, e01850-19. [Google Scholar] [CrossRef]





| Names | Accession No. | Forward Primer Sequence (5′→3′) | Reverse Primer Sequence (5′→3′) |
|---|---|---|---|
| NS3-TAclone | KX977555.1 | GAGGCTCACTTCACAGACCC | ACCGCCGGTCATTGTAACTT |
| NS3 | HQ641389.1 | TTCATGACAGCCACACCTCC | GTCAAGCACACGGCAATCTC |
| GAPDH | NM_204305.2 | GTCCATGCCATCACAGCCACAC | CATCAGCAGCAGCCTTCACTACC |
| DDX3X | NM_001030800.2 | ATGAGGAGGCCAGGAAGTTT | CTGAGGTTCGAAACCCATGT |
| NOD1 | NM_001318438.1 | GCGATGCAGGAATTGGAAAA | TGTGAAAAGAACCGTATGAGGGA |
| RIPK2 | NM_001030943.2 | CTCGAACCAGTCCTGAGAACG | AAGCGGATGTTTCCTCTTGG |
| HMGCS1 | NM_205411.1 | CAGTTCTTGGGATGGACGCT | CCCAACTAGCATAGCAACAGC |
| CTSK | XM_046903916.1 | CATCATTGACGGAGCGATGC | TTTCGTCCTCCTTGCCGTTG |
| HMGCR | NM_204485.1 | TTGGATAGAGGGAAGAGGGAAG | CCATAGCAGAACCCACCAGA |
| FAM180A | JN032743.1 | GACTTTGCTGCTGCTGCTGTTC | CTCAGCAGCCTTCCTCAGCGA |
| IGFBP4 | NM_204353.1 | AACTTCCACCCCAAGCAG | AATCCAAGTCCCCCTTCAG |
| BRCA1 | NM_204169.1 | AAGCCGATTGTGAGCGAAGA | CCATTCCGATCAGCGAGTGA |
| JAM3 | XM_417876.6 | CCAGAGTGTTGAGCTGTCCT | AGAATTTCTGCCCGAGTTGC |
| TRPV2 | XM_040650471.2 | CAGTCAGGCCCATGTCAGAG | GGTAAGGTGACTCCAAGGGC |
| CXCL8 | AJ009800.1 | CCAAGCACACCTCTCTTCCA | GCAAGGTAGGACGCTGGTAA |
| ITPR3 | XM_015298988.4 | TGTTCCGACTGTGCTACCG | AAGGCTGTGATGGTGTCCTC |
| CEBPB | NM_205253.3 | TTTGCTTTCATGCAACGCCT | TAAGTTCGGTCATGGAGCGG |
| CD74 | NM_001001613.2 | CAGTTTCGGTGGTGTCCATC | GTCCACCCCAGAGAAGATCAC |
| ALAS1 | NM_001018012.2 | CATCTCTGGAACGCTCGGCAAG | CCAGCAGCATACGAACGGACAG |
| ITGA5 | XM_046904986.1 | CTCCAACTACCCCGAGTACT | CACCGAATAGCCCATATAAC |
| IL17REL | XM_015273696.4 | TCCAGATGCCAGGAGGTTAC | TGCAAAGTCTTGGGTGAGTG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Chen, J.; Yang, F.; Lai, L.; Li, H.; Pan, C.; Bao, X.; Lin, W.; Lin, R. 4D-DIA-Based Quantitative Proteomic Analysis Reveals the Involvement of TRPV2 Protein in Duck Tembusu Virus Replication. Viruses 2024, 16, 1831. https://doi.org/10.3390/v16121831
Chen J, Yang F, Lai L, Li H, Pan C, Bao X, Lin W, Lin R. 4D-DIA-Based Quantitative Proteomic Analysis Reveals the Involvement of TRPV2 Protein in Duck Tembusu Virus Replication. Viruses. 2024; 16(12):1831. https://doi.org/10.3390/v16121831
Chicago/Turabian StyleChen, Jimin, Fan Yang, Lianjie Lai, Huihuang Li, Chengfu Pan, Xinguo Bao, Weimin Lin, and Ruiyi Lin. 2024. "4D-DIA-Based Quantitative Proteomic Analysis Reveals the Involvement of TRPV2 Protein in Duck Tembusu Virus Replication" Viruses 16, no. 12: 1831. https://doi.org/10.3390/v16121831
APA StyleChen, J., Yang, F., Lai, L., Li, H., Pan, C., Bao, X., Lin, W., & Lin, R. (2024). 4D-DIA-Based Quantitative Proteomic Analysis Reveals the Involvement of TRPV2 Protein in Duck Tembusu Virus Replication. Viruses, 16(12), 1831. https://doi.org/10.3390/v16121831

