An Alarming Eastward Front of Cassava Mosaic Disease in Development in West Africa
Abstract
1. Introduction
2. Materials and Methods
2.1. Pre-Survey in Forécariah and Generation of Complete Genome Nucleotide Sequences of Cassava Mosaic Begomovirus (CMBs)
2.2. Country-Wide Epidemiological Survey
2.3. Molecular Characterization of CMBs
2.4. Sequencing and Phylogenetic Analysis
2.5. Statistical Analysis
3. Results
3.1. Characterization of EACMV-Ug in Guinea
3.2. Analysis of EACMV-Ug Full-Length Genome Detected in Guinea
3.3. CMD Incidence and Severity in Guinea
3.4. Mode of Infection and Whitefly Abundance in Guinea
3.5. Detection of CMBs by PCR and Their Distribution Across Guinea
3.6. Cassava Variety Range and Infecting Begomoviruses in Guinea
3.7. Phylogenetic Relationships Between EACMV-Ug Coat Protein Genes
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Vernier, P.; Boni N’Zué, N.Z.-R. Le Manioc, Entre Culture Alimentaire et Filière Agro-Industrielle Quae CTA Presses Agronomiques de Gembloux. Editions Qua, CTA; Presses Agronomiques de Gembloux: Gembloux, Belgium, 2018; pp. 1–235. [Google Scholar]
- He, D.C.; Zhan, J.S.; Xie, L.H. Problems, challenges and future of plant disease management: From an ecological point of view. J. Integr. Agric. 2016, 15, 705–715. [Google Scholar] [CrossRef]
- Njoroge, M.K.; Mutisya, D.L.; Miano, D.W.; Kilalo, D.C. Whitefly species efficiency in transmitting cassava mosaic and brown streak virus diseases. Cogent Biol. 2017, 3, 1311499. [Google Scholar] [CrossRef]
- Soro, M.; Tiendrébéogo, F.; Pita, J.S.; Traoré, E.T.; Somé, K.; Tibiri, E.B.; Néya, J.B.; Mutuku, J.M.; Simporé, J.; Koné, D. Epidemiological assessment of cassava mosaic disease in Burkina Faso. Plant Pathol. 2021, 70, 2207–2216. [Google Scholar] [CrossRef] [PubMed]
- Bull, S.E.; Briddon, R.W.; Sserubombwe, W.S.; Ngugi, K.; Markham, P.G.; Stanley, J. Genetic diversity and phylogeography of cassava mosaic viruses in Kenya. J. Gen. Virol. 2006, 87, 3053–3065. [Google Scholar] [CrossRef] [PubMed]
- Pita, J.S.; Fondong, V.N.; Sangare, A.; Otim-Nape, G.W.; Ogwal, S.; Fauquet, C.M. Recombination, pseudorecombination and synergism of geminiviruses are determinant keys to the epidemic of severe cassava mosaic disease in Uganda. J. Gen. Virol. 2001, 82, 655–665. [Google Scholar] [CrossRef] [PubMed]
- Legg, J.P.; Owor, B.; Sseruwagi, P.; Ndunguru, J. Cassava Mosaic Virus Disease in East and Central Africa: Epidemiology and Management of A Regional Pandemic. Adv. Virus Res. 2006, 67, 355–418. [Google Scholar]
- Zhou, X.; Liu, Y.; Calvert, L.; Munoz, C.; Otim-nape, G.W.; Robinson, D.J.; Harrison, B.D. Evidence that DNA-A of a geminivirus associated with severe cassava mosaic disease in Uganda has arisen by interspecific recombination. J. Gen. Virol. 2017, 79, 2101–2111. [Google Scholar] [CrossRef] [PubMed]
- Were, H.K.; Winter, S.; Maiss, E. Variations and taxonomic status of begomoviruses causing severe epidemics of cassava mosaic disease in Kenya, Uganda, and Democratic Republic of the Congo. Dis. Viroid 2004, 70, 243–248. [Google Scholar] [CrossRef]
- Neuenschwander, P.; Hughes, J.A.; Ogbe, F.; Ngatse, J.M.; De, J.P.L. Occurrence of the Uganda variant of East African cassava mosaic virus (EACMV-Ug) in western Democratic Republic of Congo and the Congo Republic defines the westernmost extent of the CMD pandemic in East/Central Africa. Plant Pathol. 2002, 51, 385. [Google Scholar] [CrossRef]
- Legg, J.P.; Ndjelassili, F.; Okao-okuja, G. First report of cassava mosaic disease and cassava mosaic geminiviruses in Gabon. Plant Pathol. 2004, 53, 232. [Google Scholar] [CrossRef]
- Valam-zango, A.; Zinga, I.; Hoareau, M.; Mvila, A.C.; Semballa, S.; Lett, J.M. First report of cassava mosaic geminiviruses and the Uganda strain of East African cassava mosaic virus (EACMV-UG) associated with cassava mosaic disease in Equatorial Guinea. New Dis. Rep. 2015, 32, 29. [Google Scholar] [CrossRef]
- Akinbade, S.A.; Hanna, R.; Njukwe, E.; Kuate, A.F. First report of the East African cassava mosaic virus Uganda (EACMV-UG) infecting cassava (Manihot esculenta) in Cameroon. New Dis. Rep. 2010, 21, 22. [Google Scholar] [CrossRef]
- Tiendrébéogo, F.; Lefeuvre, P.; Hoareau, M.; Traoré, V.S.E.; Barro, N.; Reynaud, B.; Traoré, A.S. Occurrence of East African cassava mosaic virus -Uganda (EACMV-UG) in Burkina Faso. Plant Pathol. 2009, 58, 783. [Google Scholar] [CrossRef]
- Okao-Okuja, G.; Legg, J.P.; Traore, L.; Jorge, M.A. Viruses Associated with Cassava Mosaic Disease in Senegal and Guinea Conakry. J. Phytopathol. 2004, 76, 69–76. [Google Scholar] [CrossRef]
- Bah, E.S.; Bamkefa, B.A.; Winter, S.; Dixon, A.G.O. Distribution and current status of cassava mosaic disease and begomoviruses in Guinea. Afr. J. Root Tuber Crops 2011, 9, 17–23. [Google Scholar]
- Combala, M.; Pita, J.S.; Tiendrebeogo, F.; Gbonamou, M.; Eni, A.O. First Report of East African cassava mosaic virus-Uganda (EACMV-Ug) infecting cassava in Guinea, West Africa. New Dis. Rep. 2024; submitted. [Google Scholar]
- Fondong, V.N.; Pita, J.S.; Rey, M.E.C.; Kochko, A.; Beachy, R.N.; Fauquet, C.M. Evidence of synergism between African cassava mosaic virus and new double-recombination geminivirus infecting cassava in Cameroon. J. Gen. Virol. 2000, 81, 287–297. [Google Scholar]
- Chehida, S.B.; Filloux, D.; Fernandez, E.; Moubset, O.; Hoareau, M.; Julian, C.; Blondin, L.; Lett, J.; Roumagnac, P.; Lefeuvre, P. Nanopore Sequencing Is a Credible Alternative to Recover Complete Genomes of Geminiviruses. Microorganisms 2021, 9, 903. [Google Scholar] [CrossRef]
- Kouakou, B.S.M.; Yoboué, A.A.N.; Pita, J.S.; Mutuku, J.M.; Otron, D.H.; Kouassi, N.K.; Kouassi, K.M.; Vanié-Léabo, L.P.L.; Ndougonna, C.; Zouzou, M.; et al. Gradual Emergence of East African cassava mosaic Cameroon virus in Cassava Farms in Côte d’Ivoire. Agronomy 2024, 14, 418. [Google Scholar] [CrossRef]
- Hahn, S.K.; Terry, E.R.; Leuschner, K. Cassava for cassava resistance disease. Euphytica 1980, 29, 673–683. [Google Scholar] [CrossRef]
- Sseruwagi, P.; Sserubombwe, W.S.; Legg, J.P.; Ndunguru, J.; Thresh, J.M. Methods of surveying the incidence and severity of cassava mosaic disease and whitefly vector populations on cassava in Africa: A review. Virus Res. 2004, 100, 129–142. [Google Scholar] [CrossRef]
- Amoakon, W.J.L.; Yoboué, A.A.N.; Pita, J.S.; Mutuku, J.M.; N’Zué, B.; Combala, M.; Otron, D.H.; Koné, M.; Kouassi, N.K.; Sié, R. Occurrence of cassava mosaic begomoviruses in national cassava germplasm preserved in two agro-ecological zones of Ivory Coast. Plant Pathol. 2023, 72, 1011–1021. [Google Scholar] [CrossRef]
- Doyle, J.J.; Doyle, J.L. A rapid DNA isolation procedure for small quantities of fresh leaf tissue. Phytochem. Bull. 1987, 19, 11–15. [Google Scholar]
- Combala, M.; Tibiri, B.E.; Pita, J.S.; Tiendrébéogo, F.; Eni, A. Improving the cassava mosaic Begomoviruses diagnostic in Central and West Africa using Oxford nanopore technology. Sci. Rep. 2024; in preparation. [Google Scholar]
- Pita, J.S.; Fondong, V.N.; Sangaré, A.; Kokora, R.N.N.; Fauquet, C.M. Genomic and biological diversity of the African cassava geminiviruses. Euphytica 2001, 120, 115–125. [Google Scholar] [CrossRef]
- Matic, S.; Pais Da Cunha, A.T.; Thompson, J.R.; Tepfer, M. An analysis of viruses associated with cassava mosaic disease in three Angolan provinces. J. Plant Pathol. 2012, 94, 443–450. [Google Scholar]
- Alabi, O.J.; Kumar, P.L.; Naidu, R.A. Multiplex PCR for the detection of African cassava mosaic virus and East African cassava mosaic Cameroon virus in cassava. J. Virol. Methods 2008, 154, 111–120. [Google Scholar] [CrossRef]
- Ndunguru, J.; Legg, J.P.; Aveling, T.A.S.; Thompson, G.; Fauquet, C.M. Molecular biodiversity of cassava begomoviruses in Tanzania: Evolution of cassava geminiviruses in Africa and evidence for East Africa being a center of diversity of cassava geminiviruses. Virol. J. 2005, 2, 21. [Google Scholar] [CrossRef]
- Wickham, H. Getting Started with ggplot2. In ggplot2: Elegant Graphics for Data Analysis; Springer: Berlin/Heidelberg, Germany, 2016; pp. 11–31. [Google Scholar]
- Chikoti, P.C.; Peter, S.; Mulenga, R.M.; Tembo, M. Cassava mosaic disease: A review of a threat to cassava production in Zambia. J. Plant Pathol. 2019, 101, 467–477. [Google Scholar] [CrossRef]
- Anani, J.; Serge, S.; Pita, J.S.; Hound, S.E. Cassava mosaic disease (CMD) in Benin: Incidence, severity and its whitefly abundance from field surveys in 2020. Crop Prot. 2022, 158, 106007. [Google Scholar]
- Harimalala, M.; Chiroleu, F.; Giraud-Carrier, C.; Hoareau, M.; Zinga, I.; Randriamampianina, J.A.; Velombola, S.; Ranomenjanahary, S.; Andrianjaka, A.; Reynaud, B.; et al. Molecular epidemiology of cassava mosaic disease in Madagascar. Plant Pathol. 2015, 64, 501–507. [Google Scholar] [CrossRef]
- Thresh, J.M.; Otirn-nape, D.F.G.W. Effects of African cassava mosaic geminivirus on the yield of cassava. Trop. Sci. 1994, 34, 26–42. [Google Scholar]
- Eni, A.O.; Efekemo, O.P.; Onile-ere, O.A.; Pita, J.S. South West and North Central Nigeria: Assessment of cassava mosaic disease and field status of African cassava mosaic virus and East African cassava mosaic virus. Ann. Appl. Biol. 2021, 178, 466–479. [Google Scholar] [CrossRef] [PubMed]
- Houngue, J.A.; Pita, J.S.; Habib, G.; Cacaï, T.; Zandjanakou-tachin, M.; Abidjo, E.A.E.; Ahanhanzo, C. Survey of farmers’ knowledge of cassava mosaic disease and their preferences for cassava cultivars in three agro-ecological zones in Benin. J. Ethnobiol. Ethnomed. 2018, 14, 1–9. [Google Scholar] [CrossRef] [PubMed]
- Tiendrébéogo, F. Caractérisation et Aspects Epidémiologiques des Begomovirus Infectant les Plantes Maraîchères et le Manioc au Burkina Faso; Université de Ouagadougou: Ouagadougou, Burkina Faso, 2010; p. 136. [Google Scholar]
- Abubakar, M.; Singh, D.; Keta, J.N. Cassava Mosaic Disease and Associated Gemini Viruses in Bauchi State, Nigeria: Occurrence and Distribution. Am. J. Plant Biol. 2019, 4, 85–90. [Google Scholar] [CrossRef]
- Busogoro, J.P.; Masquellier, L.; Kummert, J.; Dutrecq, O.; Lepoivre, P.; Jijakli, M.H. Application of a Simplified Molecular Protocol to Reveal Mixed Infections with Begomoviruses in Cassava. J. Phytopathol. 2008, 457, 452–457. [Google Scholar] [CrossRef]
- Were, H.K.; Winter, S.; Maiss, E. Occurrence and distribution of cassava begomoviruses in Kenya. Ann. Appl. Biol. 2004, 145, 175–184. [Google Scholar] [CrossRef]
- Zhou, X.; Robinson, D.J.; Harrison, B.D. Types of variation in DNA-A among isolates of East African cassava mosaic virus from Kenya, Malawi and Tanzania. J. Gen. Virol. 1998, 79, 2835–2840. [Google Scholar] [CrossRef]
Primer Name | Primer Sequence | Size (bp) | Virus Detected (Target Region) | References |
---|---|---|---|---|
WAVE-177F | TCGAAGCCCAGATGTCCCTA | 393 | ACMV/EACMCMV/EACMV/ EACMV-Ug/AV1 (CP) | Combala et al. [25] |
WAVE-569F | CCACCAACAACAGTGGCATG | |||
JSP001F | ATGTCGAAGCGACCAGGAGAT | 783 | ACMV/AV1 (CP) | Pita et al. [26] |
JSP002R | TGTTTATTAATTGCCAATACT | |||
WAVE-AA508F | AAGGCCCATGTAAGGTCCAG | 800 | ACMV/AV1/AC3 | Combala et al. [25] |
WAVE-AA1307R | GAAGGAGCTGGGGATTCACA | |||
WAVE-AA370F | ACAGCCCATACAGGAACCGT | 1000 | ACMV/AV1/AC3 | Combala et al. [25] |
WAVE-AA1369R | CGACCATTCCTGCTGAACCA | |||
ACMVBF | TCGGGAGTGATACATGCGAAGGC | 628 | ACMV/BV1/BC1 | Matic et al. [27] |
ACMVBR | GGCTACACCAGCTACCTGAAGCT | |||
WAVE-AB177F | GATCTGCGGGCCTATCGAAT | 800 | ACMV/BV1 | Combala et al. [25] |
WAVE-AB977R | TTCACGCTGTGCAATACCCT | |||
WAVE-AB982F | TTCGTGTCATCTGCAGGAGA | 800 | ACMV/BV1/BC1 | Combala et al. [25] |
WAVE-AB1781R | GTACCATGGCAGCTGCTGTA | |||
JSP001F | ATGTCGAAGCGACCAGGAGAT | 780 | EACMV/AV1 (CP) | Pita et al. [26] |
JSP003R | CCTTTATTAATTTGTCACTGC | |||
CMBRepF | CRTCAATGACGTTGTACCA | 650 | EACMV/AC1 | Alabi et al. [28] |
EACMVRepR | GGTTTGCAGAGAACTACATC | |||
VNF031F | GGATACAGATAGGGTTCCCAC | ~560 | EACMCMV/AC2/AC3 | Fondong et al. [18] |
VNF032R | GACGAGGACAAGAATTCCAAT | |||
WAVE-EA1875F | TGTACCAGGCGTCGTTTGAA | 800 | EACMV/AC1 | Combala et al. [25] |
WAVE-EA2674R | TGTCCCCCGATCCAAAACG | |||
EAB555F | TACATCGGCCTTTGAGTCGCATGG | 544–560 | EACMV/BC1/CR | Ndunguru et al. [29] |
EAB555R | CTTATTAACGCCTATATAAACACC | |||
WAVE-EB1869F | TTCCAAGGGGAGGGTTCTGA | 800 | EACMV/BC1 | Combala et al. [25] |
WAVE-EB2694R | TGCTCTCGCCTCTCTCTTCT | |||
WAVE-EB845F | CGTGTATGGCATGCCTAGGT | 1000 | EACMV/BV1/BC1 | Combala et al. [25] |
WAVE-EB1847R | CTCCAACGTCATAGAAGGCGT |
Regions | |||||
---|---|---|---|---|---|
Viruses Detected | Lower Guinea (%) | Middle Guinea (%) | Upper Guinea (%) | Forest Guinea (%) | Total (%) |
ACMV | 54 | 34 | 52 | 42 | 182 |
(13.74) | (8.65) | (13.23) | (10.69) | (46.31) | |
EACMV | 2 | 0 | 0 | 1 | 3 |
(0.51) | (0.00) | (0.00) | (0.25) | (0.76) | |
EACMCMV | 0 | 1 | 3 | 1 | 5 |
(0.00) | (0.25) | (0.76) | (0.25) | (1.27) | |
EACMV-Ug | 3 | 0 | 0 | 1 | 4 |
(0.76) | (0.00) | (0.00) | (0.25) | (1.02) | |
ACMV+EACMV | 4 | 1 | 6 | 5 | 16 |
(1.02) | (0.25) | (1.53) | (1.27) | (4.07) | |
ACMV+EACMCMV | 15 | 13 | 12 | 18 | 58 |
(3.82) | (3.31) | (3.05) | (4.58) | (14.76) | |
ACMV+EACMV-Ug | 15 | 1 | 3 | 24 | 43 |
(3.82) | (0.25) | 0.76 | 6.11 | 10.94 | |
ACMV+EACMV+EACMV-Ug | 0 | 0 | 2 | 0 | 2 |
(0.00) | 0.00 | (0.51) | (0.00) | (0.51) | |
ACMV+EACMCMV+EACMV-Ug | 1 | 1 | 2 | 15 | 19 |
(0.25) | (0.25) | (0.51) | (3.82) | (4.83) | |
Total infected samples | 94 | 51 | 80 | 107 | 332 |
(23.92) | (12.98) | (20.36) | (27.23) | (84.48) | |
Negative samples | 26 | 11 | 10 | 14 | 61 |
(6.62) | (2.80) | (2.54) | (3.56) | (15.52) | |
Total | 120 | 62 | 90 | 121 | 393 |
(30.53) | (15.78) | (22.90) | (30.79) | (100.00) |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Combala, M.; Pita, J.S.; Gbonamou, M.; Samura, A.E.; Amoakon, W.J.-L.; Kouakou, B.S.M.; Onile-ere, O.; Sawadogo, S.; Eboulem, G.R.; Otron, D.H.; et al. An Alarming Eastward Front of Cassava Mosaic Disease in Development in West Africa. Viruses 2024, 16, 1691. https://doi.org/10.3390/v16111691
Combala M, Pita JS, Gbonamou M, Samura AE, Amoakon WJ-L, Kouakou BSM, Onile-ere O, Sawadogo S, Eboulem GR, Otron DH, et al. An Alarming Eastward Front of Cassava Mosaic Disease in Development in West Africa. Viruses. 2024; 16(11):1691. https://doi.org/10.3390/v16111691
Chicago/Turabian StyleCombala, Mariam, Justin S. Pita, Michel Gbonamou, Alusaine Edward Samura, William J.-L. Amoakon, Bekanvié S. M. Kouakou, Olabode Onile-ere, Seydou Sawadogo, Guy R. Eboulem, Daniel H. Otron, and et al. 2024. "An Alarming Eastward Front of Cassava Mosaic Disease in Development in West Africa" Viruses 16, no. 11: 1691. https://doi.org/10.3390/v16111691
APA StyleCombala, M., Pita, J. S., Gbonamou, M., Samura, A. E., Amoakon, W. J.-L., Kouakou, B. S. M., Onile-ere, O., Sawadogo, S., Eboulem, G. R., Otron, D. H., Seka, J. S. S., Eni, A., Ndougonna, C., & Tiendrébéogo, F. (2024). An Alarming Eastward Front of Cassava Mosaic Disease in Development in West Africa. Viruses, 16(11), 1691. https://doi.org/10.3390/v16111691