Nuclease Activity of the Junín Virus Nucleoprotein C-Terminal Domain
Abstract
1. Introduction
2. Materials and Methods
2.1. Cells
2.2. Plasmids
2.3. DNA Purification and Sequencing
2.4. Expression and Purification of Proteins
2.5. Determination of Molecular Weight (MW)
2.6. Circular Dichroism (CD)
2.7. Protein Analysis
2.8. Coimmunoprecipitation Assay
2.9. Nuclease Activity Assay
3. Results
3.1. Biochemical and Biophysical Characterization of the CTD of JUNV NP
3.2. JUNV NP_CTD Directly Interacts with JUNV Z
3.3. JUNV NP_CTD Displays Nuclease Activity
3.4. JUNV NP_CTD Nuclease Activity on Double-Stranded RNA Involves the DEDDh Motif
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Radoshitzky, S.R.; Buchmeier, M.J.; Charrel, R.N.; Clegg, J.C.S.; Gonzalez, J.J.; Günther, S.; Hepojoki, J.; Kuhn, J.H.; Lukashevich, I.S.; Romanowski, V.; et al. ICTV Virus Taxonomy Profile: Arenaviridae. J. Gen. Virol. 2019, 100, 1200–1201. [Google Scholar] [CrossRef] [PubMed]
- Burri, D.J.; da Palma, J.R.; Kunz, S.; Pasquato, A. Envelope glycoprotein of arenaviruses. Viruses 2012, 4, 2162–2181. [Google Scholar] [CrossRef]
- Nunberg, J.H.; York, J. The curious case of arenavirus entry, and its inhibition. Viruses 2012, 4, 83–101. [Google Scholar] [CrossRef] [PubMed]
- Buchmeier, M.J.; de la Torre, J.C.; Peters, C.J. Arenaviridae: The viruses and their replication. In Fields Virology; Fields, B.N., Knipe, D.M., Howley, P.M., Gri, N., Eds.; Lippincott Williams & Wilkins: Philadelphia, PA, USA, 2007; pp. 1791–1827. ISBN 9780781760607. [Google Scholar]
- Papageorgiou, N.; Spiliopoulou, M.; Nguyen, T.V.; Vaitsopoulou, A.; Laban, E.Y.; Alvarez, K.; Margiolaki, I.; Canard, B.; Ferron, F. Brothers in Arms: Structure, Assembly and Function of Arenaviridae Nucleoprotein. Viruses 2020, 12, 772. [Google Scholar] [CrossRef]
- Lee, K.J.; Novella, I.S.; Teng, M.N.; Oldstone, M.B.; de La Torre, J.C. NP and L proteins of lymphocytic choriomeningitis virus (LCMV) are sufficient for efficient transcription and replication of LCMV genomic RNA analogs. J. Virol. 2000, 74, 3470–3477. [Google Scholar] [CrossRef] [PubMed]
- López, N.; Jácamo, R.; Franze-Fernández, M.T. Transcription and RNA replication of Tacaribe virus genome and antigenome analogs require N and L proteins: Z protein is an inhibitor of these processes. J. Virol. 2001, 75, 12241–12251. [Google Scholar] [CrossRef]
- Hass, M.; Gölnitz, U.; Müller, S.; Becker-Ziaja, B.; Günther, S. Replicon system for Lassa virus. J. Virol. 2004, 78, 13793–13803. [Google Scholar] [CrossRef]
- Casabona, J.C.; Levingston Macleod, J.M.; Loureiro, M.E.; Gomez, G.A.; Lopez, N. The RING domain and the L79 residue of Z protein are involved in both the rescue of nucleocapsids and the incorporation of glycoproteins into infectious chimeric arenavirus-like particles. J. Virol. 2009, 83, 7029–7039. [Google Scholar] [CrossRef]
- Eichler, R.; Strecker, T.; Kolesnikova, L.; ter Meulen, J.; Weissenhorn, W.; Becker, S.; Klenk, H.D.; Garten, W.; Lenz, O. Characterization of the Lassa virus matrix protein Z: Electron microscopic study of virus-like particles and interaction with the nucleoprotein (NP). Virus Res. 2004, 100, 249–255. [Google Scholar] [CrossRef]
- Shtanko, O.; Imai, M.; Goto, H.; Lukashevich, I.S.; Neumann, G.; Watanabe, T.; Kawaoka, Y. A role for the C terminus of Mopeia virus nucleoprotein in its incorporation into Z protein-induced virus-like particles. J. Virol. 2010, 84, 5415–5422. [Google Scholar] [CrossRef]
- Martínez-Sobrido, L.; Giannakas, P.; Cubitt, B.; García-Sastre, A.; de la Torre, J.C. Differential inhibition of type I interferon induction by arenavirus nucleoproteins. J. Virol. 2007, 81, 12696–12703. [Google Scholar] [CrossRef] [PubMed]
- Pythoud, C.; Rodrigo, W.W.; Pasqual, G.; Rothenberger, S.; Martínez-Sobrido, L.; de la Torre, J.C.; Kunz, S. Arenavirus nucleoprotein targets interferon regulatory factor-activating kinase IKKε. J. Virol. 2012, 86, 7728–7738. [Google Scholar] [CrossRef]
- Rodrigo, W.W.; Ortiz-Riaño, E.; Pythoud, C.; Kunz, S.; de la Torre, J.C.; Martínez-Sobrido, L. Arenavirus nucleoproteins prevent activation of nuclear factor kappa B. J. Virol. 2012, 86, 8185–8197. [Google Scholar] [CrossRef]
- Shao, J.; Huang, Q.; Liu, X.; Di, D.; Liang, Y.; Ly, H. Arenaviral Nucleoproteins Suppress PACT-Induced Augmentation of RIG-I Function To Inhibit Type I Interferon Production. J. Virol. 2018, 92, e00482-18. [Google Scholar] [CrossRef]
- Qi, X.; Lan, S.; Wang, W.; Schelde, L.M.; Dong, H.; Wallat, G.D.; Ly, H.; Liang, Y.; Dong, C. Cap binding and immune evasion revealed by Lassa nucleoprotein structure. Nature 2010, 468, 779–783. [Google Scholar] [CrossRef]
- Hastie, K.M.; Liu, T.; Li, S.; King, L.B.; Ngo, N.; Zandonatti, M.A.; Woods VLJr de la Torre, J.C.; Saphire, E.O. Crystal structure of the Lassa virus nucleoprotein-RNA complex reveals a gating mechanism for RNA binding. Proc. Natl. Acad. Sci. USA 2011, 108, 19365–19370. [Google Scholar] [CrossRef]
- Ortiz-Riaño, E.; Cheng, B.Y.; de la Torre, J.C.; Martínez-Sobrido, L. Self-association of lymphocytic choriomeningitis virus nucleoprotein is mediated by its N-terminal region and is not required for its anti-interferon function. J. Virol. 2012, 86, 3307–3317. [Google Scholar] [CrossRef] [PubMed]
- Levingston Macleod, J.M.; D’Antuono, A.; Loureiro, M.E.; Casabona, J.C.; Gomez, G.A.; Lopez, N. Identification of two functional domains within the arenavirus nucleoprotein. J. Virol. 2011, 85, 2012–2023. [Google Scholar] [CrossRef]
- D’Antuono, A.; Loureiro, M.E.; Foscaldi, S.; Marino-Buslje, C.; Lopez, N. Differential contributions of Tacaribe arenavirus nucleoprotein N-terminal and C-terminal residues to nucleocapsid functional activity. J. Virol. 2014, 88, 6492–6505. [Google Scholar] [CrossRef] [PubMed]
- Hastie, K.M.; Kimberlin, C.R.; Zandonatti, M.A.; MacRae, I.J.; Saphire, E.O. Structure of the Lassa virus nucleoprotein reveals a dsRNA-specific 3’ to 5’ exonuclease activity essential for immune suppression. Proc. Natl. Acad. Sci. USA 2011, 108, 2396–2401. [Google Scholar] [CrossRef] [PubMed]
- Jiang, X.; Huang, Q.; Wang, W.; Dong, H.; Ly, H.; Liang, Y.; Dong, C. Structures of arenaviral nucleoproteins with triphosphate dsRNA reveal a unique mechanism of immune suppression. J. Biol. Chem. 2013, 288, 16949–16959. [Google Scholar] [CrossRef]
- Zhang, Y.; Li, L.; Liu, X.; Dong, S.; Wang, W.; Huo, T.; Guo, Y.; Rao, Z.; Yang, C. Crystal structure of Junin virus nucleoprotein. J. Gen. Virol. 2013, 94 Pt 10, 2175–2183. [Google Scholar] [CrossRef][Green Version]
- West, B.R.; Hastie, K.M.; Saphire, E.O. Structure of the LCMV nucleoprotein provides a template for understanding arenavirus replication and immunosuppression. Acta Crystallogr. D Biol. Crystallogr. 2014, 70 Pt 6, 1764–1769. [Google Scholar] [CrossRef]
- Yekwa, E.; Khourieh, J.; Canard, B.; Papageorgiou, N.; Ferron, F. Activity inhibition and crystal polymorphism induced by active-site metal swapping. Acta Crystallogr. D Struct. Biol. 2017, 73 Pt 8, 641–649. [Google Scholar] [CrossRef] [PubMed]
- Zuo, Y.; Deutscher, M.P. Exoribonuclease superfamilies: Structural analysis and phylogenetic distribution. Nucleic Acids Res. 2001, 29, 1017–1026. [Google Scholar] [CrossRef]
- Hastie, K.M.; King, L.B.; Zandonatti, M.A.; Saphire, E.O. Structural basis for the dsRNA specificity of the Lassa virus NP exonuclease. PLoS ONE 2012, 7, e44211. [Google Scholar] [CrossRef] [PubMed]
- Huang, Q.; Shao, J.; Lan, S.; Zhou, Y.; Xing, J.; Dong, C.; Liang, Y.; Ly, H. In vitro and in vivo characterizations of pichinde viral nucleoprotein exoribonuclease functions. J. Virol. 2015, 89, 6595–6607. [Google Scholar] [CrossRef] [PubMed]
- Reynard, S.; Russier, M.; Fizet, A.; Carnec, X.; Baize, S. Exonuclease domain of the Lassa virus nucleoprotein is critical to avoid RIG-I signaling and to inhibit the innate immune response. J. Virol. 2014, 88, 13923–13927. [Google Scholar] [CrossRef] [PubMed]
- Tortorici, M.A.; Ghiringhelli, P.D.; Lozano, M.E.; Albariño, C.G.; Romanowski, V. Zinc-binding properties of Junín virus nucleocapsid protein. J. Gen. Virol. 2001, 82 Pt 1, 121–128. [Google Scholar] [CrossRef]
- Alonso, L.G.; García-Alai, M.M.; Nadra, A.D.; Lapeña, A.N.; Almeida, F.L.; Gualfetti, P.; Prat-Gay, G.D. High-risk (HPV16) human papillomavirus E7 oncoprotein is highly stable and extended, with conformational transitions that could explain its multiple cellular binding partners. Biochemistry 2002, 41, 10510–10518. [Google Scholar] [CrossRef]
- Kruger, N.J. The Bradford method for protein quantitation. Methods Mol. Biol. 1994, 32, 9–15. [Google Scholar] [CrossRef]
- Abramoff, M.D.; Magalhaes, P.J.; Ram, S.J. Image processing with ImageJ. Biophotonics Int. 2004, 11, 36–42. [Google Scholar]
- Fuerst, T.R.; Niles, E.G.; Studier, F.W.; Moss, B. Eukaryotic transient-expression system based on recombinant vaccinia virus that synthesizes bacteriophage T7 RNA polymerase. Proc. Natl. Acad. Sci. USA 1986, 83, 8122–8126. [Google Scholar] [CrossRef] [PubMed]
- Jácamo, R.; López, N.; Wilda, M.; Franze-Fernández, M.T. Tacaribe virus Z protein interacts with the L polymerase protein to inhibit viral RNA synthesis. J. Virol. 2003, 77, 10383–10393. [Google Scholar] [CrossRef] [PubMed]
- Foscaldi, S.; D’Antuono, A.; Noval, M.G.; de Prat Gay, G.; Scolaro, L.; Lopez, N. Regulation of Tacaribe Mammarenavirus Translation: Positive 5’ and Negative 3’ Elements and Role of Key Cellular Factors. J. Virol. 2017, 91, e00084-17. [Google Scholar] [CrossRef]
- Salvato, M.S.; Schweighofer, K.J.; Burns, J.; Shimomaye, E.M. Biochemical and immunological evidence that the 11 kDa zinc-binding protein of lymphocytic choriomeningitis virus is a structural component of the virus. Virus Res. 1992, 22, 185–198. [Google Scholar] [CrossRef]
- Ortiz-Riaño, E.; Cheng, B.Y.; de la Torre, J.C.; Martínez-Sobrido, L. The C-terminal region of lymphocytic choriomeningitis virus nucleoprotein contains distinct and segregable functional domains involved in NP-Z interaction and counteraction of the type I interferon response. J. Virol. 2011, 85, 13038–13048. [Google Scholar] [CrossRef] [PubMed]
- Mateer, E.J.; Paessler, S.; Huang, C. Visualization of Double-Stranded RNA Colocalizing With Pattern Recognition Receptors in Arenavirus Infected Cells. Front. Cell. Infect. Microbiol. 2018, 8, 251. [Google Scholar] [CrossRef] [PubMed]
- Mateer, E.J.; Maruyama, J.; Card, G.E.; Paessler, S.; Huang, C. Lassa Virus, but Not Highly Pathogenic New World Arenaviruses, Restricts Immunostimulatory Double-Stranded RNA Accumulation during Infection. J. Virol. 2020, 94, e02006-19. [Google Scholar] [CrossRef]
- Meyer, B.; Ly, H. Inhibition of Innate Immune Responses Is Key to Pathogenesis by Arenaviruses. J. Virol. 2016, 90, 3810–3818. [Google Scholar] [CrossRef]
- Negrotto, S.; Mena, H.A.; Ure, A.E.; Jaquenod De Giusti, C.; Bollati-Fogolín, M.; Vermeulen, E.M.; Schattner, M.; Gómez, R.M. Human Plasmacytoid Dendritic Cells Elicited Different Responses after Infection with Pathogenic and Nonpathogenic Junin Virus Strains. J. Virol. 2015, 89, 7409–7413. [Google Scholar] [CrossRef][Green Version]
- Huang, C.; Kolokoltsova, O.A.; Yun, N.E.; Seregin, A.V.; Ronca, S.; Koma, T.; Paessler, S. Highly Pathogenic New World and Old World Human Arenaviruses Induce Distinct Interferon Responses in Human Cells. J. Virol. 2015, 89, 7079–7088. [Google Scholar] [CrossRef] [PubMed]
- Gallo, G.L.; López, N.; Loureiro, M.E. The Virus-Host Interplay in Junín Mammarenavirus Infection. Viruses 2022, 14, 1134. [Google Scholar] [CrossRef]
- Baird, N.L.; York, J.; Nunberg, J.H. Arenavirus infection induces discrete cytosolic structures for RNA replication. J. Virol. 2012, 86, 11301–11310, Erratum in J. Virol. 2013, 87, 2983. [Google Scholar] [CrossRef] [PubMed]
- Minskaia, E.; Hertzig, T.; Gorbalenya, A.E.; Campanacci, V.; Cambillau, C.; Canard, B.; Ziebuhr, J. Discovery of an RNA virus 3’->5’ exoribonuclease that is critically involved in coronavirus RNA synthesis. Proc. Natl. Acad. Sci. USA 2006, 103, 5108–5113. [Google Scholar] [CrossRef] [PubMed]
- Bouvet, M.; Imbert, I.; Subissi, L.; Gluais, L.; Canard, B.; Decroly, E. RNA 3’-end mismatch excision by the severe acute respiratory syndrome coronavirus nonstructural protein nsp10/nsp14 exoribonuclease complex. Proc. Natl. Acad. Sci. USA 2012, 109, 9372–9377. [Google Scholar] [CrossRef] [PubMed]
- de Silva, U.; Perrino, F.W.; Hollis, T. DNA binding induces active site conformational change in the human TREX2 3’-exonuclease. Nucleic Acids Res. 2009, 37, 2411–2417. [Google Scholar] [CrossRef]
- Yang, W.; Lee, J.Y.; Nowotny, M. Making and breaking nucleic acids: Two-Mg2+-ion catalysis and substrate specificity. Mol. Cell 2006, 22, 5–13. [Google Scholar] [CrossRef]
- Yang, W. Nucleases: Diversity of structure, function and mechanism. Q. Rev. Biophys. 2011, 44, 1–93. [Google Scholar] [CrossRef] [PubMed]
- Ren, Y.G.; Kirsebom, L.A.; Virtanen, A. Coordination of divalent metal ions in the active site of poly(A)-specific ribonuclease. J. Biol. Chem. 2004, 279, 48702–48706. [Google Scholar] [CrossRef]
- Ogando, N.S.; Ferron, F.; Decroly, E.; Canard, B.; Posthuma, C.C.; Snijder, E.J. The Curious Case of the Nidovirus Exoribonuclease: Its Role in RNA Synthesis and Replication Fidelity. Front. Microbiol. 2019, 10, 1813. [Google Scholar] [CrossRef]
- Robson, F.; Khan, K.S.; Le, T.K.; Paris, C.; Demirbag, S.; Barfuss, P.; Rocchi, P.; Ng, W.L. Coronavirus RNA Proofreading: Molecular Basis and Therapeutic Targeting. Mol. Cell 2020, 79, 710–727, Erratum in Mol. Cell 2020, 80, 1136–1138. [Google Scholar] [CrossRef] [PubMed]
- Yekwa, E.; Aphibanthammakit, C.; Carnec, X.; Picard, C.; Canard, B.; Baize, S.; Ferron, F. Arenaviridae exoribonuclease presents genomic RNA edition capacity. bioRxiv 2019, 541698. [Google Scholar] [CrossRef]
- Ngwe Tun, M.M.; Morita, K.; Ishikawa, T.; Urata, S. The Antiviral Effect of the Chemical Compounds Targeting DED/EDh Motifs of the Viral Proteins on Lymphocytic Choriomeningitis Virus and SARS-CoV-2. Viruses 2021, 13, 1220. [Google Scholar] [CrossRef]
- Huang, K.W.; Chen, J.W.; Hua, T.Y.; Chu, Y.Y.; Chiu, T.Y.; Liu, J.Y.; Tu, C.I.; Hsu, K.C.; Kao, Y.T.; Chu, J.W.; et al. Targeted Covalent Inhibitors Allosterically Deactivate the DEDDh Lassa Fever Virus NP Exonuclease from Alternative Distal Sites. JACS Au 2021, 1, 2315–2327. [Google Scholar] [CrossRef]
- Hernández, S.; Feracci, M.; De Jesus, C.T.; El Kazzi, P.; Kaci, R.; Garlatti, L.; Mondielli, C.; Bailly, F.; Cotelle, P.; Touret, F.; et al. Identification of potent inhibitors of arenavirus and SARS-CoV-2 exoribonucleases by fluorescence polarization assay. Antiviral Res. 2022, 204, 105364. [Google Scholar] [CrossRef] [PubMed]
Oligonucleotide Name | Sequence 5′ to 3′ |
---|---|
CTD-NJunv Fw | CATGAAACCAGTTGCTGGTCCTAGACAG |
NJunv Rv | TAGAGAATTCTTATCACAGTGCATAGGCTGCCTTCGG |
Flag-NJunv Fw | CATGGATTACAAGGATGACGACGATAAGGCACACTCCAAAGAGGTTCCAAGC |
NJunvD529A Fw | CACTGTGCTCTGCTAGCCTGCATAATGTTTCAGTC |
NJunvD529A Rv | GACTGAAACATTATGCAGGCTAGCAGAGCACAGTG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Sierra, A.A.; Loureiro, M.E.; Esperante, S.; Borkosky, S.S.; Gallo, G.L.; de Prat Gay, G.; Lopez, N. Nuclease Activity of the Junín Virus Nucleoprotein C-Terminal Domain. Viruses 2023, 15, 1818. https://doi.org/10.3390/v15091818
Sierra AA, Loureiro ME, Esperante S, Borkosky SS, Gallo GL, de Prat Gay G, Lopez N. Nuclease Activity of the Junín Virus Nucleoprotein C-Terminal Domain. Viruses. 2023; 15(9):1818. https://doi.org/10.3390/v15091818
Chicago/Turabian StyleSierra, Alicia Armella, María Eugenia Loureiro, Sebastián Esperante, Silvia Susana Borkosky, Giovanna L. Gallo, Gonzalo de Prat Gay, and Nora Lopez. 2023. "Nuclease Activity of the Junín Virus Nucleoprotein C-Terminal Domain" Viruses 15, no. 9: 1818. https://doi.org/10.3390/v15091818
APA StyleSierra, A. A., Loureiro, M. E., Esperante, S., Borkosky, S. S., Gallo, G. L., de Prat Gay, G., & Lopez, N. (2023). Nuclease Activity of the Junín Virus Nucleoprotein C-Terminal Domain. Viruses, 15(9), 1818. https://doi.org/10.3390/v15091818