One-Step Assembly of a PRRSV Infectious cDNA Clone and a Convenient CRISPR/Cas9-Based Gene-Editing Technology for Manipulation of PRRSV Genome
Abstract
1. Introduction
2. Materials and Methods
2.1. Cells and Viruses
2.2. Selection of Restrictive Endonuclease in Genome and Assembly of a Full-Length cDNA Clone
2.3. Recovery of Recombinant PRRSV
2.4. Design and Synthesis of sgRNAs
2.5. Analysis of Residue Conservation in PRRSV WUH3 nsp1α
2.6. Construction of pCMV-WUH3-EGFP and pCMV-WUH3 nsp1α-K150Q
2.7. Indirect Immunofluorescence Assay (IFA)
2.8. Western Blotting Assay
2.9. Viral Plaque Assay
2.10. Viral Multiple-Step Growth Curves Measured by TCID50 Assay
2.11. Statistical Analysis
3. Results
3.1. Assembly of Full-Length Infectious cDNA Clone of PRRSV WUH3
3.2. Recovery, Identification, and Characterization of rPRRSV WUH3
3.3. Modification of PRRSV Genome Using CRISPR/Cas9 to Carry an Exogenous Gene
3.4. Rescue and Characteristics of rPRRSV WUH3-EGFP
3.5. Site-Directed Mutation of PRRSV Genome Using CRISPR/Cas9
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Wensvoort, G.; Terpstra, C.; Pol, J.M.; ter Laak, E.A.; Bloemraad, M.; de Kluyver, E.P.; Kragten, C.; van Buiten, L.; den Besten, A.; Wagenaar, F.; et al. Mystery swine disease in The Netherlands: The isolation of Lelystad virus. Vet. Q. 1991, 13, 121–130. [Google Scholar] [CrossRef]
- Kuhn, J.H.; Lauck, M.; Bailey, A.L.; Shchetinin, A.M.; Vishnevskaya, T.V.; Bao, Y.; Ng, T.F.; LeBreton, M.; Schneider, B.S.; Gillis, A.; et al. Reorganization and expansion of the nidoviral family Arteriviridae. Arch. Virol. 2016, 161, 755–768. [Google Scholar] [CrossRef] [PubMed]
- Nelson, E.A.; Christopher-Hennings, J.; Drew, T.; Wensvoort, G.; Collins, J.E.; Benfield, D.A. Differentiation of U.S. and European isolates of porcine reproductive and respiratory syndrome virus by monoclonal antibodies. J. Clin. Microbiol. 1993, 31, 5. [Google Scholar] [CrossRef]
- Nelsen, C.J.; Murtaugh, M.P.; Faaberg, K.S. Porcine reproductive and respiratory syndrome virus comparison-Divergent evolution on two continents. J. Virol. 1999, 73, 11. [Google Scholar] [CrossRef]
- Fang, Y.; Snijder, E.J. The PRRSV replicase: Exploring the multifunctionality of an intriguing set of nonstructural proteins. Virus Res. 2010, 154, 61–76. [Google Scholar] [CrossRef] [PubMed]
- Fang, Y.; Treffers, E.E.; Li, Y.; Tas, A.; Sun, Z.; van der Meer, Y.; de Ru, A.H.; van Veelen, P.A.; Atkins, J.F.; Snijder, E.J.; et al. Efficient -2 frameshifting by mammalian ribosomes to synthesize an additional arterivirus protein. Proc. Natl. Acad. Sci. USA 2012, 109, E2920–E2928. [Google Scholar] [CrossRef] [PubMed]
- Li, Y.; Treffers, E.E.; Napthine, S.; Tas, A.; Zhu, L.; Sun, Z.; Bell, S.; Mark, B.L.; van Veelen, P.A.; van Hemert, M.J.; et al. Transactivation of programmed ribosomal frameshifting by a viral protein. Proc. Natl. Acad. Sci. USA 2014, 111, E2172–E2181. [Google Scholar] [CrossRef]
- Sun, L.; Li, Y.; Liu, R.; Wang, X.; Gao, F.; Lin, T.; Huang, T.; Yao, H.; Tong, G.; Fan, H.; et al. Porcine reproductive and respiratory syndrome virus ORF5a protein is essential for virus viability. Virus Res. 2013, 171, 178–185. [Google Scholar] [CrossRef]
- Das, P.B.; Dinh, P.X.; Ansari, I.H.; de Lima, M.; Osorio, F.A.; Pattnaik, A.K. The minor envelope glycoproteins GP2a and GP4 of porcine reproductive and respiratory syndrome virus interact with the receptor CD163. J. Virol. 2010, 84, 1731–1740. [Google Scholar] [CrossRef]
- Su, J.; Zhou, L.; He, B.; Zhang, X.; Ge, X.; Han, J.; Guo, X.; Yang, H. Nsp2 and GP5-M of Porcine Reproductive and Respiratory Syndrome Virus Contribute to Targets for Neutralizing Antibodies. Virol. Sin. 2019, 34, 631–640. [Google Scholar] [CrossRef]
- Wu, W.H.; Fang, Y.; Farwell, R.; Steffen-Bien, M.; Rowland, R.R.; Christopher-Hennings, J.; Nelson, E.A. A 10-kDa structural protein of porcine reproductive and respiratory syndrome virus encoded by ORF2b. Virology 2001, 287, 183–191. [Google Scholar] [CrossRef] [PubMed]
- Xie, J.; Trus, I.; Oh, D.; Kvisgaard, L.K.; Rappe, J.C.F.; Ruggli, N.; Vanderheijden, N.; Larsen, L.E.; Lefevre, F.; Nauwynck, H.J. A Triple Amino Acid Substitution at Position 88/94/95 in Glycoprotein GP2a of Type 1 Porcine Reproductive and Respiratory Syndrome Virus (PRRSV1) Is Responsible for Adaptation to MARC-145 Cells. Viruses 2019, 11, 36. [Google Scholar] [CrossRef]
- Tian, K.; Yu, X.; Zhao, T.; Feng, Y.; Cao, Z.; Wang, C.; Hu, Y.; Chen, X.; Hu, D.; Tian, X.; et al. Emergence of fatal PRRSV variants: Unparalleled outbreaks of atypical PRRS in China and molecular dissection of the unique hallmark. PLoS ONE 2007, 2, e526. [Google Scholar] [CrossRef] [PubMed]
- Kvisgaard, L.K.; Larsen, L.E.; Hjulsager, C.K.; Botner, A.; Rathkjen, P.H.; Heegaard, P.M.H.; Bisgaard, N.P.; Nielsen, J.; Hansen, M.S. Genetic and biological characterization of a Porcine Reproductive and Respiratory Syndrome Virus 2 (PRRSV-2) causing significant clinical disease in the field. Vet. Microbiol. 2017, 211, 74–83. [Google Scholar] [CrossRef]
- Niu, X.; Hou, Y.J.; Jung, K.; Kong, F.; Saif, L.J.; Wang, Q. Chimeric Porcine Deltacoronaviruses with Sparrow Coronavirus Spike Protein or the Receptor-Binding Domain Infect Pigs but Lose Virulence and Intestinal Tropism. Viruses 2021, 13, 122. [Google Scholar] [CrossRef] [PubMed]
- Garcia-Nunez, S.; Gismondi, M.I.; Konig, G.; Berinstein, A.; Taboga, O.; Rieder, E.; Martinez-Salas, E.; Carrillo, E. Enhanced IRES activity by the 3′UTR element determines the virulence of FMDV isolates. Virology 2014, 448, 303–313. [Google Scholar] [CrossRef][Green Version]
- Lee, C.; Yoo, D. The small envelope protein of porcine reproductive and respiratory syndrome virus possesses ion channel protein-like properties. Virology 2006, 355, 30–43. [Google Scholar] [CrossRef]
- Verheije, M.H.; Olsthoorn, R.C.; Kroese, M.V.; Rottier, P.J.; Meulenberg, J.J. Kissing interaction between 3′ noncoding and coding sequences is essential for porcine arterivirus RNA replication. J. Virol. 2002, 76, 1521–1526. [Google Scholar] [CrossRef]
- Jeong, C.-G.; Khatun, A.; Nazki, S.; Kim, S.-C.; Noh, Y.-H.; Kang, S.-C.; Lee, D.-U.; Yang, M.-S.; Shabir, N.; Yoon, I.-J.; et al. Evaluation of the Cross-Protective Efficacy of a Chimeric PRRSV Vaccine against Two Genetically Diverse PRRSV2 Field Strains in a Reproductive Model. Vaccines 2021, 9, 1258. [Google Scholar] [CrossRef]
- Popescu, L.N.; Trible, B.R.; Chen, N.; Rowland, R.R.R. GP5 of porcine reproductive and respiratory syndrome virus (PRRSV) as a target for homologous and broadly neutralizing antibodies. Vet. Microbiol. 2017, 209, 90–96. [Google Scholar] [CrossRef]
- Choi, H.Y.; Kim, M.S.; Kang, Y.L.; Choi, J.C.; Choi, I.Y.; Jung, S.W.; Jeong, J.Y.; Kim, M.C.; Hwang, S.S.; Lee, S.W.; et al. Development of a Chimeric Porcine Reproductive and Respiratory Syndrome Virus (PRRSV)-2 Vaccine Candidate Expressing Hypo-Glycosylated Glycoprotein-5 Ectodomain of Korean Lineage-1 Strain. Vet. Sci. 2022, 9, 165. [Google Scholar] [CrossRef] [PubMed]
- Choi, J.C.; Kim, M.S.; Choi, H.Y.; Kang, Y.L.; Choi, I.Y.; Jung, S.W.; Jeong, J.Y.; Kim, M.C.; Cho, A.Y.; Lee, J.H.; et al. Porcine Reproductive and Respiratory Syndrome Virus Engineered by Serine Substitution on the 44th Amino Acid of GP5 Resulted in a Potential Vaccine Candidate with the Ability to Produce High Levels of Neutralizing Antibody. Vet. Sci. 2023, 10, 191. [Google Scholar] [CrossRef] [PubMed]
- Wang, H.; Xie, X.; He, W.; Wang, Y.; Ren, T.; Ouyang, K.; Chen, Y.; Huang, W.; Wei, Z. Generation of a Recombinant Porcine Reproductive and Respiratory Syndrome Virus Stably Expressing Two Marker Genes. Front. Vet. Sci. 2020, 7, 548282. [Google Scholar] [CrossRef] [PubMed]
- Li, N.; Zhang, Y.; Yao, L.; Shi, Y.; Zhao, Q.; Huang, B.; Sun, Y. A Recombinant Porcine Reproductive and Respiratory Syndrome Virus Stably Expressing DsRed Protein Based on Bacterial Artificial Chromosome System. Front. Microbiol. 2022, 13, 839845. [Google Scholar] [CrossRef] [PubMed]
- Kim, D.Y.; Calvert, J.G.; Chang, K.O.; Horlen, K.; Kerrigan, M.; Rowland, R.R. Expression and stability of foreign tags inserted into nsp2 of porcine reproductive and respiratory syndrome virus (PRRSV). Virus Res. 2007, 128, 106–114. [Google Scholar] [CrossRef]
- Wang, Y.; He, W.; Li, Q.; Xie, X.; Qin, N.; Wang, H.; Huang, J.; Lin, S.; Ouyang, K.; Chen, Y.; et al. Generation of a porcine reproductive and respiratory syndrome virus expressing a marker gene inserted between ORF4 and ORF5a. Arch. Virol. 2020, 165, 1803–1813. [Google Scholar] [CrossRef] [PubMed]
- Jiang, W.; Bikard, D.; Cox, D.; Zhang, F.; Marraffini, L.A. RNA-guided editing of bacterial genomes using CRISPR-Cas systems. Nat. Biotechnol. 2013, 31, 233–239. [Google Scholar] [CrossRef]
- Gu, Z.; Dong, J.; Wang, J.; Hou, C.; Sun, H.; Yang, W.; Bai, J.; Jiang, P. A novel inactivated gE/gI deleted pseudorabies virus (PRV) vaccine completely protects pigs from an emerged variant PRV challenge. Virus Res. 2015, 195, 57–63. [Google Scholar] [CrossRef]
- Liu, Q.; Yang, F.; Zhang, J.; Liu, H.; Rahman, S.; Islam, S.; Ma, W.; She, M. Application of CRISPR/Cas9 in Crop Quality Improvement. Int. J. Mol. Sci. 2021, 22, 4206. [Google Scholar] [CrossRef]
- Gleeson, D.; Sethi, D.; Platte, R.; Burvill, J.; Barrett, D.; Akhtar, S.; Bruntraeger, M.; Bottomley, J.; Mouse Genetics Project, S.; Bussell, J.; et al. High-throughput genotyping of high-homology mutant mouse strains by next-generation sequencing. Methods 2021, 191, 78–86. [Google Scholar] [CrossRef]
- Ruan, J.; Li, H.; Xu, K.; Wu, T.; Wei, J.; Zhou, R.; Liu, Z.; Mu, Y.; Yang, S.; Ouyang, H.; et al. Highly efficient CRISPR/Cas9-mediated transgene knockin at the H11 locus in pigs. Sci. Rep. 2015, 5, 14253. [Google Scholar] [CrossRef] [PubMed]
- Kostyushev, D.; Brezgin, S.; Kostyusheva, A.; Zarifyan, D.; Goptar, I.; Chulanov, V. Orthologous CRISPR/Cas9 systems for specific and efficient degradation of covalently closed circular DNA of hepatitis B virus. Cell Mol. Life Sci. 2019, 76, 1779–1794. [Google Scholar] [CrossRef]
- Ehrke-Schulz, E.; Heinemann, S.; Schulte, L.; Schiwon, M.; Ehrhardt, A. Adenoviral Vectors Armed with PAPILLOMAVIRUs Oncogene Specific CRISPR/Cas9 Kill Human-Papillomavirus-Induced Cervical Cancer Cells. Cancers 2020, 12, 1934. [Google Scholar] [CrossRef] [PubMed]
- Ebrahimi, S.; Makvandi, M.; Abbasi, S.; Azadmanesh, K.; Teimoori, A. Developing oncolytic Herpes simplex virus type 1 through UL39 knockout by CRISPR-Cas9. Iran. J. Basic Med. Sci. 2020, 23, 937–944. [Google Scholar] [CrossRef]
- Tang, Y.D.; Liu, J.T.; Wang, T.Y.; An, T.Q.; Sun, M.X.; Wang, S.J.; Fang, Q.Q.; Hou, L.L.; Tian, Z.J.; Cai, X.H. Live attenuated pseudorabies virus developed using the CRISPR/Cas9 system. Virus Res. 2016, 225, 33–39. [Google Scholar] [CrossRef] [PubMed]
- Zou, Z.; Huang, K.; Wei, Y.; Chen, H.; Liu, Z.; Jin, M. Construction of a highly efficient CRISPR/Cas9-mediated duck enteritis virus-based vaccine against H5N1 avian influenza virus and duck Tembusu virus infection. Sci. Rep. 2017, 7, 1478. [Google Scholar] [CrossRef]
- Peng, Q.; Fang, L.; Ding, Z.; Wang, D.; Peng, G.; Xiao, S. Rapid manipulation of the porcine epidemic diarrhea virus genome by CRISPR/Cas9 technology. J. Virol. Methods 2020, 276, 113772. [Google Scholar] [CrossRef]
- Wang, G.; Liang, R.; Liu, Z.; Shen, Z.; Shi, J.; Shi, Y.; Deng, F.; Xiao, S.; Fu, Z.F.; Peng, G. The N-Terminal Domain of Spike Protein Is Not the Enteric Tropism Determinant for Transmissible Gastroenteritis Virus in Piglets. Viruses 2019, 11, 313. [Google Scholar] [CrossRef]
- Li, B.; Fang, L.; Liu, S.; Zhao, F.; Jiang, Y.; He, K.; Chen, H.; Xiao, S. The genomic diversity of Chinese porcine reproductive and respiratory syndrome virus isolates from 1996 to 2009. Vet. Microbiol. 2010, 146, 226–237. [Google Scholar] [CrossRef]
- Ke, W.; Fang, L.; Jing, H.; Tao, R.; Wang, T.; Li, Y.; Long, S.; Wang, D.; Xiao, S. Cholesterol 25-Hydroxylase Inhibits Porcine Reproductive and Respiratory Syndrome Virus Replication through Enzyme Activity-Dependent and -Independent Mechanisms. J. Virol. 2017, 91, 10–1128. [Google Scholar] [CrossRef]
- Li, R.; Chen, C.; He, J.; Zhang, L.; Zhang, L.; Guo, Y.; Zhang, W.; Tan, K.; Huang, J. E3 ligase ASB8 promotes porcine reproductive and respiratory syndrome virus proliferation by stabilizing the viral Nsp1alpha protein and degrading host IKKbeta kinase. Virology 2019, 532, 55–68. [Google Scholar] [CrossRef] [PubMed]
- Chen, N.; Yu, X.; Wang, L.; Wu, J.; Zhou, Z.; Ni, J.; Li, X.; Zhai, X.; Tian, K. Two natural recombinant highly pathogenic porcine reproductive and respiratory syndrome viruses with different pathogenicities. Virus Genes. 2013, 46, 473–478. [Google Scholar] [CrossRef] [PubMed]
- Zhou, L.; Kang, R.; Zhang, Y.; Ding, M.; Xie, B.; Tian, Y.; Wu, X.; Zuo, L.; Yang, X.; Wang, H. Whole Genome Analysis of Two Novel Type 2 Porcine Reproductive and Respiratory Syndrome Viruses with Complex Genome Recombination between Lineage 8, 3, and 1 Strains Identified in Southwestern China. Viruses 2018, 10, 328. [Google Scholar] [CrossRef] [PubMed]
- Kroese, M.V.; Zevenhoven-Dobbe, J.C.; Bos-de Ruijter, J.N.A.; Peeters, B.P.H.; Meulenberg, J.J.M.; Cornelissen, L.; Snijder, E.J. The nsp1alpha and nsp1 papain-like autoproteinases are essential for porcine reproductive and respiratory syndrome virus RNA synthesis. J. Gen. Virol. 2008, 89 Pt 2, 494–499. [Google Scholar] [CrossRef]
- Wang, T.-Y.; Fang, Q.-Q.; Cong, F.; Liu, Y.-G.; Wang, H.-M.; Zhang, H.-L.; Tian, Z.-J.; Tang, Y.-D.; Cai, X.-H. The Nsp12-coding region of type 2 PRRSV is required for viral subgenomic mRNA synthesis. Emerg. Microbes Infect. 2019, 8, 1501–1510. [Google Scholar] [CrossRef] [PubMed]
- Lu, Z.; Zhang, J.; Huang, C.M.; Go, Y.Y.; Faaberg, K.S.; Rowland, R.R.; Timoney, P.J.; Balasuriya, U.B. Chimeric viruses containing the N-terminal ectodomains of GP5 and M proteins of porcine reproductive and respiratory syndrome virus do not change the cellular tropism of equine arteritis virus. Virology 2012, 432, 99–109. [Google Scholar] [CrossRef] [PubMed]
- Wang, L.; Zhang, K.; Lin, H.; Li, W.; Wen, J.; Zhang, J.; Zhang, Y.; Li, X.; Zhong, F. Preparation of North American type II PRRSV infectious clone expressing green fluorescent protein. Biomed. Res. Int. 2014, 2014, 368581. [Google Scholar] [CrossRef]
- Groot Bramel-Verheije, M.H.; Rottier, P.J.; Meulenberg, J.J. Expression of a foreign epitope by porcine reproductive and respiratory syndrome virus. Virology 2000, 278, 380–389. [Google Scholar] [CrossRef]
- Pei, Y.; Hodgins, D.C.; Wu, J.; Welch, S.K.; Calvert, J.G.; Li, G.; Du, Y.; Song, C.; Yoo, D. Porcine reproductive and respiratory syndrome virus as a vector: Immunogenicity of green fluorescent protein and porcine circovirus type 2 capsid expressed from dedicated subgenomic RNAs. Virology 2009, 389, 91–99. [Google Scholar] [CrossRef]
- Ansari, I.H.; Kwon, B.; Osorio, F.A.; Pattnaik, A.K. Influence of N-linked glycosylation of porcine reproductive and respiratory syndrome virus GP5 on virus infectivity, antigenicity, and ability to induce neutralizing antibodies. J. Virol. 2006, 80, 3994–4004. [Google Scholar] [CrossRef]
- Ren, X.; Yang, Z.; Mao, D.; Chang, Z.; Qiao, H.-H.; Wang, X.; Sun, J.; Hu, Q.; Cui, Y.; Liu, L.-P.; et al. Performance of the Cas9 Nickase System inDrosophila melanogaster. G3 Genes Genomes Genet. 2014, 4, 1955–1962. [Google Scholar] [CrossRef]






| Primer Name | Sequence (5′–3′) |
|---|---|
| WUH3-F1 | ATGACGTATAGGTGTTGGCTCTA |
| WUH3-R1 | GCAACGTCCACCGGAGTGGCTC |
| WUH3-F2 | GAGCCACTCCGGTGGACGTTGC |
| WUH3-R2 | ACCATCCGGTTCGCGATGGCG |
| WUH3-F3 | CGCCATCGCGAACCGGATGGT |
| WUH3-R3 | CTTTAGTCCATTCAGCTGGGC |
| WUH3-F4 | GCCCAGCTGAATGGACTAAAG |
| WUH3-R4 | CTCCAGTTCTTTGGCAGTC |
| WUH3-F5 | GACTGCCAAAGAACTGGAG |
| WUH3-R5 | CACAGCAAGATAGAACGGCAC |
| WUH3-F6 | TGTGTGCGTCAACTTTACC |
| WUH3-R6 | TTTTTTTTTTAATTACGGCCGCATGGTTCTC |
| pCMV-F | CATGCGGCCGTAATTAAAAAAAAAAAAAAAAAAAAAAAAAAAGGCCGGCATGG |
| pCMV-R | TAGAGCCAACACCTATACGTCATCCGACGGTACCGGGTACCGTTTC |
| Oligo Name | Sequence (5′–3′) |
|---|---|
| ssDNAa-ORF1b | TTAATACGACTCACTATAGGGATGTCAAAGGTACCACCGTGTTTTAGAGCTAGA |
| ssDNAb-ORF2a | TTAATACGACTCACTATAGGGAAGAGTACAAGAAGCTGCAAGTTTTAGAGCTAGA |
| ORF1b-F | CATCGGCGATGTCAAAGGTACC |
| ORF1b-mR | CCTCGCCCTTGCTCACCATTCAATTCAGGCCTAAAGTTG |
| EGFP-F | CAACTTTAGGCCTGAATTGAATGGTGAGCAAGGGCGAGG |
| EGFP-R | CGTTCCGCTGAAACTCTGGTTAAAGGGGTTGCCGCGGAACTTACTTGTACAGCTCGTCCATGC |
| ORF2-mF | CCAGAGTTTCAGCGGAACGAATGAAATGGGGTCTATGCAAAGC |
| ORF2-R | GCACAACAAAAAGAGTACAAGAAGCTGC |
| ssDNA-scaffold | AAAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC |
| ssDNAa-nsp1α | TTAATACGACTCACTATAGGGGTTTGTCACTCACATGCAGTTTTAGAGCTAGA |
| ssDNAb-nsp1α | TTAATACGACTCACTATAGGGTAACACATGAGTTGCTCCCGTTTTAGAGCTAGA |
| nsp1α-K150Q-F | CGCCAACTCCCTGCATGTGAGTGACCAGCCTTTCCCGGGAGCAACTCATG |
| nsp1α-K150Q-R | GGTTAACACATGAGTTGCTCCCGGGAAAG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhang, H.; Duan, K.; Du, Y.; Xiao, S.; Fang, L.; Zhou, Y. One-Step Assembly of a PRRSV Infectious cDNA Clone and a Convenient CRISPR/Cas9-Based Gene-Editing Technology for Manipulation of PRRSV Genome. Viruses 2023, 15, 1816. https://doi.org/10.3390/v15091816
Zhang H, Duan K, Du Y, Xiao S, Fang L, Zhou Y. One-Step Assembly of a PRRSV Infectious cDNA Clone and a Convenient CRISPR/Cas9-Based Gene-Editing Technology for Manipulation of PRRSV Genome. Viruses. 2023; 15(9):1816. https://doi.org/10.3390/v15091816
Chicago/Turabian StyleZhang, Hejin, Kaiqi Duan, Yingbin Du, Shaobo Xiao, Liurong Fang, and Yanrong Zhou. 2023. "One-Step Assembly of a PRRSV Infectious cDNA Clone and a Convenient CRISPR/Cas9-Based Gene-Editing Technology for Manipulation of PRRSV Genome" Viruses 15, no. 9: 1816. https://doi.org/10.3390/v15091816
APA StyleZhang, H., Duan, K., Du, Y., Xiao, S., Fang, L., & Zhou, Y. (2023). One-Step Assembly of a PRRSV Infectious cDNA Clone and a Convenient CRISPR/Cas9-Based Gene-Editing Technology for Manipulation of PRRSV Genome. Viruses, 15(9), 1816. https://doi.org/10.3390/v15091816

