Oncolytic Avian Reovirus σA-Modulated Upregulation of the HIF-1α/C-myc/glut1 Pathway to Produce More Energy in Different Cancer Cell Lines Benefiting Virus Replication
Abstract
:1. Introduction
2. Materials and Methods
2.1. Virus and Cells
2.2. Antibodies
2.3. shRNA and Plasmid Construction
2.4. Quantitative Real Time RT-PCR
2.5. Transient Transfection
2.6. Trypan Blue Dye Staining
2.7. Western Blot Assays
2.8. Determination of Virus Titer
2.9. FRET-Based Senetically Encoded Indicators (Ateam)
2.10. Statistical Analysis
3. Results
3.1. ARV Replication in Three Cancer Cell Lines
3.2. ARV Infection and σA Transfection Increased c-myc, HIF-1α, and glut1 in Cancer Cell Lines
3.3. ARV σA Protein Upregulates c-myc, HIF-1α, and glut1 in mRNA Level
3.4. Inhibition of c-myc or HIF-1α and Overexpression of σA Reduce the Virus Yield in Cancer Cell Lines
3.5. Visualization of Adenosine Triphosphate (ATP) Levels Inside Cells Infected with ARV in Cancer Cell Lines
3.6. ARV Infection and pCI-neo-σA Transfection Alter Levels of LDHA, PKM2, OGDH, and Gls in Cancer Cell Lines
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Ferlay, J.; Colombet, M.; Soerjomataram, I.; Parkin, D.M.; Piñeros, M.; Znaor, A.; Bray, F. Cancer statistics for the year 2020: An overview. Int. J. Cancer 2021, 149, 778–789. [Google Scholar] [CrossRef] [PubMed]
- Russell, S.J.; Peng, K.W.; Bell, J.C. Oncolytic virotherapy. Nat. Biotechnol. 2012, 30, 658–670. [Google Scholar] [CrossRef]
- DeBerardinis, R.J.; Lum, J.J.; Hatzivassiliou, G.; Thompson, C.B. The biology of cancer: Metabolic reprogramming fuels cell growth and proliferation. Cell Metab. 2008, 7, 11–20. [Google Scholar] [CrossRef] [PubMed]
- Boroughs, L.K.; DeBerardinis, R.J. Metabolic pathways promoting cancer cell survival and growth. Nat. Cell Biol. 2015, 17, 351–359. [Google Scholar] [CrossRef] [PubMed]
- Dang, C.V.; Le, A.; Gao, P. MYC-induced cancer cell energy metabolism and therapeutic opportunities. Clin. Cancer Res. 2009, 15, 6479–6483. [Google Scholar] [CrossRef]
- Dang, C.V.; Kim, J.W.; Gao, P.; Yustein, J. The interplay between MYC and HIF in cancer. Nat. Rev. Cancer 2008, 8, 51–56. [Google Scholar] [CrossRef]
- Kozak, R.A.; Hattin, L.; Biondi, M.J.; Corredor, J.C.; Walsh, S.; Xue-Zhong, M.; Manuel, J.; McGilvray, I.D.; Morgenstern, J.; Lusty, E.; et al. Replication and oncolytic activity of an avian orthoreovirus in human hepatocellular carcinoma cells. Viruses 2017, 9, 90. [Google Scholar] [CrossRef]
- Chiu, H.C.; Huang, W.R.; Liao, T.L.; Chi, P.I.; Nielsen, B.L.; Liu, J.H.; Liu, H.-J. Mechanistic insights into avian reovirus p17-modulated suppression of cell cycle CDK–cyclin complexes and enhancement of p53 and cyclin H interaction. J. Biol. Chem. 2018, 293, 12542–12562. [Google Scholar] [CrossRef]
- Cai, R.; Meng, G.; Li, Y.; Wang, W.; Diao, Y.; Zhao, S.; Feng, Q.; Tang, Y. The oncolytic efficacy and safety of avian reovirus and its dynamic distribution in infected mice. Exp. Biol. Med. 2019, 244, 983–991. [Google Scholar] [CrossRef]
- Manocha, E.; Bugatti, A.; Belleri, M.; Zani, A.; Marsico, S.; Caccuri, F.; Presta, M.; Caruso, A. Avian reovirus P17 suppresses angiogenesis by promoting DPP4 secretion. Cells 2021, 10, 259. [Google Scholar] [CrossRef]
- Comins, C.; Simpson, G.R.; Relph, K.; Harrington, K.J.; Melcher, A.; Pandha, H. Reoviral therapy for cancer: Strategies for improving antitumor efficacy using radio-and chemotherapy. In Gene Therapy of Cancer; Elsevier: Amsterdam, The Netherlands, 2014; pp. 185–198. [Google Scholar]
- Fukuhara, H.; Ino, Y.; Todo, T. Oncolytic virus therapy: A new era of cancer treatment at dawn. Cancer Sci. 2016, 107, 1373–1379. [Google Scholar] [CrossRef] [PubMed]
- Varela, R.; Benavente, J. Protein coding assignment of avian reovirus strain S1133. J. Virol. 1994, 68, 6775–6777. [Google Scholar] [CrossRef] [PubMed]
- Huang, W.R.; Chi, P.I.; Chiu, H.C.; Hsu, J.L.; Nielsen, B.L.; Liao, T.L.; Liu, H.-J. Avian reovirus p17 and σA act cooperatively to downregulate Akt by suppressing mTORC2 and CDK2/cyclin A2 and upregulating proteasome PSMB6. Sci. Rep. 2017, 7, 5226. [Google Scholar] [CrossRef] [PubMed]
- Huang, W.R.; Chiu, H.C.; Liao, T.L.; Chuang, K.P.; Shih, W.L.; Liu, H.J. Avian reovirus protein p17 functions as a nucleoporin Tpr suppressor leading to activation of p53, p21 and PTEN and inactivation of PI3K/AKT/mTOR and ERK signaling pathways. PLoS ONE 2015, 10, e0133699. [Google Scholar] [CrossRef]
- Chi, P.I.; Huang, W.R.; Chiu, H.C.; Li, J.Y.; Nielsen, B.L.; Liu, H.J. Avian reovirus σ A-modulated suppression of lactate dehydrogenase and upregulation of glutaminolysis and the mTOC1/eIF4E/HIF-1α pathway to enhance glycolysis and the TCA cycle for virus replication. Cell. Microbiol. 2018, 20, e12946. [Google Scholar] [CrossRef]
- Hsu, C.Y.; Chen, Y.H.; Huang, W.U.; Huang, J.W.; Chen, I.C.; Chang, Y.K.; Wang, C.Y.; Wang, C.-Y.; Chang, C.-D.; Liao, T.-L.; et al. Oncolytic avian reovirus σA-modulated fatty acid metabolism through the PSMB6/Akt/SREBP1/acetyl-CoA carboxylase pathway to increase energy production for virus replication. Vet. Microbiol. 2022, 273, 109545. [Google Scholar] [CrossRef]
- Imamura, H.; Nhat, K.P.; Togawa, H.; Saito, K.; Iino, R.; Yasuyuki, K.Y.; Nagai, T.; Noji, H. Visualization of ATP levels inside single living cells with fluorescence resonance energy transfer-based genetically encoded indicators. Proc. Natl. Acad. Sci. USA 2009, 106, 15651–15656. [Google Scholar] [CrossRef]
- Kelly, E.; Russell, S.J. History of oncolytic viruses: Genesis to genetic engineering. Mol. Ther. 2007, 15, 651–659. [Google Scholar] [CrossRef]
- Mahalingam, D.; Wilkinson, G.A.; Eng, K.H.; Fields, P.; Raber, P.; Moseley, J.L.; Cheetham, K.; Coffey, M.; Nuovo, G.; Kalinski, P.; et al. Pembrolizumab in combination with the oncolytic virus pelareorep and chemotherapy in patients with advanced pancreatic adenocarcinoma: A phase 1b study. Clin. Cancer Res. 2020, 26, 71–81. [Google Scholar] [CrossRef]
- Su, M.A.; Huang, Y.T.; Chen, I.T.; Lee, D.Y.; Hsieh, Y.C.; Li, C.Y.; Ng, T.H.; Liang, S.-Y.; Lin, S.-Y.; Huang, S.-W.; et al. An invertebrate Warburg effect: A shrimp virus achieves successful replication by altering the host metabolome via the PI3K-Akt-mTOR pathway. PLoS Pathog. 2014, 10, e1004196. [Google Scholar] [CrossRef] [Green Version]
- Thai, M.; Graham, N.A.; Braas, D.; Nehil, M.; Komisopoulou, E.; Kurdistani, S.K.; McCormick, F.; Graeber, T.G.; Christofk, H.R. Adenovirus E4ORF1-induced MYC activation promotes host cell anabolic glucose metabolism and virus replication. Cell Metab. 2014, 19, 694–701. [Google Scholar] [CrossRef] [PubMed]
- Sanchez, E.L.; Lagunoff, M. Viral activation of cellular metabolism. Virology 2015, 479, 609–618. [Google Scholar] [CrossRef]
- Lien, E.C.; Lyssiotis, C.A.; Cantley, L.C. Metabolic reprogramming by the PI3K-Akt-mTOR pathway in cancer. Metab. Cancer 2016, 207, 39–72. [Google Scholar]
- Chi, P.I.; Huang, W.R.; Lai, I.; Cheng, C.Y.; Liu, H.J. The p17 nonstructural protein of avian reovirus triggers autophagy enhancing virus replication via activation of phosphatase and tensin deleted on chromosome 10 (PTEN) and AMP-activated protein kinase (AMPK), as well as dsRNA-dependent protein kinase (PKR)/eIF2α signaling pathways. J. Biol. Chem. 2013, 288, 3571–3584. [Google Scholar]
- Li, J.Y.; Huang, W.R.; Liao, T.L.; Nielsen, B.L.; Liu, H.J. Oncolytic avian reovirus p17-modulated inhibition of mTORC1 by enhancement of endogenous mTORC1 inhibitors binding to mTORC1 to disrupt its assembly and accumulation on lysosomes. J. Virol. 2022, 96, e0083622. [Google Scholar] [CrossRef]
- Kobayashi, Y.; Banno, K.; Kunitomi, H.; Takahashi, T.; Takeda, T.; Nakamura, K.; Tsuji, K.; Tominaga, E.; Aoki, D. Warburg effect in Gynecologic cancers. J. Obstet. Gynaecol. Res. 2019, 45, 542–548. [Google Scholar] [CrossRef]
- Thaker, S.K.; Ch’ng, J.; Christofk, H.R. Viral hijacking of cellular metabolism. BMC Biol. 2019, 17, 59. [Google Scholar] [CrossRef]
- Schwartz, L.; Supuran, C.T.; Alfarouk, K.O. The Warburg effect and the hallmarks of cancer. Anticancer Agents Med. Chem. 2017, 17, 164–170. [Google Scholar] [CrossRef] [PubMed]
- Liberti, M.V.; Locasale, J.W. The Warburg effect: How does it benefit cancer cells? Trends Biochem. Sci. 2016, 41, 211–218. [Google Scholar] [CrossRef]
- Greseth, M.D.; Traktman, P. De novo fatty acid biosynthesis contributes significantly to establishment of a bioenergetically favorable environment for vaccinia virus infection. PLoS Pathog. 2014, 10, e1004021. [Google Scholar] [CrossRef]
- Mazzon, M.; Peters, N.E.; Loenarz, C.; Krysztofinska, E.M.; Ember, S.W.; Ferguson, B.J.; Smith, G.L. A mechanism for induction of a hypoxic response by vaccinia virus. Proc. Natl. Acad. Sci. USA 2013, 110, 12444–12449. [Google Scholar] [CrossRef] [PubMed]
- Fontaine, K.A.; Sanchez, E.L.; Camarda, R.; Lagunoff, M. Dengue virus induces and requires glycolysis for optimal replication. J. Virol. 2015, 89, 2358–2366. [Google Scholar] [CrossRef] [Green Version]
- Abrantes, J.L.; Alves, C.M.; Costa, J.; Almeida, F.C.; Mauro, S.P.; Fontes, C.F.L.; Souza, T.M.L. Herpes simplex type 1 activates glycolysis through engagement of the enzyme 6-phosphofructo-1-kinase (PFK-1). Biochim. Biophys. Acta BBA Mol. Basis Dis. 2012, 1822, 1198–1206. [Google Scholar] [CrossRef]
- Chambers, J.W.; Maguire, T.G.; Alwine, J.C. Glutamine metabolism is essential for human cytomegalovirus infection. J. Virol. 2010, 84, 1867–1873. [Google Scholar] [CrossRef] [PubMed]
- Yu, Y.; Maguire, T.G.; Alwine, J.C. ChREBP, a glucose-responsive transcriptional factor, enhances glucose metabolism to support biosynthesis in human cytomegalovirus-infected cells. Proc. Natl. Acad. Sci. USA 2014, 111, 1951–1956. [Google Scholar] [CrossRef] [PubMed]
- Vastag, L.; Koyuncu, E.; Grady, S.L.; Shenk, T.E.; Rabinowitz, J.D. Divergent effects of human cytomegalovirus and herpes simplex virus-1 on cellular metabolism. PLoS Pathog. 2011, 7, e1002124. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Gene | Sequences (5′–3′) | Expected Size (bp) |
---|---|---|
HIF-1α | F: ATGAAGTGTACCCTAACTAGCCG R: GCTTGAGTTTCAACCCAGACATA | 452 |
c-myc | F: ATGCCCCTCAACGTGAACTTC R: GTCGCAGATGAAATAGGGCTG | 183 |
glut1 | F: ACTGGGCAAGTCCTTTGAGAT R: GTCCTTGTTGCCCATGATGGA | 213 |
β-actin | F: TTAAGGAGAAGCTGTGCTACG R: GTTGAAGGTAGTTTCGTGGAT | 208 |
LDHA | F: GCCCTCAGGAGGCTATACTT R: GCAAGTTCATCTGCCAAGTCC | 225 |
PKM2 | F: CCCGATCTGTGGAGATGCTG R: CGGATCTCAGGTCCCTTTGT | 196 |
OGDH | F: GCTAGTCTCTTCCTTGACTG R: AACTTACTCATGCCATTGTC | 184 |
Gls | F: GCTGTGTTCCATTGAGGTGAC R: ACTCGCTCGCCTGTGATTG | 93 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Hsu, C.-Y.; Huang, J.-W.; Huang, W.-R.; Chen, I.-C.; Chen, M.-S.; Liao, T.-L.; Chang, Y.-K.; Munir, M.; Liu, H.-J. Oncolytic Avian Reovirus σA-Modulated Upregulation of the HIF-1α/C-myc/glut1 Pathway to Produce More Energy in Different Cancer Cell Lines Benefiting Virus Replication. Viruses 2023, 15, 523. https://doi.org/10.3390/v15020523
Hsu C-Y, Huang J-W, Huang W-R, Chen I-C, Chen M-S, Liao T-L, Chang Y-K, Munir M, Liu H-J. Oncolytic Avian Reovirus σA-Modulated Upregulation of the HIF-1α/C-myc/glut1 Pathway to Produce More Energy in Different Cancer Cell Lines Benefiting Virus Replication. Viruses. 2023; 15(2):523. https://doi.org/10.3390/v15020523
Chicago/Turabian StyleHsu, Chao-Yu, Jing-Wen Huang, Wei-Ru Huang, I-Chun Chen, Ming-Shan Chen, Tsai-Ling Liao, Yu-Kang Chang, Muhammad Munir, and Hung-Jen Liu. 2023. "Oncolytic Avian Reovirus σA-Modulated Upregulation of the HIF-1α/C-myc/glut1 Pathway to Produce More Energy in Different Cancer Cell Lines Benefiting Virus Replication" Viruses 15, no. 2: 523. https://doi.org/10.3390/v15020523
APA StyleHsu, C.-Y., Huang, J.-W., Huang, W.-R., Chen, I.-C., Chen, M.-S., Liao, T.-L., Chang, Y.-K., Munir, M., & Liu, H.-J. (2023). Oncolytic Avian Reovirus σA-Modulated Upregulation of the HIF-1α/C-myc/glut1 Pathway to Produce More Energy in Different Cancer Cell Lines Benefiting Virus Replication. Viruses, 15(2), 523. https://doi.org/10.3390/v15020523