Next Article in Journal
Immunostimulatory Profile of Cancer Cell Death by the AdV-Lumc007-Derived Oncolytic Virus ‘GoraVir’ in Cultured Pancreatic Cancer Cells
Previous Article in Journal
Differences in Genetic Diversity of Mammalian Tick-Borne Flaviviruses
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Review

Pepper Mild Mottle Virus: An Infectious Pathogen in Pepper Production and a Potential Indicator of Domestic Water Quality

1
National Agrobiodiversity Center, National Institute of Agricultural Sciences, Rural Development Administration (RDA), Jeonju 54874, Republic of Korea
2
Plant Genetic Resources Research Institute, Council for Scientific and Industrial Research, Bunso P.O. Box 7, Ghana
*
Author to whom correspondence should be addressed.
Viruses 2023, 15(2), 282; https://doi.org/10.3390/v15020282
Submission received: 9 December 2022 / Revised: 16 January 2023 / Accepted: 17 January 2023 / Published: 19 January 2023
(This article belongs to the Section Viruses of Plants, Fungi and Protozoa)

Abstract

Pepper (Capsicum spp.; Family: Solanaceae; 2n = 24) is an important crop cultivated worldwide for the consumption of its fresh and dried processed fruits. Pepper fruits are used as raw materials in a wide variety of industrial processes. As a multipurpose vegetable crop, there is a need to increase the yield. However, yield productivity of pepper is severely constrained by infectious plant pathogens, including viruses, bacteria, fungi, and oomycetes. The pepper mild mottle virus (PMMoV) is currently one of the most damaging pathogens associated with yield losses in pepper production worldwide. In addition to impacts on pepper productivity, PMMoV has been detected in domestic and aquatic water resources, as well as in the excreta of animals, including humans. Therefore, PMMoV has been suggested as a potential indicator of domestic water quality. These findings present additional concerns and trigger the need to control the infectious pathogen in crop production. This review provides an overview of the distribution, economic impacts, management, and genome sequence variation of some isolates of PMMoV. We also describe genetic resources available for crop breeding against PMMoV.

1. Introduction

Vegetable crops are rich sources of basic food nutrients, including vitamins, minerals, and dietary fiber, as well as several antioxidant compounds required for human health [1]. Pepper (Capsicum spp.; family: Solanaceae) is one of the most important vegetable crops globally, and is widely cultivated for the consumption of its fruits, either fresh, dehydrated, or processed in spicy condiments [2]. As a versatile crop, pepper is widely cultivated in diverse climatic conditions in both fields and protected environments. At the global and regional scales, fresh pepper fruits and processed products are highly traded, making cultivation of the crop an important source of employment for many people, especially smallholder farmers around the world [3]. The crop is in demand for industrial uses, especially for the extraction of useful volatile molecules or compounds, including capsaicin, carotenoids, and tocopherol compounds, and for use as an ingredient in agrofoods, cosmetics, food preservatives, additives, antimicrobial preparations, and pharmaceuticals [2]. Therefore, it is important to increase the pepper fruit yield. However, the success of pepper cultivation in relation to productivity of the fruits is influenced by environmental conditions, which can place stress on the crop, leading to fruit yield loss and quality reduction [4]. Abiotic and biotic conditions are major environmental threats that limit the yield of vegetable crop species, and efforts to control the associated impacts usually require an investment of resources leading to increased production costs. Fruit yield loss in pepper continues to be recorded in many growing areas, which is largely attributed to a wide array of phytopathogens [5]. Pepper plants are susceptible to different plant pathogens, including viruses, bacteria, fungi, nematodes, oomycetes, and viroids. Plant viruses are economically important pathogens that are responsible for severe yield reduction and reduced marketable fruit quality, especially deformed fruits in cultivated pepper species such as C. annuum, C. frutescens, C. chinense, and C. chacoense. Among the various groups of viruses, members of the genus Tobamovirus in the family Virgaviridae are among the most deleterious pathogens, and account for injurious yield losses and reduced fruit quality in pepper production worldwide [5,6]. Pepper mild mottle virus (PMMoV) is a frequently detected plant virus in domestic and aquatic water resources as well as in human and other animal excreta, and it has therefore been suggested as a potential indicator for assessing global water quality [7,8]. The cultivation of pepper genotypes with inherent or conferred resistance against pathotypes of PMMoV is one of the best approaches for enhancing crop yields. Previous studies of pepper identified the L locus as containing allelic genes (L1–L4) for resistance against PMMoV in pepper plants [9]. However, the resistance of pepper plants to the virus differs between viral strains [10], and as the diversity of viral strains coupled with the emergence of more virulent strains or exposure to higher concentrations of the virus can overcome host resistance, it is essential to explore, identify, and utilize novel resistance mechanisms for breeding resilient genotypes [11]. Controlling PMMoV is essential to promote the worldwide development of pepper production. To help control the negative impacts of PMMoV on pepper production, this review presents an overview of the nature of the pathogen in terms of its distribution, economic impacts, management, and genome sequence variation of different isolates, as well as available genetic resources for future breeding.

2. The Genus Tobamovirus

Among the various genera, the tobamoviruses include several well-characterized plant viruses (Table 1) containing a positive-sense single-stranded RNA (ssRNA+) genome [9]. The genome of tobamoviruses has a 5′-capped RNA containing four open reading frames that encode a replication protein (~130 kDa), a read-through product (~180 kDa), nonstructural cell-to-cell movement proteins (30 kDa), and a coat protein (CP; 17.5 kDa) [10,12]. The encoded proteins vary across different strains andisolates (Table 1). The replication protein has a methyltransferase-like domain responsible for the 5′ capping of progeny RNAs and an RNA helicase-like domain, whereas the read-through protein contains an RNA-dependent RNA polymerase-like (RdRp) domain [13,14]. The genus Tobamovirus is evolutionarily diverse and comprises several highly damaging plant viruses, such as PMMoV, cucumber green mottle mosaic virus, and tomato brown rugose fruit virus (Table 1, Figure 1).

3. Genome Sequence Variationof PMMoVIsolates

PMMoV has a monopartite genome [51], consisting of a single RNA molecule that is protected in a shell or capsid. The capsid is composed of proteins that form a the rod-shaped virion of the virus [7]. The virion contains a nonenvelopedssRNA+ genome [52,53]. The first complete genome sequence of PMMoV (Isolate: PMMoV-S) was reported in 1991 [54]. Several experiments have since been conducted to provide information about the complete genome sequencing of PMMoV isolates (Table 2, Figure 2). Complete genome sequencing projects of PMMoV have revealed the presence of variation among different isolates in terms of nucleotide sequence length (Table 2). The genome of PMMoV encodes four different types of proteins: replication-associated proteins (126 kDa and 183 kDa), a movement protein (30 kDa), and a CP (17 kDa) [10,52,55]. Given the challenges regarding the mechanisms of controllingplant viruses, their dynamic and evolvability nature, it is vital to understand the evolutionary relationships among different isolates of the PMMoV pathogen. This knowledge will provide important information for understanding the genetic or mutations associated with resistance-breaking ability of PMMoV strains or isolates, and efficiency of diagnostic tools to use. In addition, knowledge on evolutionary relationships among different pathogen isolates is significant for disease management, germplasm evaluation and crop breeding. Phylogenetic trees based on sequences of coat proteins of different PMMoV isolates whose genomes have been completely sequenced are shown in Figure 2.

4. Host Range and Symptoms Associated with PMMoV

Members of the genus Tobamovirus are capable of infecting different Solanaceae species, including tomato, tobacco, and eggplant. Although PMMoV infects species of pepper and tobacco, other susceptible hosts, such as Dracaenabraunii [73], tomato [1], and Parispolyphylla var. yunnanensis [72], have been reported. Symptomsof infection by PMMoV occurmainly on leaves and fruits (53). At the early stage of infection, plants generally show mild foliar mosaicism. Infected plant leaves subsequently develop mottled, deformed, and chlorotic features [74] (Figure 3A–C). In severe infections, especially those occurring at the early stage of growth, affected plants become stunted, resulting in reduced yields [55]. Fruits of affected plants are decreased in size and appear deformed, necrotic, mosaic, and lumpy or blistered (Figure 3D), thus reducing their market value. The symptoms of PMMoV-affected plants are usually more prominent when infection occurs at the early stages of plant growth. Severe yield losses are likely to occur if an infection is not detected early [59].

5. Mode of PMMoV Transmission in Plants

PMMoV can be transmitted mechanically via contact with contaminated sources, including working equipment such as gloves and workers’ clothing, during normal crop management. The pathogen is both seed- and soil-borne and can be transmitted through the use of contaminated seeds in planting as well as planting in infected soils. On seeds, PMMoV occurs on the outer coat of the seed and is transmitted nonembryonically [69]. As the pathogen is seed-borne, it can be easily introduced across different environments, which is likely the reason for the spread of the pathogen in many pepper-growing areas. Wounds and microscopic abrasions on seeds or plant parts facilitate viral entry into the host. PMMoV can remain stable and serve as inocula when adsorbed on plant debris (leaves, stems, and roots), soil, humus, greenhouse structures, and working tools for prolonged periods.

6. Global Distribution and Economic Importance of PMMoV

Overall, plant viral diseases account for considerable yield losses and the severity of their impacts on crop production can be accelerated by changing patterns of climate, international trade, and pathogen adaptation for rapid evolution [75]. Globally, annual crop yield losses resulting from plant viruses in the form of small-scale yield reductions to total crop failure havebeen estimated to have a value of more than USD 30 billion [76]. In the early half of the 1950s, PMMoV was described for the first time as a latent strain of tobacco mosaic virus in the USA [77]. In 1984, PMMoV was first described in the literature by an Italian group as a distinct virus [78]. Currently, disease incidences associated with the pathogen are spread across different parts of the world (Table 2). PMMoV is particularly adapted to survive under extreme conditions, such as warm, hot, and humid climates. The fast-spreading nature of the pathogen poses a serious threat to pepper cultivation and food security. In addition, the broad scope of PMMoV isolates is indicative of the pathogen’s exceptional adaptation, which may enable some strains to easily overcome known resistance genes and even expand their host range. Meanwhile, the severity of impacts resulting from PMMoV infection in pepper differs according to the isolate, host species, and the stage of plant growth during which the infection occurs. The disease incidence resulting from PMMoV infection in commercial bell pepper fields in Florida, USA varied from <1% to 30% [79]. In another study in Grady County, Georgia, USA, an entire jalapeno pepper (Capsicum annuum L.) field was reported to have been devastated by PMMoV [80]. Fruits of infected plants were deformed, mottled, reduced in size, and had off-colored sunken parts.

7. Management of Pepper Mild Mottle Virus (PMMoV)

Diseases originating from PMMoV infections are exceptionally difficult to control when they occur. Once infected with PMMoV, it becomes extremely difficult to recover plants using chemical or physical treatments [81]. Therefore, to control infections with and the spread of PMMoV, growers must observe good cultural and sanitation practices in their production systems. Avoiding sources of infection by the disinfection of working tools and removal and destruction of infected plants can help to control the spread of the pathogen. Working tools or equipment and stakes must be disinfected to minimize possible transmission. The pathogen is seed-borne; therefore, clean seeds must be used to establish pepper production. Sanitary certification and cross-protection management are important factors to control PMMoV. Care must also be taken to avoid abrasions and induced wounds on plant parts, as this is ideal for viral entry into host tissues. It is also essential to gain an understanding of which weed species can act as hosts of the virus. In addition, the genetic relationships among existing strains of PMMoV must be studied to facilitate accurate diagnosis in research. Knowledge about causal agents and symptoms associated with the virus as well as regular inspection of plants for the early detection of PMMoV infection are required. Under less severe conditions, plants showing noticeable symptomsof viral infection and adjacent plants should be removed immediately, but care must be taken to avoid touching healthy plants with contaminated hands or tools. Rotation with resistant crops and sterilizing soils before planting for greenhouse cultivation are good practices to break the disease cycle via inocula from plant debris [82]. The planting of resistant pepper genotypes is also highly recommended.

8. Genetic and Gene Resources for Resistance Breeding against PMMoV

8.1. Diversity of L Resistance Genes and PMMoV Pathotypes

Due to the rapid spread and damaging nature of PMMoV, it is necessary to incorporate resistance alleles from PMMoV-resistant cultivars into the genome of commonly cultivated peppers. The L genes (L1L4) that functionally control resistance of peppers to tobamovirusesdiffers across different pepper species and cultivars. Based on differences in the L gene allele, Capsicum species have been divided into L1, L2, L3, and L4 classes [10]. On the other hand, tobamoviruses are classified into four pathotypes—P0, P1, P1.2, and P1.2.3—according to their ability to systemically infect Capsicum species carrying L gene alleles L1, L2, L3, and L4, respectively [10,83]. Following infection, the PMMoV CP induces expression of the L genes and thus induces a HR in the host plant [84]. Two L gene alleles, L3 and L4, confer high degrees of resistance to PMMoV. Pepper plants harboring the L3 gene show resistance to the P1.2 pathotype but are susceptible to P1.2.3. Plants that have the L4 geneshow resistance to these two pathotypes and have a broader scope of resistance against tobamoviruses. The crop germplasm represents a significant tool for identifying disease resistance genotypes for crop breeding. Extensive screening of diverse accessions to identify PMMoV-resistant resources has been conducted using various gene markers (Table 3). Although commercial pepper varieties have been developed that carry L genes that confer resistance to the pathogen, there are strains of PMMoV that can overcome some of these resistance genes. Moreover, previous studies revealed that many host plant species harbor specific genes encoding a protein known as the TOBAMOVIRUS MULTIPLICATION (TOM) susceptibility protein, which interacts with the viral replication protein [85]. The mechanism underlying the host plant–viral protein interaction favorably promotes certain Tobamovirus replication complexes and pathogen multiplication, and leads to effective infectivity on the host. Molecular studies usingthe CRISPR/Cas9-derived suppression of certain host TOM-related genes have been successfully conducted in different plant species, including Arabidopsis, tomato, and tobacco [85], but this technique has not been fully explored for resistance breeding against PMMoV.

8.2. Pepper Genetic Resources with Resistance against PMMoV

Pepper cultivation is widely distributed across the globe, with specific selections conducted over the past several years in different locations, resulting in differences in cultivar adaptation potential in diverse environments. Although pepper has a wide range of cultivars, many cultivated varieties display susceptibility to PMMoV [90]. Germplasm screening is an important means of identifying Capsicum accessions that may contain genes capable of conferring resistance to the virus. Nonetheless, the resistance of Capsicum species to PMMoV differs considerably across different genotypes (Figure 4), with some genotypes succumbing easily to specific strains but showing resistance to other strains (Table 4). This phenomenon can be attributed to the presence of variability in strains or isolates of the pathogen. A comprehensive characterization that combinesphenotyping and genotyping strategies isrequired to identify useful PMMoV-resistant accessions [81]. Thus, pepper breeders screened diverse pepper germplasm resources and identified some accessions with resistance against different PMMoVpathotypes that are useful for further breeding (Table 4).

9. PMMoV as an Indicator of Water Quality

Pepper is the most important spicy vegetable crop, with worldwide consumption of its fresh fruits and processed dry powder, as wellas an ingredient in some industrial consumable products. Strategies to control PMMoV in pepper fields will help to increase fruit yield and reduce the likelihood of water contamination [7]. There are research studies that have confirmed the detection of PMMoV in domestic and aquatic water resources, as well as in the excreta of animals, including humans (Table 5). The pathogen is known to have survival ability in the human gastrointestinal tract, and thus can be transmitted via human excreta [92]. Human immune response and clinical symptoms linked to PMMoV infection have also been investigated experimentally and include fever, abdominal pains, and pruritus (7). Though this finding may be possible, the detected symptoms may also result from other cofactors [93]. The key source of the pathogen’s presence in human excreta has been attributed largely to the consumption of PMMoV-infected pepper and its processed products, while human excreta-derived pollution of water resources is the reason for the presence of the virus in water bodies [94,95,96]). Therefore, the presence of PMMoV in water is currently considered an indicator for water quality assessment [8,97,98,99]. Moreover, the stable nature of PMMoV in water raises additional concerns in relation to their possible transmission via contaminated irrigation water resources [92,100,101].

10. Conclusions

PMMoV is an economically significant pathogen responsible for yield losses in pepper production, and poses a serious threat to agriculture and food sustainability. Detection of the virus in water resources, including aquatic, irrigation, pond, underground, and domestic water, as well as in the excreta of animals, including humans, raises additional concerns requiring extensive research to develop solutions that can circumvent potential risks associated with the pathogen in relation to human health. The application of molecular breeding techniques has prospects for the development of new cultivars that are resilient against PMMoV. Mutagenesis, including physical, chemical, and biological techniques, can be used in combination with next-generation sequencing to explore and exploit beneficial candidate genes for molecular breeding targeting the development of PMMoV-resistant genotypes.

Author Contributions

Conceptualization and design of research, K.O. and O.H.; writing—original draft preparation, K.O. and O.H.; writing—review and editing, H.-C.K., H.-J.W. and B.-S.H. All authors have read and approved the manuscript.

Funding

This work was carried out with the support of “The Cooperative Research Program for Agriculture Science and Technology Development (Project No. PJ014186012022)” National Institute of Agricultural Sciences, RDA, Republic of Korea.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

Not applicable.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Zhou, W.P.; Li, Y.Y.; Li, F.; Tan, G.L. First report of natural infection of tomato by pepper mild mottle virus in China. J. Plant Pathol. 2020, 103, 363. [Google Scholar] [CrossRef] [Scilit]
  2. Baenas, N.; Belović, M.; Ilic, N.; Moreno, D.A.; García-Viguera, C. Industrial use of pepper (Capsicum annum L.) derived products: Technological benefits and biological advantages. Food Chem. 2019, 274, 872–885. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  3. Adeoye, A.E.; Fashogbon, B.A. Analysis of technical efficiency of pepper production among farmers under tropical conditions. Int. J. Veg. Sci. 2014, 20, 124–130. [Google Scholar] [CrossRef] [Scilit]
  4. Parisi, M.; Alioto, D.; Tripodi, P. Overview of Biotic Stresses in Pepper (Capsicum spp.): Sources of Genetic Resistance, Molecular Breeding and Genomics. Int. J. Mol. Sci. 2020, 21, 2587. [Google Scholar] [CrossRef] [Scilit]
  5. Vélez-Olmedo, J.B.; Fribourg, C.E.; Melo, F.L.; Nagata, T.; de Oliveira, A.S.; Resende, R.O. Tobamoviruses of two new species trigger resistance in pepper plants harbouring functional L alleles. J. Gen. Virol. 2021, 102, 001524. [Google Scholar] [CrossRef] [Scilit]
  6. Secrist, K.; Ali, A. FirstComplete Genome Sequence of Pepper mild mottle virus from Chili Pepper in the United States. Genome Announc. 2018, 6, e00331-18. [Google Scholar] [CrossRef] [Scilit]
  7. Kitajima, M.; Sassi, H.P.; Torrey, J.R. Pepper mild mottle virus as a water quality indicator. NPJ Clean Water 1 2018, 1, 19. [Google Scholar] [CrossRef] [Scilit]
  8. Rosario, K.; Symonds, E.M.; Sinigalliano, C.; Stewart, J.; Breitbart, M. Pepper mild mottle virus as an indicator of fecal pollution. Appl. Environ. Microbiol. 2009, 75, 7261–7267. [Google Scholar] [CrossRef] [Scilit]
  9. Adams, M.J.; Antoniw, J.F.; Kreuze, J. Virgaviridae: A new family of rod-shaped plant viruses. Arch. Virol. 2009, 154, 1967–1972. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  10. Choi, S.-K.; Choi, G.-S.; Kwon, S.-J.; Yoon, J.-Y. Complete nucleotide sequences and genome organization of two pepper mild mottle virus isolates from Capsicum annuum in South Korea. Genome Announc. 2016, 4, e00411-16. [Google Scholar] [CrossRef] [Scilit]
  11. Choi, G.-S.; Choi, S.-K.; Cho, I.-S.; Kwon, S.-J. Resistance screening to pepper mild mottle virus pathotypes in paprika cultivars. Res. Plant Dis. 2014, 20, 299–302. [Google Scholar] [CrossRef] [Scilit]
  12. Salgado-Ortíz, H.; De La Torre-Almaraz, R.; Sánchez-Navarro, J.Á.; Pallás, V. Identification and genomic characterization of a novel Tobamovirus from prickly pear cactus. Arch. Virol. 2020, 165, 781–784. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  13. Song, Y.S.; Min, B.E.; Hong, J.S.; Rhie, M.J.; Kim, M.J.; Ryu, K.H. Molecular evidence supporting the confirmation of Maracuja mosaic virus as a species of the genus Tobamovirus and production of an infectious cDNA transcript. Arch. Virol. 2006, 151, 2337–2348. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  14. Conti, G.; Rodriguez, M.C.; Venturuzzi, A.L.; Asurmendi, S. Modulation of host plant immunity by Tobamovirus proteins. Ann. Bot. 2017, 119, 737–747. [Google Scholar] [CrossRef] [Scilit]
  15. Rhie, M.J.; Min, B.E.; Hong, J.S.; Song, Y.S.; Rhu, K.H. Complete genome sequence supports bell pepper mottle virus as a species of the genus Tobamovirus. Arch. Virol. 2007, 152, 1401–1407. [Google Scholar] [CrossRef] [Scilit]
  16. Hamada, H.; Takeuchi, S.; Morita, Y.; Sawadah, H.; Kiba, A.; Hikichi, Y. Characterization of paprika mottle virus first isolated in Japan. J. Gen. Plant Pathol. 2003, 69, 99–204. [Google Scholar] [CrossRef]
  17. Ikeda, R.; Watanabe, E.; Watanabe, Y.; Okada, Y. Nucleotide sequence of Tobamovirus Ob which can spread systemically in N gene tobacco. J. Gen. Viol. 1993, 74, 1939–1944. [Google Scholar] [CrossRef] [Scilit]
  18. Hu, Q.; Jiang, T.; Xue, C.; Zhou, X. Characterization and complete nucleotide sequence of two isolates of tomato mosaic virus. J. Phytopathol. 2011, 160, 115–119. [Google Scholar] [CrossRef] [Scilit]
  19. Chanda, B.; Rivera, Y.; Nunziata, S.O.; Galvez, M.E.; Gilliard, A.; Ling, K.-S. Complete genome sequence of a tomato brown rugose fruit virus isolated in the United States. Microbiol. Resour. Announc. 2020, 9, e00630-20. [Google Scholar] [CrossRef] [Scilit]
  20. Padmanabhan, C.; Zheng, Y.; Li, R.; Martin, G.B.; Fei, Z.; Ling, K.-S. Complete genome sequence of a tomato-infecting tomato mottle mosaic virus in New York. Genome Announc. 2015, 3, e01523-15. [Google Scholar] [CrossRef] [Scilit]
  21. Kim, N.Y.; Lee, H.J.; Kim, N.K.; Kim, H.; Jeong, R.-D. First report of tobacco mosaic virus infecting Hosta longipes in Korea. J. Plant Pathol. 2021, 103, 341. [Google Scholar] [CrossRef] [Scilit]
  22. Solis, I.; Garcia-Arenal, F. The complete nucleotide sequence of the genomic RNA of the Tobamovirus tobacco mild green mosaic virus. Virol. 1990, 177, 553–558. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  23. Crosslin, J.M.; Hamm, P.B.; Kirk, W.W.; Hammond, R.W. Complete genomic sequence of a Tobacco rattle virus isolate from Michigan-grown potatoes. Arch. Virol. 2010, 155, 621–625. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  24. Ladipo, J.; Koenig, R.; Lesemann, D.-E. Nigerian tobacco latent virus: A new Tobamovirus from tobacco in Nigeria. Eur. J. Plant Pathol. 2003, 109, 373–379. [Google Scholar] [CrossRef] [Scilit]
  25. Ilmberger, N.; Willingmann, P.; Adam, G.; Heinze, C.A. Subgroup 1 Tobamovirus isolated from Brugmansia sp. and its Detection by RT-PCR. J. Phytopathol. 2007, 155, 326–332. [Google Scholar] [CrossRef] [Scilit]
  26. Fillmer, K.; Adkins, S.; Pongam, P.; D’Elia, T. The complete nucleotide sequence and genomic characterization of tropical soda apple mosaic virus. Arch. Virol. 2016, 161, 2317–2320. [Google Scholar] [CrossRef] [Scilit]
  27. Uehara-Ichiki, T.; Uke, A.; Hanada, K.; Hishida, A.; Nakazono-Nagaoka, E.; Kodaira, E. Scopolia mild mottle virus: A new Tobamovirus isolated from a Scopolia japonica plant in Japan. Arch. Virol. 2022, 167, 947–951. [Google Scholar] [CrossRef] [Scilit]
  28. Wylie, S.J.; Li, H.; Jones, M.G.K. Yellow tailflower mild mottle virus: A new Tobamovirus described from Anthocercislittorea (Solanaceae) in Western Australia. Arch. Virol. 2013, 159, 791–795. [Google Scholar] [CrossRef] [Scilit]
  29. Antignus, Y.; Wang, Y.; Pearlsman, M.; Lachman, O.; Lavi, N.; Gal-On, A. Biological and molecular characterization of a new cucurbit-infecting Tobamovirus. Phytopathology 2001, 91, 565–571. [Google Scholar] [CrossRef] [Scilit]
  30. Ugaki, M.; Tomiyama, M.; Kakutani, T.; Hidaka, S.; Kiguchi, T.; Nagata, R.; Sato, T.; Motoyoshi, F.; Nishiguchi, M. The complete nucleotide sequence of cucumber green mottle mosaic virus (SH strain) genomic RNA. J. Gen. Virol. 1991, 72, 1487–1495. [Google Scholar] [CrossRef] [Scilit]
  31. Orita, H.; Sakai, J.I.; Kubota, K.; Okuda, M.; Tanaka, Y.; Hanada, K.; Imamura, Y.; Nishiguchi, M.; Karasev, A.V.; Miyata, S.I.; et al. Molecular and serological characterization of Cucumber mottle virus, a new cucurbit-infecting Tobamo-like. Virus. Plant Dis. 2007, 91, 1574–1578. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  32. Yoon, J.Y.; Min, B.E.; Choi, S.H.; Ryu, K.H. Completion of nucleotide sequence and generation of highly infectious transcripts to cucurbits from full-length cDNA clone of Kyuri green mottle mosaic virus. Arch. Virol. 2001, 146, 2085–2096. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  33. Yoon, J.Y.; Min, B.E.; Choi, J.K.; Ryu, K.H. Genome structure and production of biologically active in vitro transcripts of cucurbit-infecting Zucchini green mottle mosaic virus. Phytopathology 2002, 92, 156–163. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  34. Lartey, R.T.; Voss, T.C.; Melcher, U. Completion of a cDNA sequence from a Tobamovirus pathogenic to crucifers. Gene 1995, 166, 331–332. [Google Scholar] [CrossRef] [Scilit]
  35. MacDonald, J.L.; Punja, Z.K.; Xiang, Y.; Bouthillier, M.J.; Reade, R.; DeYoung, R.M.; Bhagwat, B.; Betz, E.C.; Li, Y.Q.; Chen, X. First report of wasabi mottle virus causing ringspot and vein-clearing symptoms on wasabi (Wasabia japonica) in North America. Can. J. Plant Pathol. 2020, 43, 311–322. [Google Scholar] [CrossRef] [Scilit]
  36. Aguilar, I.; Sanchez, F.; Martin, A.M.; Martinez-Herrera, D.; Ponz, F. Nucleotide sequence of Chinese rape mosaic virus (oilseed rape mosaic virus), a crucifer Tobamovirus infectious on Arabidopsis thaliana. Plant Mol. Biol. 1996, 30, 191–197. [Google Scholar] [CrossRef] [Scilit]
  37. Yoshida, T.; Kitazawa, Y.; Komatsu, K.; Neriya, Y.; Ishikawa, K.; Fujita, N.; Hashimoto, M.; Maejima, K.; Yamaji, Y.; Namba, S. Complete nucleotide sequence and genome structure of a Japanese isolate of hibiscus latent Fort Pierce virus, a unique Tobamovirus that contains an internal poly(A) region in its 3′ end. Arch. Virol. 2014, 159, 3161–3165. [Google Scholar] [CrossRef] [Scilit]
  38. Srinivasan, K.G.; Min, B.E.; Ryu, K.H.; Adkins, S.; Wong, S.M. Determination of complete nucleotide sequence of Hibiscus latent Singapore virus: Evidence for the presence of an internal poly (A) tract. Arch. Virol. 2004, 150, 153–166. [Google Scholar] [CrossRef] [Scilit]
  39. Wei, K.; Gibbs, A.; Mackenzie, A. Clitoria yellow mottle virus: A Tobamovirus from Northern Australia. Australas. Plant Dis. Notes 2012, 7, 59–61. [Google Scholar] [CrossRef] [Scilit]
  40. Silver, S.; Quan, S.; Deom, C.M. Completion of the nucleotide sequence of sunn-hemp mosaic virus: A Tobamovirus pathogenic to legumes. Virus Genes 1996, 13, 83–85. [Google Scholar] [CrossRef] [Scilit]
  41. Min, B.E.; Song, Y.S.; Ryu, K.H. Complete sequence and genome structure of cactus mild mottle virus. Arch. Virol. 2009, 154, 1371–1374. [Google Scholar] [CrossRef] [Scilit]
  42. Kim, N.R.; Hong, J.S.; Song, Y.S.; Chung, B.N.; Park, J.W.; Ryu, K.H. The complete genome sequence of a member of a new species of Tobamovirus (rattail cactus necrosis-associated virus) isolated from Aporcactusflagelliformis. Arch. Virol. 2011, 157, 185–187. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  43. Lim, M.A.; Hong, J.S.; Song, Y.S.; Ryu, K.H. The complete genome sequence and genome structure of frangipani mosaic virus. Arch. Virol. 2010, 155, 1543–1546. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  44. Song, Y.S.; Ryu, K.H. The complete genome sequence and genome structure of passion fruit mosaic virus. Arch. Virol. 2011, 156, 1093–1095. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  45. Ryu, K.H.; Park, W.M. The complete nucleotide sequence and genome organization of odontoglossum ringspot Tobamovirus RNA. Arch. Virol. 1995, 140, 1577–1587. [Google Scholar] [CrossRef] [Scilit]
  46. Kumar, A.; Mandal, B. Molecular Characterization of a New Tobamovirus, Plumeria Mosaic Virus. Unpublished. 2015. Available online: https://www.ncbi.nlm.nih.gov/genomes/GenomesGroup.cgi?taxid-12234 (accessed on 8 December 2022).
  47. Zhang, Z.C.; Lei, C.Y.; Zhang, L.F.; Yang, X.X.; Chen, R.; Zhang, D.S. The complete nucleotide sequence of a novel Tobamovirus, Rehmannia mosaic virus. Arch. Virol. 2008, 153, 595–599. [Google Scholar] [CrossRef] [Scilit]
  48. Chavan, R.R.; Cohen, D.; Blouin, A.G.; Pearson, M.N. Characterization of the complete genome of ribgrass mosaic virus isolated from Plantago major L. from New Zealand and Actinidia spp. from China. Arch. Virol. 2012, 157, 1253–1260. [Google Scholar] [CrossRef] [Scilit]
  49. Heinze, C.; Lesemann, D.-E.; Ilmberger, N.; Willingmann, P.; Adam, G. The phylogenetic structure of the cluster of Tobamovirus species serologically related to ribgrass mosaic virus (RMV) and the sequence of Streptocarpus flower break virus (SFBV). Arch. Virol. 2005, 151, 763–774. [Google Scholar] [CrossRef] [Scilit]
  50. Adkins, S.; D’Elia, T.; Fillmer, K.; Pongam, P.; Baker, C.A. Biological and genomic characterization of a novel Tobamovirus infecting Hoya spp. Plant Dis. 2018, 102, 2571–2577. [Google Scholar] [CrossRef] [Scilit]
  51. Koenig, R. Polyhedral Plant Viruses with Monopartite RNA Genomes. In The Plant Viruses. The Viruses; Koenig, R., Ed.; Springer: Boston, MA, USA, 1988. [Google Scholar] [CrossRef] [Scilit]
  52. Berendsen, S.M.H.; Schravesande, W.E.W. Complete genome sequence of a novel genotype of pepper mild mottle virus infecting pepper in Chile. Microbiol 2020, 9, e01183-20. [Google Scholar] [CrossRef] [Scilit]
  53. Yu, M.; Zhou, T.; Wu, Y.; An, M. Complete genome sequence of a pepper mild mottle virus isolate from Northeast China. Genome Announc. 2018, 6, e01500-17. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  54. Alonso, E.; Garcia-Luque, I.; de la Cruz, A.; Wicke, B.; Avila-Rincon, M.J.; Serra, M.T.; Castresana, C.; Diaz-Ruiz, J.R. Nucleotide sequence of the genomic RNA of pepper mild mottle virus, a resistance-breaking Tobamovirus in pepper. J. Gen. Virol. 1991, 72, 2875–2884. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  55. Han, S.-H.; Park, J.-S.; Han, J.-Y.; Gong, J.-S.; Park, C.-H.; Kim, J.-K.; Seo, E.-Y.; Domier, L.L.; Hammond, J.; Lim, H.-S. New Korean isolates of pepper mild mottle virus (PMMoV) differ in symptom severity and subcellular localization of the 126 kDa protein. Virus Genes 2017, 53, 434–445. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  56. Yoon, J.-Y.; Hong, J.-S.; Kim, M.-J.; Ha, J.-H.; Choi, G.-S.; Choi, J.-K.; Ryu, K.-H. Molecular characterization of pepper mild mottle virus Kr strain. Plant Pathol. J. 2005, 21, 361–368. [Google Scholar] [CrossRef] [Scilit]
  57. Velasco, L.; Janssen, D.; Ruiz-Garcia, L.; Segundo, E.; Cuadrado, I.M. The complete nucleotide sequence and development of a differential detection assay for a pepper mild mottle virus (PMMoV) isolate that overcomes L3 resistance in pepper. J. Virol. 2002, 106, 135–140. [Google Scholar] [CrossRef] [Scilit]
  58. Oliveira, L.M.; Inoue-Nagata, A.K.; Nagata, T. Complete genome nucleotide sequence of PMMoV in Brazil. Trop Plant Pathol. 2010, 35, 373–376. [Google Scholar]
  59. Rialch, N.; Sharma, V.; Sharma, A.; Sharma, P.N. Characterization and complete nucleotide sequencing of Pepper Mild Mottle Virus infecting Bell Pepper in India. Phytoparasitica 2015, 43, 327–337. [Google Scholar] [CrossRef] [Scilit]
  60. Leon, Y.; Mejias, A.; Rodriguez-Roman, E.; Marys, E. Molecular and Biological Characterization of Pepper Mild Mottle Virus Isolates from Venezuela (Unpublished). 2015. Available online: https://www.ncbi.nlm.nih.gov/nuccore/KU312319. (accessed on 8 December 2022).
  61. Liu, X.; Tan, Q.; Chen, H.; Liu, M.; Dai, L.; Xiao, Q. Cloning and Sequence Analysis of the Complete Nucleotide Sequence of Pepper Mild Mottle Virus Isolates from Hunan (Unpublished). 2015. Available online: https://www.ncbi.nlm.nih.gov/nuccore/KP345899 (accessed on 8 December 2022).
  62. Wang, X.; Liu, F.; Zhou, G.; Li, X.-H.; Li, Z. Detection and molecular characterization of pepper mild mottle virus in China. J. Phytopathol. 2006, 154, 755–757. [Google Scholar] [CrossRef] [Scilit]
  63. Zhu, H.; Li, X.; Hou, H.; Xu, Q.; An, M. Identification, Whole-Genome Sequencing and Phylogenetic Analysis of Pepper Mild Mottle Virus Fengcheng Isolate (Unpublished). 2016. Available online: https://www.ncbi.nlm.nih.gov/nuccore/KU646837 (accessed on 8 December 2022).
  64. Han, K.; Zheng, H.; Ji, M.; Cui, W.; Hu, S.; Peng, J.; Zhao, J.; Lu, Y.; Lin, L.; Liu, Y.; et al. A single amino acid in coat protein of Pepper mild mottle virus determines its subcellular localization and the chlorosis symptom on leaves of pepper. J. Gen. Virol. 2020, 101, 565–570. [Google Scholar] [CrossRef] [Scilit]
  65. Kirita, M.; Akutsu, K.; Watanabe, Y.; Tsuda, S. Nucleotide Sequence of the Japanese Isolate of Pepper Mild Mottle Tobamovirus (TMV-P) RNA. Jpn. J. Phytopathol. 1997, 63, 373–376. [Google Scholar] [CrossRef] [Scilit]
  66. Hamada, H.; Tomita, R.; Iwadate, Y.; Kobayashi, K.; Munemura, I.; Takeuchi, S.; Hikichi, Y.; Suzuki, K. Cooperative effect of two amino acid mutations in the coat protein of Pepper mild mottle virus overcomes L 3 -mediated resistance in Capsicum plants. Virus Genes 2006, 34, 205–214. [Google Scholar] [CrossRef] [Scilit]
  67. Hagiwara, K.; Ichiki, T.U.; Ogawa, Y.; Omura, T.; Tsuda, S. A single amino acid substitution in 126-kDa protein of pepper mild mottle virus associates with symptoms attenuation in pepper; the complete nucleotide sequence of an attenuated strain, C-1421. Arch. Virol. 2002, 147, 833–840. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  68. Ichiki, T.U.; Nagaoka, E.N.; Hagiwara, K.; Uchikawa, K.; Tsuda, S.; Omura, T. Integration of mutations responsible for the attenuated phenotype of pepper mild mottle virus strains results in a symptomless cross-protecting strain. Arch. Virol. 2005, 150, 2009–2020. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  69. Genda, Y.; Kanda, A.; Hamada, H.; Sato, K.; Ohnishi, J.; Tsuda, S. Two amino acid substitutions in the coat protein of pepper mild mottle virus are responsible for overcoming the L4Gene-mediated resistance in Capsicum spp. Phytopathology 2007, 9, 787–793. [Google Scholar] [CrossRef] [Scilit]
  70. Kwon, S.-J.; Yoon, J.-Y.; Cho, I.-S.; Choi, S.-K.; Choi, G.-S. Phylogenetic analyses of pepper mild mottle virus and Cucumber mosaic virus isolated from Rorippapalustris. Res. Plant Dis. 2016, 22, 25–31. [Google Scholar] [CrossRef] [Scilit]
  71. Moreno-Perez, M.G.; Garcia-Luque, I.; Fraile, A.; Garcia-Arenal, F. Mutations that determine resistance breaking in a plant RNA virus have pleiotropic effects on its fitness that depend on the host environment and on the type, single or mixed, of infection. J. Virol. 2016, 90, 9128–9137. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  72. Wen, G.S.; Yang, L.Y.; Anane, R.F.; Chen, Z.L.; Yang, Y.H.; Chen, L.; Sun, Y.; Zhao, M.F. First report of pepper mild mottle virus in Parispolyphylla var. yunnanensis in China. Plant Dis. 2019, 103, 3289. [Google Scholar] [CrossRef] [Scilit]
  73. Kim, S.-W.; Jeong, Y.; Yang, K.-Y.; Jeong, R.-D. First report of natural infection of Dracaena braunii by pepper mild mottle virus in Korea. J. Plant Pathol. 2022, 1, 1579. [Google Scholar] [CrossRef] [Scilit]
  74. Kim, J.-S.; Lee, S.-H.; Choi, H.-S.; Kim, M.-K.; Kwak, H.-R.; Kim, J.-S.; Nam, M.; Cho, J.-D.; Cho, I.-S.; Choi, G.-S. 2007–2011 Characteristics of plant virus infections on crop samples submitted from agricultural places. Res. Plant Dis. 2012, 18, 277–289. [Google Scholar] [CrossRef] [Scilit]
  75. Jones, R.A.C. Disease Pandemics and Major Epidemics Arising from New Encounters between Indigenous Viruses and Introduced Crops. Viruses 2020, 12, 1388. [Google Scholar] [CrossRef] [Scilit]
  76. Jones, R.A.C.; Naidu, R.A. Global Dimensions of Plant Virus Diseases: Current Status and Future Perspectives. Annu. Rev. Virol. 2019, 6, 387–409. [Google Scholar] [CrossRef] [Scilit]
  77. McKinney, H.H. Two strains of tobacco mosaic virus, one which is seed borne in an etch-immune pungent pepper. Plant Dis. Rep. 1952, 36, 184–187. [Google Scholar]
  78. Wetter, C.; Conti, M.; Altschuh, D.; Tabillion, R.; van Regenmortel, M.H.V. Pepper mild mottle virus, a Tobamovirus infecting pepper cultivars in Sicily. Phytopathology 1984, 74, 405–410. [Google Scholar] [CrossRef] [Scilit]
  79. Adkins, S.; Lamb, E.M.; Roberts, P.D.; Gooch, M.D.; Breman, L.; Shuler, K.D. Identification of pepper mild mottle virus in commercial bell pepper in Florida. Plant Health Prog. 2007, 4, 26. [Google Scholar] [CrossRef] [Scilit]
  80. Martínez-Ochoa, N.; Langston, D.B.; Mullis, S.W.; Flanders, J.T. First report of pepper mild mottle virus in jalapeno pepper in Georgia. Plant Health Prog. 2003, 4, 26. [Google Scholar] [CrossRef] [Scilit]
  81. Hur, O.-S.; Kwak, H.-R.; Ro, N.-Y.; Choi, Y.; Lee, S.; Hwang, A.; Kim, B.; Kim, S.-H.; Hahn, B.-S. Resistance Screening of Capsicum Germplasm to Pepper Mild Mottle Virus (PMMoV) Pathotypes P1,2 and P1,2,3. Korean J. Breed. 2022, 54, 1–7. [Google Scholar] [CrossRef] [Scilit]
  82. Moury, B.; Verdin, E. Viruses of Pepper Crops in the Mediterranean Basin. Viruses and Virus Diseases of Vegetables in the Mediterranean Basin. Adv. Virus Res. 2012, 127–162. [Google Scholar] [CrossRef] [Scilit]
  83. Antignus, Y.; Lachman, O.; Pearlsman, M.; Maslenin, L.; Rosner, A. A New Pathotype of Pepper mild mottle virus (PMMoV) Overcomes the L4 Resistance Genotype of Pepper Cultivars. Plant Dis. 2008, 92, 1033–1037. [Google Scholar] [CrossRef] [Scilit]
  84. Hamada, H.; Takeuchi, S.; Kiba, A.; Tsuda, S.; Hikichi, Y.; Okuno, T. Amino acid changes in pepper mild mottle virus coat protein that affect L3 gene-mediated resistance in pepper. J. Gen. Plant Pathol. 2002, 68, 155–162. [Google Scholar] [CrossRef] [Scilit]
  85. Hu, Q.; Zhang, H.; Liu, Y.; Huang, C.; Yuan, C.; Chen, Z.; Li, K.; Larkin, R.M.; Chen, J.; Kuang, H. Two tobamovirus multiplication proteins 2A homologs in tobacco determine asymptomatic response to tobacco mosaic virus. Plant Physiol. 2021, 187, 2674–2690. [Google Scholar] [CrossRef] [Scilit]
  86. Matsunaga, H.; Saito, T.; Hirai, M.; Nunome, T.; Yoshida, T. DNA markers linked to pepper mild mottle virus (PMMoV) resistant locus (L4) in Capsicum. J. Japan. Soc. Hort. 2003, 72, 218–220. [Google Scholar] [CrossRef] [Scilit]
  87. Yang, H.-B.; Liu, W.Y.; Knag, W.-H.; Jahn, M.; Knag, B.-C. Development of SNP markers linked to the L locus in Capsicum spp. A comparative genetic analysis. Mol. Breed. 2009, 24, 433–446. [Google Scholar] [CrossRef] [Scilit]
  88. Kim, H.J.; Han, J.H.; Yoo, J.H.; Cho, H.J.; Kim, B.D. Development of a sequence characteristic amplified region marker linked to the L4 locus conferring broad spectrum resistance to tobamoviruses in pepper plants. Mol. Cells 2008, 25, 205–210. [Google Scholar] [PubMed]
  89. Sugita, T.; Yamaguchi, K.; Sugimura, Y.; Nagata, R. Development of SCAR markers linked to L3 gene in Capsicum. Breed. Sci. 2004, 54, 111–115. [Google Scholar] [CrossRef] [Scilit]
  90. Nankar, A.N.; Todorova, V.; Tringovska, I.; Pasev, G.; Radeva-Ivanova, V.; Ivanova, V.; Kostova, D.A. Step towards Balkan Capsicum annuum L. core collection: Phenotypic and biochemical characterization of 180 accessions for agronomic, fruit quality, and virus resistance traits. PLoS ONE 2020, 15, e0237741. [Google Scholar] [CrossRef] [Scilit]
  91. Svoboda, J.; Cervena, G.; Rodova, J.; Jokes, M. First report of pepper miled mottle virus in seeds produced in the Czech Republic-Short communication. Plant Prot. Sci. 2006, 42, 34–37. [Google Scholar] [CrossRef] [Scilit]
  92. Filipić, A.; Dobnik, D.; Tušek Žnidarič, M.; Žegura, B.; Štern, A.; Primc, G.; Mozetič, M.; Ravnikar, M.; Žel, J.; Gutierrez Aguirre, I. Inactivation of Pepper Mild Mottle Virus in Water by Cold Atmospheric Plasma. Front. Microbiol. 2021, 12, 618209. [Google Scholar] [CrossRef] [Scilit]
  93. Colson, P.; Richet, H.; Desnues, C.; Balique, F.; Moal, V.; Grob, J.-J.; Berbis, P.; Lecoq, H.; Harle, J.-R.; Berland, Y.; et al. Pepper mild mottle virus, a plant virus associated with specific immune responses, fever, abdominal pains, and pruritus in humans. PLoS ONE 2010, 5, e10041. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  94. Dhakar, V.; Geetanjali, A.S. Role of pepper mild mottle virus as a tracking tool for fecal pollution in aquatic environments. Arch. Microbiol. 2022, 204, 513. [Google Scholar] [CrossRef] [Scilit]
  95. Shrestha, S.; Shrestha, S.; Shindo, J.; Sherchand, J.B.; Haramoto, E. Virological quality of irrigation water sources and pepper mild mottle virus and tobacco mosaic virus as index of pathogenic virus contamination level. Food Environ. Virol. 2018, 10, 107–120. [Google Scholar] [CrossRef] [Scilit]
  96. Zhang, T.; Breitbart, M.; Lee, W.H.; Run, J.Q.; Wei, C.L.; Soh, S.W.L.; Hibberd, M.L.; Liu, E.T.; Rohwer, F.; Ruan, Y. RNA viral community in human feces: Prevalence of plant pathogenic viruses. PLoS Biol. 2006, 4, e3. [Google Scholar] [CrossRef] [Scilit]
  97. Kuroda, K.; Nakada, N.; Hanamoto, S.; Inaba, M.; Katayama, H.; Do, A.T.; Nga, T.T.; Oguma, K.; Hayashi, T.; Takizawa, S. Pepper mild mottle virus as an indicator and a tracer of fecal pollution in water environments: Comparative evaluation with wastewater-tracer pharmaceuticals in Hanoi, Vietnam. Sci. Total Environ. 2015, 15, 287–298. [Google Scholar] [CrossRef] [Scilit]
  98. Haramoto, E.; Kitajima, M.; Kishida, N.; Konno, Y.; Katayama, H.; Asami, M.; Akiba, M. Occurrence of pepper mild mottle virus in drinking water sources in Japan. Appl. Environ. Microbiol. 2013, 79, 7413–7418. [Google Scholar] [CrossRef] [Scilit]
  99. Hamza, I.A.; Jurzik, L.; Uberla, K.; Wilhelm, M. Evaluation of pepper mild mottle virus, human picobirnavirus and Torque teno virus as indicators of fecal contamination in river water. Water Res. 2011, 45, 1358–1368. [Google Scholar] [CrossRef] [Scilit]
  100. Otaki, Y.; Otaki, M.; Chaminda, T.; Kishimoto, Y.; Nakazawa, Y.; Gimhana, K. Hygiene risk of waterborne pathogenic viruses in rural communities using onsite sanitation systems and shallow dug wells. Sci. Total Environ. 2020, 752, 141775. [Google Scholar] [CrossRef] [Scilit]
  101. Bačnik, K.; Kutnjak, D.; Pecman, A.; Mehle, N.; Tušek Žnidarič, M.; Gutiérrez, A.I.; Ravnikar, M. Viromics and infectivity analysis reveal the release of infective plant viruses from wastewater into the environment. Water Res. 2020, 177, 115628. [Google Scholar] [CrossRef] [Scilit]
  102. Anderson-Coughlin, B.L.; Craighead, S.; Kelly, A.; Gartley, S.; Vanore, A.; Johnson, G.; Jiang, C.; Haymaker, J.; White, C.; Foust, D.; et al. Enteric Viruses and pepper mild mottle virus show significant correlation in select mid-atlantic agricultural waters. Appl. Environ. Microbiol. 2021, 87, e0021121. [Google Scholar] [CrossRef] [Scilit]
  103. Canh, V.D.; Torii, S.; Furumai, H.; Katayama, H. Application of capsid integrity (RT-)qPCR to assessing occurrence of intact viruses in surface water and tap water in Japan. Water Res. 2021, 189, 116674. [Google Scholar] [CrossRef] [Scilit]
  104. Bonanno Ferraro, G.; Suffredini, E.; Mancini, P.; Veneri, C.; Iaconelli, M.; Bonadonna, L.; Montagna, M.T.; De Gi-glio, O.; La Rosa, G. Pepper Mild Mottle Virus as Indicator of Pollution: Assessment of Prevalence and Concentration in Different Water Environments in Italy. Food Environ. 2021, 13, 117–125. [Google Scholar] [CrossRef] [Scilit]
  105. González-Fernández, A.; Symonds, E.M.; Gallard-Gongora, J.F.; Mull, B.; Lukasik, J.O.; Navarro, P.R.; Aguilar, A.B.; Peraud, J.; Brown, M.L.; Alvarado, D.M.; et al. Relationships among microbial indicators of fecal pollution, microbial source tracking markers, and pathogens in Costa Rican coastal waters. Water Res. 2021, 188, 116507. [Google Scholar] [CrossRef] [Scilit]
  106. Ferraro, G.B.; Suffredini, E.; Mancini, P.; Veneri, C.; Iaconelli, M.; Bonadonna, L.; Montagna, M.T.; De Giglio, O.; La Rosa, G. Pepper mild mottle virus in different water matrices. Eur. J. Public Health 2020, 30, ckaa116. [Google Scholar] [CrossRef] [Scilit]
  107. Aguado-García, Y.; Taboada, B.; Morán, P.; Rivera-Gutiérrez1, X.; Serrano-Vázquez, A.; Iša1, P.; Rojas-Velázquez, L.; Pérez-Juárez, H.; López1, S.; Torres, J.; et al. Tobamoviruses can be frequently present in the oropharynx and gut of infants during their first year of life. Sci. Rep. 2020, 10, 13595. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  108. Shirasaki, N.; Matsushita, T.; Matsui, Y.; Koriki, S. Suitability of pepper mild mottle virus as a human enteric virus surrogate for assessing the efficacy of thermal or free-chlorine disinfection processes by using infectivity assays and enhanced viability PCR. Water Res. 2020, 186, 116409. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  109. Hamza, H.; Rizk, N.M.; Gad, M.A.; Hamza, I.A. Pepper mild mottle virus in wastewater in Egypt: A potential indicator of wastewater pollution and the efficiency of the treatment process. Adv. Virol. 2019, 164, 2707–2713. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  110. Malla, B.; Ghaju Shrestha, R.; Tandukar, S.; Bhandari, D.; Thakali, O.; Sherchand, J.B.; Haramoto, E. Detection of Pathogenic Viruses, Pathogen Indicators, and Fecal-Source Markers within Tanker Water and Their Sources in the Kathmandu Valley, Nepal. Pathogens 2019, 8, 81. [Google Scholar] [CrossRef] [Scilit]
  111. Van Zyl, W.B.; Zhou, N.A.; Wolfaardt, M.; Matsapola, P.N.; Ngwana, F.B.; Symonds, E.M.; Fagnant-Sperati, C.S.; Shirai, J.H.; Kossik, A.L.; Beck, N.K.; et al. Detection of potentially pathogenic enteric viruses in environmental samples from Kenya using the bag-mediated fltration system. Water Supply 2019, 19, 1668–1676. [Google Scholar] [CrossRef] [Scilit]
  112. Gyawali, P.; Croucher, D.; Ahmed, W.; Devane, M.; Hewitt, J. Evaluation of pepper mild mottle virus as an indicator of human faecal pollution in shellfish and growing waters. Water Res. 2019, 154, 370–376. [Google Scholar] [CrossRef] [Scilit]
  113. Hata, A.; Hanamoto, S.; Ihara, M.; Shirasaka, Y.; Yamashita, N.; Tanaka, H. Comprehensive Study on Enteric Viruses and Indicators in Surface Water in Kyoto, Japan, During 2014-2015 Season. Food Environ. Virol. 2018, 10, 353–364. [Google Scholar] [CrossRef] [Scilit]
  114. Kato, R.; Asami, T.; Utagawa, E.; Furumai, H.; Katayama, H. Pepper mild mottle virus as a process indicator at drinking water treatment plants employing coagulation-sedimentation, rapid sand filtration, ozonation, and biological activated carbon treatments in Japan. Water Res. 2018, 132, 61–70. [Google Scholar] [CrossRef] [Scilit]
  115. Saeidi, N.; Gu, X.; Tran, N.H.; Goh, S.G.; Kitajima, M.; Kushmaro, A.; Schmitz, B.W.; Gin, K.Y. Occurrence of traditional and alternative fecal indicators in tropical urban environments under different land use patterns. Appl. Environ. Microbiol. 2018, 84, e00287-18. [Google Scholar] [CrossRef] [Scilit]
  116. Symonds, E.M.; Young, S.; Verbyla, M.E.; McQuaig-Ulrich, S.M.; Ross, E.; Jiménez, J.A.; Harwood, V.J.; Breitbart, M. Microbial source tracking in shellfish harvesting waters in the Gulf of Nicoya, Costa Rica. Water Res. 2017, 111, 177–184. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  117. Rosiles-González, G.; Ávila-Torres, G.; Moreno-Valenzuela, O.A.; Acosta-González, G.; Leal-Bautista, R.M.; Grimaldo-Hernández, C.D.; Brown, J.K.; Chaidez-Quiroz, C.; Betancourt, W.Q.; Gerba, C.P.; et al. Occurrence of pepper mild mottle virus (PMMoV) in Groundwater from a Karst Aquifer System in the Yucatan Peninsula, Mexico. Food Environ. Virol. 2017, 9, 487–497. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  118. Symonds, E.M.; Sinigalliano, C.; Gidley, M.; Ahmed, W.; McQuaig-Ulrich, S.M.; Breitbart, M. Faecal pollution along the southeastern coast of Florida and insight into the use of pepper mild mottle virus as an indicator. J. Appl. Microbiol. 2016, 121, 1469–1481. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  119. Schmitz, B.W.; Kitajima, M.; Campillo, M.E.; Gerba, C.P.; Pepper, I.L. Virus Reduction during Advanced Bardenpho and Conventional Wastewater Treatment Processes. Environ. Sci. Technol. 2016, 50, 9524–9532. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  120. Kitajima, M.; Iker, B.C.; Pepper, I.L.; Gerba, C.P. Relative Abundance and Treatment Reduction of Viruses during Wastewater Treatment Processes--identification of Potential Viral Indicators. Sci Total Environ. 2014, 488–489, 290–296. [Google Scholar] [CrossRef] [Scilit]
Figure 1. Unrooted phylogenetic tree of a representative isolate of pepper mild mottle virus (PMMoV) and other tobamoviruses based on sequences of their coat proteins (CPs). All the sequences were downloaded from National Center for Biotechnology Information (NCBI) genome database (https://www.nvbi.nlm.nih.gov/) using the corresponding accession numbers. The phylogenetic treewas constructed using MEGAX software. The red colored triangleindicatesPMMoV isolate. The representative isolates are indicated in parentheses against the corresponding protein accession numbers.
Figure 1. Unrooted phylogenetic tree of a representative isolate of pepper mild mottle virus (PMMoV) and other tobamoviruses based on sequences of their coat proteins (CPs). All the sequences were downloaded from National Center for Biotechnology Information (NCBI) genome database (https://www.nvbi.nlm.nih.gov/) using the corresponding accession numbers. The phylogenetic treewas constructed using MEGAX software. The red colored triangleindicatesPMMoV isolate. The representative isolates are indicated in parentheses against the corresponding protein accession numbers.
Viruses 15 00282 g001
Figure 2. Phylogenetic tree showing the relationships among isolates of PMMoV based on sequences of RNA-dependent RNA polymerase (RdRp) ((A), 183 kDa), read-through protein ((B), 126 kDa), movement protein ((C), 30 kDa), and coat proteins ((D), 17 kDa). The protein sequences were downloaded from the NCBI genome database (https://www.nvbi.nlm.nih.gov/) and used forphylogenetic tree conduction using the MEGAXsoftware. The red, blue, and green triangles indicate examples of P1.2; P1.2.3, and P1.2.3.4 pathotypes, respectively.
Figure 2. Phylogenetic tree showing the relationships among isolates of PMMoV based on sequences of RNA-dependent RNA polymerase (RdRp) ((A), 183 kDa), read-through protein ((B), 126 kDa), movement protein ((C), 30 kDa), and coat proteins ((D), 17 kDa). The protein sequences were downloaded from the NCBI genome database (https://www.nvbi.nlm.nih.gov/) and used forphylogenetic tree conduction using the MEGAXsoftware. The red, blue, and green triangles indicate examples of P1.2; P1.2.3, and P1.2.3.4 pathotypes, respectively.
Viruses 15 00282 g002aViruses 15 00282 g002b
Figure 3. Features of healthy and PMMoV-infected pepper plants. (A) Uninfected plant. (B) PMMoV-infected plant with mottled leaves. (C) PMMoV-infected plant with chlorotic leaves. (D) Fruit showing typical symptoms of PMMoVinfection (e.g., blistered and lumpy).
Figure 3. Features of healthy and PMMoV-infected pepper plants. (A) Uninfected plant. (B) PMMoV-infected plant with mottled leaves. (C) PMMoV-infected plant with chlorotic leaves. (D) Fruit showing typical symptoms of PMMoVinfection (e.g., blistered and lumpy).
Viruses 15 00282 g003
Figure 4. Mechanical inoculation of pepper germplasm with PMMoV pathogen under greenhouse conditions. Red and yellow arrows indicate plants of susceptible and resistant accessions, respectively. The photographs were taken 14 days postinoculation (DPI) during greenhouse experimental screening.
Figure 4. Mechanical inoculation of pepper germplasm with PMMoV pathogen under greenhouse conditions. Red and yellow arrows indicate plants of susceptible and resistant accessions, respectively. The photographs were taken 14 days postinoculation (DPI) during greenhouse experimental screening.
Viruses 15 00282 g004
Table 1. Plant viruses belonging to the genus Tobamovirus of the family Virgaviridae.
Table 1. Plant viruses belonging to the genus Tobamovirus of the family Virgaviridae.
Name of VirusShort NameRepresentative IsolateGeneBank AccessionNucleotide Length (kb)Host Common NameHost Taxonomic NameHost FamilyReference
Pepper mild mottle virusPMMoVPMMoV-p2LC0820996.356PaprikaCapsicum annuumSolanaceae[10]
Bell pepper motile virusBPMoVBPMoV-P1DQ3550236.375EggplantSolanum melongenaSolanaceae[15]
Paprika mild mottle virusPaMMoVPaMMoV-JABO893816.525Sweet pepperCapsicum annuum L.Solanaceae[16]
Obuda pepper virusObPVObPV-ObD134386.507TobaccoNicotiana tabacum cv. Xanthi nc.Solanaceae[17]
Tomato mosaic virusToMVS1AJ1328456.384TomatoSolanum spp. Solanaceae[18]
Tomato brown rugose fruit virusToBRFVToBRFV-CA18-01MT0029736.389TomatoSolanum lycopersicumSolanaceae[19]
Tomato mottle mosaic virusToMoMVToMMV_NY-13KT8101836.398TomatoSolanum lycopersicumSolanaceae[20]
Tobacco mosaic virusTMVTMV-variant 1V014086.395TobaccoNicotiana spp.Solanaceae[21]
Tobacco mild green mosaic virusTMGMV-M340776.355TobaccoNicotiana tabacumSolanaceae[22]
Tobacco rattle virusTRVTRV MI-1 RNA-1GQ9037716.791Potatoes Solanaceae[23]
Tobacco latent virusNTLV AY1377751.415TobaccoNicotiana speciesSolanaceae[24]
Brugmansia mild mottle virusBrMMoVBrMMoV-2373AM3984366.381BrugmansiaAngel’s trampetSolanaceae[25]
Tropical soda apple mosaic virusTSAMVTSAMV-OkeechobeeNC0302296.350Tropical soda appleSolanum viarumSolanaceae[26]
Scopolia mild mottle virusSMMoVSMMoV-Kyo35LC6430286.350Japanese belladonnaScopolia japonicaSolanaceae[27]
Yello tailflower mild mottle virusYTMMoVYTMMV-CervantesKF4955646.379Yellow tailflowerAnthocercislittoreaSolanaceae[28]
Cucumber fruit mottle mosaic virusCFMMVCFMMVAF3210576.562CucumberCucumis sativusCucubitaceae[29]
Cucumber green mottle mosaic virusCGMoMVCGMMV-SHD125056.424MuskmelonCucumis meloCucubitaceae[30]
Cucumber mottle virusCuMoVCMoVAB2611676.485CucumberCucumis sativusCucubitaceae[31]
Kyuri green mottle mosaic virusKGMoMVKGMoMV-C1AJ2959486.514CucumberCucumis sativus L.Cucubitaceae[32]
Zucchini green mottle mosaic virusZGMoVZGMMV-KNC0038786.513Zucchini squashCucurbita pepo L. zucchiniCucubitaceae[33]
Turnip vein-clearing virusTuVCVTuVCV-OSUU033876.311TurnipBrassica rapaBrassicaceae[34]
Wasabi mottle virusWMoVWMoV-SFU2MK4317796.297WasabiWasabi japonica (Miq) MatsumBrassicaceae[35]
Youcai mosaic virus/Oilseed rape mosaic virusYMoV U309446.303RapeseedBrassica napusBrassicaceae[36]
Hibiscus latent Fort Pierce virusHLFPVHLFPV-JNC0253816.431Hibiscus Hibiscus spp.Malvaceae[37]
Hibiscus latent Singapore virusHLSVSingaporeAF3958986.485HibiscusHibiscus rsa-sinensisMalvaceae[38]
Clitoria yellow mottle virusCliYMVLarrimahJN5661246.514Butterfly peasClitoriaternateaFabaceae[39]
Sunn-hemp mosaic virusSHMVSHMVU470344.683Sunn-hempCrotalaria junceaFabaceae[40]
Cactus mild mottle virusCMMoVCMMoV-KrEU0433356.449Diseased grafted cactusGymnocalyciummihanovichiiCactaceae[41]
Opuntia virus 2OV2Nopal_hec MexMF4348216.4.53Prickly pear (mixed sample)Opuntia sp.Cactaceae[12]
Rattail cactus necrosis-associated virusRCNaVRCNaVJF7294716.506RatilcatusAporocactusflagelliformisCactaceae[42]
Frangipani mosaic virusFrMVFrMV-PHM0264546.643FrangipaniPlumeria rubra f. acustifoliaApocynaceae[43]
Maracuja mosaic virusMarMVMarMVDQ3569496.794Passion fruitPassiflora edulis Sims ‘Flavicarpa’Passifloraceae[13]
Passion fruit mosaic virusPfMVPfMVHQ3895406.791Passion fruitPassiflora incarnata L.Passifloraceae[44]
Odontoglossum ringspot virusORSVORSV-CyX821306.618TobaccoNicotiana tabacumOrchidaceae[45]
Plumeira mosaic virusPlMVPlu-Ind-1NC0268166.688FrangipaniPlumeria rubra f. acustifoliaApocynaceae[46]
Rehmannia mosaic virusReMVHenanNC0090416.395RehmanniaRehmanniaglutinosa LiboschOrobanchacee[47]
Ribgrass mosaic virusRMVKons 1105-R14HQ6679796.311RigbgrassPlantago major L.Plantaginaceae[48]
Streptocarpus flower break virusSFBVSFBVAM0409556.279StreptocarpusStreptocarpus spp.Gesneriaceae[49]
Hoya chlorotic spot virusHoCSV12-415KX4347256.386Hoya wayetiiHoya spp.Asclepiadaceae[50]
Table 2. PMMoV isolates with available complete genome sequence information.
Table 2. PMMoV isolates with available complete genome sequence information.
PMMoV IsolateCountryAccession NumberSequence Length (kb)Protein ID (183 kDa)HostReference
PMMoV-P2Republic of KoreaLC082099 6.356BAS32791Capsicum spp.[10]
PMMoV-P3Republic of KoreaLC0821006.356BAS32795Capsicum spp.[10]
S-47Republic of KoreaKX3993906.356AQN78273Capsicum spp.[55]
J-47Republic of KoreaKX3993896.356AQN78269Capsicum spp.[55]
PMMoV-KrRepublic of KoreaAB1260036.356BAD90598Capsicum spp.[56]
PMMoV-IaSpainAJ3082286.357CAC59955Capsicum spp.[57]
BR-DF01BrazilAB5509116.356BAJ19098_[58]
Hp1IndiaKJ6311236.356AIC77173Capsicum spp.[59]
VEVenezuelaKU3123196.356AND76921Capsicum spp.[60]
PMMoV-SSpainNC0036306.357NP_619740Capsicum spp.[54]
HuludaoChinaMG5157256.356AUR34024Capsicum spp.[53]
HN1ChinaKP3458996.356AKL59776Capsicum spp.[61]
PMMoV-CNChinaAY8594976.356AAW55638Capsicum spp.[62]
Fengcheng ChinaKU6468376.356AOC37873Capsicum spp.[63]
PMMoV-ZJ1 China MN616926 6.356QHD44340Capsicum spp.[64]
PmmoV-ZJ2ChinaMN6169276.357QHD44344Capsicum spp.[64]
PMMoV-JJapanAB0007096.357BAA19167Capsicum spp.[65]
IwJapanAB2548216.356BAE92302Capsicum spp.[66]
BL14USAMH0638826.353AVP80826Capsicum spp.[4]
C-1421JapanAB0698536.357BAB84693Capsicum spp.[67]
Pa18JapanAB1131166.356BAD99232Capsicum spp.[68]
TPO-2-19JapanAB1131176.356BAD99233Capsicum spp.[68]
PRO54348ChileMT3858686.356QNS28114Capsicum spp.[52]
L4BVJapanAB2760306.356BAF52937Capsicum spp.[69]
RPRepublic of KoreaKR1082066.356AL131824Rorippa palustris[70]
pMGSpainKX0636116.361ANW61873Capsicum spp.[71]
QJChinaMK7845686.357QIJ69894P. polyphylla[72]
Table 3. DNA markers used in the genotype selection of PMMoV-resistant pepper accessions.
Table 3. DNA markers used in the genotype selection of PMMoV-resistant pepper accessions.
MarkerPrimerPrimer Sequence (5′–3′)Primer Size (bp)TypeResistanceReference
AP-7CGTACTGTGGCTCAAAACTC--L4
SCARAP-8ATTCGCACCGTTTAGCCCGT--L4[86]
087H3T7150FCATGATTACATTTTATGTTGC Co-dominantL4
087H3T7087H3T7150RAAAAGGAAGGTTCTCATTGTT150L4[87]
087H3T7FCCTTTGCCTGCATTATTCTTG L4
087H3T7087H3T7RGCCCAAATTTATTCCCAAATGC440Co-dominantL4[87]
060I2END-2FGCACATCAGCAGGTTTAGTACG L4
060I2END060I2END-2RCCAACTGTCAAACCTCGGTT751Co-dominantL4[87]
158K24HRMFCAGATTAAGTGTTCAAAATGAGTGATG Co-dominantL4
158K24HRM158K24HRMRTGATTCCATGAAAATAAATTGTAAAGA125L4[87]
FAAGGGGCGTTCTTGAGCCAA -L4
L4SC340RTCCATGGAGTTGTTCTGCAT340-L4[88]
PMF1CTGCAGAACAACAATGGCACG Co-dominantL3
PMFR11269PMR1GCTTCCTCCTCTGCAGTCC268L3[89]
PMF2GCCAAAATGGTAATTG Co-dominantL3
PMFR11283PMF1GCTTCCTCCTCTGCAGTCC283L3[89]
Table 4. Pepper genetic resources with resistance against PMMoVpathotypes.
Table 4. Pepper genetic resources with resistance against PMMoVpathotypes.
Germplasm (Name or Accession) *Pepper TypeResistance GenotypePMMoV PathotypeReactionResponseScreening MethodReference
EasyC. annuumL4L4P1.2 and P1.2.3NS/-RBioassay and genetic markers[11]
MagnipicoC. annuumL4L4P1.2 and P1.2.3NS/RBioassay and genetic markers[11]
Orange gloryC. annuumL4L3P1.2 and P1.2.3NS/RBioassay and genetic markers[11]
Scirocco F1C. annuumL4L3P1.2 and P1.2.3NS/RBioassay and genetic markers[11]
Special F1C. annuumL4L1P1.2 and P1.2.3NS/RBioassay and genetic markers[11]
IT261210 *C. chinense PMMoV-1.2.3Nl/-RBioassay and RT-PCR[81]
IT261211 *C. chinense PMMoV-1.2.3Nl/-RBioassay and RT[81]
IT261426 *C. chinense PMMoV-1.2.3Nl/-RBioassay and RT[81]
IT261431 *C. chinense PMMoV-1.2.3Nl/-RBioassay and RT[81]
IT261442 *C. chinense PMMoV-1.2.3Nl/-RBioassay and RT[81]
IT284050 *C. chinense PMMoV-1.2.3Nl/-RBioassay and RT[81]
PI 152225 *C. chinenseL3PMMoV-P1.2Nl/RMechanical and biological characterization[91]
PI 260429 *C. chinenseL4PMMoV-P1.2Nl/RMechanical and biological characterization[91]
PI260429 *C. ChacoenseL4PMMoV-1.2.3-RSCAR DNA marker[86]
SA185 *C. ChacoenseL4PMMoV-RSCAR DNA marker[86]
SusanC. annuumL4PMMoV-RSCAR DNA marker[86]
SpecialC. annuumL4PMMoV-1.2.3-RSCAR DNA marker[86]
AP-PM01 *C. annuumL4PMMoV-RSCAR DNA marker[86]
AP-PM02 *C. annuumL4PMMoV-RSCAR DNA marker[86]
AP-PM03 *C. annuumL4PMMoV-1.2.3-RSCAR DNA marker[86]
AP-PM04 *C. annuumL4PMMoV-RSCAR DNA marker[86]
AP-PM05 *C. annuumL4PMMoV-RSCAR DNA marker[86]
AP-PM06 *C. annuumL4PMMoV-RSCAR DNA marker[86]
KyouyutakaC. annuumL1PMMoV-1.2-RSCAR marker[89]
Tosahikari D L1PMMoV-1.2-RSCAR marker[89]
TabascoC. frutescensL2PMMoV-1.2/1.2.3-RSCAR marker[89]
PI159236 *C. chinenseL3PMMoV-1.2/1.2.3-RSCAR marker[89]
BerumasariC. annuumL3PMMoV-1.2/1.2.3-RSCAR marker[89]
HimukamidoriC. annuumL3PMMoV-1.2/1.2.3-RSCAR marker[89]
T-143 *C. annuumL3PMMoV-1.2/1.2.3-RSCAR marker[89]
Tosahime RC. annuumL3PMMoV-1.2/1.2.3-RSCAR marker[89]
SpiritC. annuumL3PMMoV-1.2/1.2.3-RSCAR marker[89]
Mihata 1C. annuumL3PMMoV-1.2/1.2.3-RSCAR marker[89]
SararaC. annuumL3PMMoV-1.2/1.2.3-RSCAR marker[89]
MiogiC. annuumL3PMMoV-1.2/1.2.3-RSCAR marker[89]
FiestaC. annuumL3PMMoV-1.2/1.2.3-RSCAR marker[89]
PI260429C. chacoenseL4PMMoV-1.2/1.2.3-RSCAR marker[89]
LeiraC. annuumL4PMMoV-1.2/1.2.3-RSCAR marker[89]
SpecialC. annuumL4PMMoV-1.2/1.2.3-RSCAR marker[89]
* Refers to pepper accessions.
Table 5. Research findings on the detection of PMMoV in water resources and in animal (including human) excreta.
Table 5. Research findings on the detection of PMMoV in water resources and in animal (including human) excreta.
Study LocationYearSample SourceDetection MethodKey FindingsReferences
Atlantic, USA2021Surface and reclaimed waterRT-qPCR1. PMMoV detected more in reclaimed water than in surface water samples.
2. Water salinity affected the detection of PMMoV and other enteric viruses.
[102]
Japan2021Surface and tap waterRT-qPCR and SD-CDDP-(RT-qPCR1. PMMoV detected in surface water.
2. Intact PMMoV was more common than intact human pathogenic viruses.
[103]
Italy2021Raw and treated sewage, river, estuarine, bathing water, groundwater, and drinking waterNested RT-qPCR and sequencing1. PMMoV detected in both treated and untreated sewage, river, estuarine water, bathing water, and groundwater samples.
2. No PMMoV detected in drinking water.
[104]
Costa Rica2021River and ocean discharge sitesRT-qPCR 1. PMMoV and HF183 detected in all river samples and in >89% of ocean samples.[105]
Slovenia2021PMMoV -containing plant homogenates
and
PMMoV-free homogenates
Test plant infectivity assays, transmission electron microscopy, RT-PCR-
and RT-droplet
digital PCR
1. PMMoV is a very resilient water-transmissible Tobamovirus and can survive transit through the human gut.
2. CAP is a useful water treatment tool for inactivation of pathogenic viruses, including PMMoVand other enteric viruses.
[92]
Japan2021Groundwater (well water)Quantitative microbial risk assessment, membrane filtration method1. PMMoV detected in well water in high based only on the horizontal distance as the PMMoV concentration decreased rapidly as distance increased. [100]
Italy2020Urban wastewaters, treated effluents, surface water, estuarine, seawater, groundwater, and drinking waterNested RT-PCR and TaqMan-based qPCR1. PMMoV detected in wastewater, treated sewage, river, estuarine, bathing water, and groundwater samples.
2. No PMMoV detected in drinking water samples.
3. PMMoV is ubiquitous throughout the water cycle with different concentrations.
[106]
Mexico2020Fecal, oropharyngeal (gastrointestinal) samples.NextSeq500 Illumina platform1. PMMoV, in addition to tropical soda apple mosaic virus and opuntia virus 2, were the most common species detected in fecal and oropharynx samples.[107]
Slovenia2020Influents and effluents ofwastewater treatment plantsRT-qPCR1. High-diversity plant viruses, especially tobamoviruses, were detected in wastewater treatment plant influents and effluents. [101]
Japan2020Human enteric viruses and PMMoVPMA-PCR, PMA-Enhancer-PCR, PMAxx-PCR, and PMAxx-Enhancer-PCR1. PMMoV was more resistant to heat treatments and could be a potential surrogate for some enteric viruses in thermal disinfection processes.
2. The PMMoV was comparatively much more resistant to chlorine treatment.
[108]
Egypt2020Influent and effluentwastewaterg qRT-PCR1. PMMoV was detected in both influent and effluent samples and no clear seasonality of detection was found.
2. PMMoV can be used as a fecal indicator of wastewater contamination and a process indicator for the performance of the treatment process.
[109]
Nepal2019Tanker waterqPCR1. PMMoV together with tobacco mosaic virus was detected in tanker water.[110]
Kenya2019Wastewater and wastewater-impacted surface watersRT-PCR1. PMMoV and other enteroviruses were detected in all samples and could be used as indicators in fecal contaminated sites.[111]
New Zealand2019Nonhuman fecal matter; influent wastewater, and fish-growing watersRT-qPCR1. Certain nonhuman fecal samples (seagull, Canada goose, black swan, and dog) were positive for PMMoV.
2. PMMoV detected in shellfish and shellfish-growing water samples.
[112]
Japan2018Surface waterConventional plaque assay, RT-qPCR 1. PMMoVdetected in the surface water samples regardless of season and location, and is useful as an indicator for water contamination.[113]
Japan2018WaterTaqman-based
RT-qPCR
1. PMMoV detected in raw water throughput the year and can serve as a treatment process indicator of enteric viruses.[114]
Singapore2018Water from different water bodiesHollow fiber ultrafiltration, ImProm-II reverse transcription system (Promega), qPCR1. PMMoV detected in the water sample and can be used as a suitable indicator of fecal pollution in tropical surface waters. [115]
Kathmandu Valley, Nepal.2018Irrigation water sourcesElectronegative membrane-vortex method and TaqMan (MGB)-based qPCR assays1. PMMoV (and TMV) detected in all types of irrigation water sources and is a potential indicator to elucidate pathogenic virus levels in environmental samples.
2. Seasons had good correspondence with the presence of pathogenic virus types.
[95]
Costa Rica2017Fecal matter of animals, domestic wastewater, and surface waterRT-qPCR1. PMMoV is a useful domestic wastewater-associated marker, with high concentrations and 100% sensitivity and specificity.
2. PMMoV markers were not detected in any surface water samples.
[116]
Mexico2017GroundwaterRT-PCR and cloning1. PMMoV RNA detected in most samples with gene sequences sharing 99–100% of nucleotide identity with other PMMoV sequences.
2. No significant correlation observed between PMMoV occurrences by season or water type.
[117]
Southeastern Florida2016Surface water samples from inlets, exposed to runoff and septic seepage, and coastal sites, exposed to ocean outfallsRT-qPCR1. PMMoV detected more frequently than other microbial source tracking markers.[118]
Southern Arizona2016WastewaterTaqMan-based qPCR1. PMMoV in addition to AiV, AdV, JCPyV and BKPyV were detected in the samples and are potential viral markers for human fecal contamination.
2. Frequency of PMMoV detection was less influenced by seasonal variation.
[119]
Hanoi, Vietnam2015Surface water, wastewater, groundwater, tap water, and bottled water qPCR1. PMMoV detected in many surface water samples and in all wastewater samples in high concentration.
2. PMMoV is useful as a sensitive fecal indicator for evaluating the potential occurrence of pathogenic viruses.
3. No PMMoV detection in tap water and bottled water samples.
[97]
Southern Arizona2014Wastewater samplesRT-qPCR
TaqMan-based quantitative PCR (qPCR) assays
1. PMMoV (and AiV) detected in both influent and effluent water.
2. PMMoV can be used as potential indicator of wastewater reclamation.
3. No significant seasonal change in concentration of PMMoV was recorded.
[120]
Japan2013Drinking water sourcesqPCR1. Significant difference in the occurrence of PMMoV observed among geographical regions but not a seasonal difference.
2. PMMoV strains were diverse in the water sources.
[98]
Germany 2011Rivers, influents and effluents of wastewater; animal (including human) stool.Quantitative real time (RT-) PCR1. PMMoV highly detected in all river water samples, while frequently of other viruses (HAdV and HPyV, TTV and hPBV) were less detected.
2.PMMoV could be a promising indicator of fecal pollution in surface water.
[99]
USA2010Commercialized food products containing peppers; human stoolRT-PCR, sequencing, and electron microscopy1. PMMoV in feces can infect host plants and is viable after passing through the gut.
2. Individuals (humans) positive for PMMoV showed symptoms such as pain in the stomach and mild fever.
[93]
USA2009Raw sewage, treated wastewater, seawater exposed to wastewater, and fecal samples and intestinal homogenates from a wide variety of animalsqPCR1. PMMoV was present in all wastewater and some seawater samples but at higher concentrations in raw sewage and has a potential utility as an indicator of human fecal pollution.
2. Though ubiquitous in human feces, PMMoV was not detected in the majority of animal fecal samples tested (except chicken and seagull samples).
3. PMMoV was not found in nonpolluted seawater samples but could be detected in surface seawater.
[8]
San Diego, California, United States2006Fecal samples from two healthy human individualsRT-PCR1. PMMoV detected in human fecal samples and high concentration of its viron particles observed in the samples.
2. The vast majority of the viral sequences showed similarity to plant pathogenic RNA viruses.
3. PMMV was also detected in some fecal samples from healthy individuals.
4. A number of pepper-based foods were tested positive for PMMV, which suggests a dietary origin for the virus.
5. PMMV derived from fecal matter is infectious to host plants.
[96]
RT-ddPCR: RT-droplet digital PCR; CAP: cold atmospheric plasma for waterborne virus inactivation; PMAxx: improved PMA; HAdV: human adenovirus, a recognized indicator for human fecal contamination; AiV: Aichi virus; JCPyV/BKPyV: human polymaviruses; hPBV: human picobirnaviruses; TTV: torque teno virus; HpyV: human polyomaviruses; EVs: enteric viruses; AdV: adenovirus type 40; CV: coxsackievirus B5; HF183: microorganism (bacteroides).
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Ochar, K.; Ko, H.-C.; Woo, H.-J.; Hahn, B.-S.; Hur, O. Pepper Mild Mottle Virus: An Infectious Pathogen in Pepper Production and a Potential Indicator of Domestic Water Quality. Viruses 2023, 15, 282. https://doi.org/10.3390/v15020282

AMA Style

Ochar K, Ko H-C, Woo H-J, Hahn B-S, Hur O. Pepper Mild Mottle Virus: An Infectious Pathogen in Pepper Production and a Potential Indicator of Domestic Water Quality. Viruses. 2023; 15(2):282. https://doi.org/10.3390/v15020282

Chicago/Turabian Style

Ochar, Kingsley, Ho-Cheol Ko, Hee-Jong Woo, Bum-Soo Hahn, and Onsook Hur. 2023. "Pepper Mild Mottle Virus: An Infectious Pathogen in Pepper Production and a Potential Indicator of Domestic Water Quality" Viruses 15, no. 2: 282. https://doi.org/10.3390/v15020282

APA Style

Ochar, K., Ko, H.-C., Woo, H.-J., Hahn, B.-S., & Hur, O. (2023). Pepper Mild Mottle Virus: An Infectious Pathogen in Pepper Production and a Potential Indicator of Domestic Water Quality. Viruses, 15(2), 282. https://doi.org/10.3390/v15020282

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop