Pathogenicity Studies of NADC34-like Porcine Reproductive and Respiratory Syndrome Virus LNSY-GY and NADC30-like Porcine Reproductive and Respiratory Syndrome Virus GXGG-8011 in Piglets
Abstract
:1. Introduction
2. Materials and Methods
2.1. Viruses and Cells
2.2. Sequencing Alignment and Phylogenic Analysis
2.3. Viral Growth Kinetics of PRRSV
2.4. Animals and Experimental Design
2.5. Detection of PRRSV via qPCR
2.6. Serological Test
2.7. Histopathological to Lungs
2.8. Statistical Analysis
3. Results
3.1. Viral Kinetics and Nsp2 and ORF5 Sequence Analysis of NADC30/34-like PRRSV
3.2. Clinical Presentations of Piglets after PRRSV Infection
3.3. Viremia Examination and Serological Test Analysis
3.4. Pathogenicity and Viral Loads in Tissues
3.5. Histopathological and Immunohistochemistry Examinations
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Meulenberg, J.J. PRRSV, the virus. Vet. Res. 2000, 31, 11–21. [Google Scholar] [CrossRef] [PubMed]
- Neumann, E.J.; Kliebenstein, J.B.; Johnson, C.D.; Mabry, J.W.; Bush, E.J.; Seitzinger, A.H.; Green, A.L.; Zimmerman, J.J. Assessment of the economic impact of porcine reproductive and respiratory syndrome on swine production in the United States. J. Am. Vet. Med. Assoc. 2005, 227, 385–392. [Google Scholar] [CrossRef] [PubMed]
- Brinton, M.A.; Gulyaeva, A.A.; Balasuriya, U.B.R.; Dunowska, M.; Faaberg, K.S.; Goldberg, T.; Leung, F.C.C.; Nauwynck, H.J.; Snijder, E.J.; Stadejek, T.; et al. ICTV Virus Taxonomy Profile: Arteriviridae 2021. J. Gen. Virol. 2021, 102, 8. [Google Scholar] [CrossRef] [PubMed]
- Conzelmann, K.K.; Visser, N.; Van Woensel, P.; Thiel, H.J. Molecular characterization of porcine reproductive and respiratory syndrome virus, a member of the arterivirus group. Virology 1993, 193, 329–339. [Google Scholar] [CrossRef] [PubMed]
- Snijder, E.J.; Meulenberg, J.J. The molecular biology of arteriviruses. J. Gen. Virol. 1998, 79 Pt 5, 961–979. [Google Scholar] [CrossRef] [PubMed]
- Kuhn, J.H.; Lauck, M.; Bailey, A.L.; Shchetinin, A.M.; Vishnevskaya, T.V.; Bao, Y.; Ng, T.F.; LeBreton, M.; Schneider, B.S.; Gillis, A.; et al. Reorganization and expansion of the nidoviral family Arteriviridae. Arch. Virol. 2016, 161, 755–768. [Google Scholar] [CrossRef] [PubMed]
- Li, L.; Chen, J.; Cao, Z.; Cao, Y.; Guo, Z.; Tong, W.; Zhou, Y.; Li, G.; Jiang, Y.; Liu, C.; et al. Recombinant Bivalent Live Vectored Vaccine Against Classical Swine Fever and HP-PRRS Revealed Adequate Heterogeneous Protection Against NADC30-Like Strain. Front. Microbiol. 2021, 12, 822749. [Google Scholar] [CrossRef]
- Zhang, Z.; Zhang, H.; Luo, Q.; Zheng, Y.; Kong, W.; Huang, L.; Zhao, M. Variations in NSP1 of Porcine Reproductive and Respiratory Syndrome Virus Isolated in China from 1996 to 2022. Genes 2023, 14, 1435. [Google Scholar] [CrossRef]
- Xie, S.; Liang, W.; Wang, X.; Chen, H.; Fan, J.; Song, W.; Hua, L.; Tang, X.; Chen, H.; Peng, Z.; et al. Epidemiological and genetic characteristics of porcine reproduction and respiratory syndrome virus 2 in mainland China, 2017–2018. Arch. Virol. 2020, 165, 1621–1632. [Google Scholar] [CrossRef]
- An, T.Q.; Li, J.N.; Su, C.M.; Yoo, D. Molecular and Cellular Mechanisms for PRRSV Pathogenesis and Host Response to Infection. Virus Res. 2020, 286, 197980. [Google Scholar] [CrossRef]
- Yin, B.; Qi, S.; Sha, W.; Qin, H.; Liu, L.; Yun, J.; Zhu, J.; Li, G.; Sun, D. Molecular Characterization of the Nsp2 and ORF5 (ORF5a) Genes of PRRSV Strains in Nine Provinces of China During 2016–2018. Front. Vet. Sci. 2021, 8, 605832. [Google Scholar] [CrossRef] [PubMed]
- Guo, Z.; Chen, X.X.; Li, R.; Qiao, S.; Zhang, G. The prevalent status and genetic diversity of porcine reproductive and respiratory syndrome virus in China: A molecular epidemiological perspective. Virol. J. 2018, 15, 2. [Google Scholar] [CrossRef] [PubMed]
- Wu, Y.; Peng, O.; Xu, Q.; Li, Q.; Li, W.; Lin, L.; Zhou, Q.; Cai, X.; Hu, G.; He, Z.; et al. Characterization and Pathogenicity of Two Novel PRRSVs Recombined by NADC30-like and NADC34-like Strains in China. Viruses 2022, 14, 2174. [Google Scholar] [CrossRef] [PubMed]
- Zhao, H.Z.; Wang, F.X.; Han, X.Y.; Guo, H.; Liu, C.Y.; Hou, L.N.; Wang, Y.X.; Zheng, H.; Wang, L.; Wen, Y.J. Recent advances in the study of NADC34-like porcine reproductive and respiratory syndrome virus in China. Front. Microbiol. 2022, 13, 950402. [Google Scholar] [CrossRef] [PubMed]
- Song, S.; Xu, H.; Zhao, J.; Leng, C.; Xiang, L.; Li, C.; Fu, J.; Tang, Y.D.; Peng, J.; Wang, Q.; et al. Pathogenicity of NADC34-like PRRSV HLJDZD32-1901 isolated in China. Vet. Microbiol. 2020, 246, 108727. [Google Scholar] [CrossRef] [PubMed]
- Yuan, L.; Zhu, Z.; Fan, J.; Liu, P.; Li, Y.; Li, Q.; Sun, Z.; Yu, X.; Lee, H.S.; Tian, K.; et al. High Pathogenicity of a Chinese NADC34-like PRRSV on Pigs. Microbiol. Spectr. 2022, 10, e0154122. [Google Scholar] [CrossRef] [PubMed]
- Li, Z.; He, Y.; Xu, X.; Leng, X.; Li, S.; Wen, Y.; Wang, F.; Xia, M.; Cheng, S.; Wu, H. Pathological and immunological characteristics of piglets infected experimentally with a HP-PRRSV TJ strain. BMC Vet. Res. 2016, 12, 230. [Google Scholar] [CrossRef] [PubMed]
- Ruedas-Torres, I.; Sanchez-Carvajal, J.M.; Carrasco, L.; Pallares, F.J.; Larenas-Munoz, F.; Rodriguez-Gomez, I.M.; Gomez-Laguna, J. PRRSV-1 induced lung lesion is associated with an imbalance between costimulatory and coinhibitory immune checkpoints. Front. Microbiol. 2022, 13, 1007523. [Google Scholar] [CrossRef]
- Halbur, P.G.; Paul, P.S.; Frey, M.L.; Landgraf, J.; Eernisse, K.; Meng, X.J.; Lum, M.A.; Andrews, J.J.; Rathje, J.A. Comparison of the pathogenicity of two US porcine reproductive and respiratory syndrome virus isolates with that of the Lelystad virus. Vet. Pathol. 1995, 32, 648–660. [Google Scholar] [CrossRef]
- Magaki, S.; Hojat, S.A.; Wei, B.; So, A.; Yong, W.H. An Introduction to the Performance of Immunohistochemistry. Methods Mol. Biol. 2019, 1897, 289–298. [Google Scholar] [CrossRef]
- Prieto, C.; Sanchez, R.; Martin-Rillo, S.; Suarez, P.; Simarro, I.; Solana, A.; Castro, J.M. Exposure of gilts in early gestation to porcine reproductive and respiratory syndrome virus. Vet. Rec. 1996, 138, 536–539. [Google Scholar] [CrossRef] [PubMed]
- Mengeling, W.L.; Lager, K.M.; Vorwald, A.C. Temporal characterization of transplacental infection of porcine fetuses with porcine reproductive and respiratory syndrome virus. Am. J. Vet. Res. 1994, 55, 1391–1398. [Google Scholar] [PubMed]
- Shang, Y.; Wang, G.; Yin, S.; Tian, H.; Du, P.; Wu, J.; Chen, Y.; Yang, S.; Jin, Y.; Zhang, K.; et al. Pathogenic characteristics of three genotype II porcine reproductive and respiratory syndrome viruses isolated from China. Virol. J. 2013, 10, 7. [Google Scholar] [CrossRef] [PubMed]
- Yun, S.I.; Lee, Y.M. Overview: Replication of porcine reproductive and respiratory syndrome virus. J. Microbiol. 2013, 51, 711–723. [Google Scholar] [CrossRef] [PubMed]
- Bai, X.; Wang, Y.; Xu, X.; Sun, Z.; Xiao, Y.; Ji, G.; Li, Y.; Tan, F.; Li, X.; Tian, K. Commercial vaccines provide limited protection to NADC30-like PRRSV infection. Vaccine 2016, 34, 5540–5545. [Google Scholar] [CrossRef] [PubMed]
- Zhou, L.; Yang, B.; Xu, L.; Jin, H.; Ge, X.; Guo, X.; Han, J.; Yang, H. Efficacy evaluation of three modified-live virus vaccines against a strain of porcine reproductive and respiratory syndrome virus NADC30-like. Vet. Microbiol. 2017, 207, 108–116. [Google Scholar] [CrossRef] [PubMed]
- Li, C.; Liu, Z.; Chen, K.; Qian, J.; Hu, Y.; Fang, S.; Sun, Z.; Zhang, C.; Huang, L.; Zhang, J.; et al. Efficacy of the Synergy Between Live-Attenuated and Inactivated PRRSV Vaccines Against a NADC30-Like Strain of Porcine Reproductive and Respiratory Syndrome Virus in 4-Week Piglets. Front. Vet. Sci. 2022, 9, 812040. [Google Scholar] [CrossRef]
- van Geelen, A.G.M.; Anderson, T.K.; Lager, K.M.; Das, P.B.; Otis, N.J.; Montiel, N.A.; Miller, L.C.; Kulshreshtha, V.; Buckley, A.C.; Brockmeier, S.L.; et al. Porcine reproductive and respiratory disease virus: Evolution and recombination yields distinct ORF5 RFLP 1-7-4 viruses with individual pathogenicity. Virology 2018, 513, 168–179. [Google Scholar] [CrossRef]
- Ramirez, M.; Bauermann, F.V.; Navarro, D.; Rojas, M.; Manchego, A.; Nelson, E.A.; Diel, D.G.; Rivera, H. Detection of porcine reproductive and respiratory syndrome virus (PRRSV) 1-7-4-type strains in Peru. Transbound. Emerg. Dis. 2019, 66, 1107–1113. [Google Scholar] [CrossRef]
- Zhao, J.; Xu, L.; Xu, Z.; Deng, H.; Li, F.; Sun, X.; Zhou, Y.; Zhu, L. Emergence and spread of NADC34-like PRRSV in Southwest China. Transbound. Emerg. Dis. 2022, 69, e3416–e3424. [Google Scholar] [CrossRef]
- Xu, H.; Song, S.; Zhao, J.; Leng, C.; Fu, J.; Li, C.; Tang, Y.D.; Xiang, L.; Peng, J.; Wang, Q.; et al. A potential endemic strain in China: NADC34-like porcine reproductive and respiratory syndrome virus. Transbound. Emerg. Dis. 2020, 67, 1730–1738. [Google Scholar] [CrossRef] [PubMed]
- Sun, Y.F.; Liu, Y.; Yang, J.; Li, W.Z.; Yu, X.X.; Wang, S.Y.; Li, L.A.; Yu, H. Recombination between NADC34-like and QYYZ-like strain of porcine reproductive and respiratory syndrome virus with high pathogenicity for piglets in China. Transbound. Emerg. Dis. 2022, 69, e3202–e3207. [Google Scholar] [CrossRef] [PubMed]
- Kim, S.C.; Moon, S.H.; Jeong, C.G.; Park, G.S.; Park, J.Y.; Jeoung, H.Y.; Shin, G.E.; Ko, M.K.; Kim, S.H.; Lee, K.K.; et al. Whole-genome sequencing and genetic characteristics of representative porcine reproductive and respiratory syndrome virus (PRRSV) isolates in Korea. Virol. J. 2022, 19, 66. [Google Scholar] [CrossRef] [PubMed]
- Zhang, H.L.; Zhang, W.L.; Xiang, L.R.; Leng, C.L.; Tian, Z.J.; Tang, Y.D.; Cai, X.H. Emergence of novel porcine reproductive and respiratory syndrome viruses (ORF5 RFLP 1-7-4 viruses) in China. Vet. Microbiol. 2018, 222, 105–108. [Google Scholar] [CrossRef] [PubMed]
- Sun, Z.; Wang, J.; Bai, X.; Ji, G.; Yan, H.; Li, Y.; Wang, Y.; Tan, F.; Xiao, Y.; Li, X.; et al. Pathogenicity comparison between highly pathogenic and NADC30-like porcine reproductive and respiratory syndrome virus. Arch. Virol. 2016, 161, 2257–2261. [Google Scholar] [CrossRef] [PubMed]
- Zhang, H.; Xia, M.; Wang, W.; Ju, D.; Cao, L.; Wu, B.; Wang, X.; Wu, Y.; Song, N.; Hu, J.; et al. An Attenuated Highly Pathogenic Chinese PRRS Viral Vaccine Confers Cross Protection to Pigs against Challenge with the Emerging PRRSV NADC30-Like Strain. Virol. Sin. 2018, 33, 153–161. [Google Scholar] [CrossRef] [PubMed]
- Ma, X.; Wang, P.; Zhang, R.; Zhao, Y.; Wu, Y.; Luo, C.; Zeshan, B.; Yang, Z.; Qiu, L.; Zhou, Y.; et al. A NADC30-like PRRSV causes serious intestinal infections and tropism in piglets. Vet. Microbiol. 2022, 268, 109397. [Google Scholar] [CrossRef]
- Kikuti, M.; Paploski, I.A.D.; Pamornchainavakul, N.; Picasso-Risso, C.; Schwartz, M.; Yeske, P.; Leuwerke, B.; Bruner, L.; Murray, D.; Roggow, B.D.; et al. Emergence of a New Lineage 1C Variant of Porcine Reproductive and Respiratory Syndrome Virus 2 in the United States. Front. Vet. Sci. 2021, 8, 752938. [Google Scholar] [CrossRef]
- Liu, J.; Liu, C.; Xu, Y.; Yang, Y.; Li, J.; Dai, A.; Huang, C.; Luo, M.; Wei, C. Molecular Characteristics and Pathogenicity of a Novel Recombinant Porcine Reproductive and Respiratory Syndrome Virus Strain from NADC30-, NADC34-, and JXA1-Like Strains That Emerged in China. Microbiol. Spectr. 2022, 10, e0266722. [Google Scholar] [CrossRef]
- Bordet, E.; Fretaud, M.; Crisci, E.; Bouguyon, E.; Rault, S.; Pezant, J.; Pleau, A.; Renson, P.; Giuffra, E.; Larcher, T.; et al. Macrophage-B Cell Interactions in the Inverted Porcine Lymph Node and Their Response to Porcine Reproductive and Respiratory Syndrome Virus. Front. Immunol. 2019, 10, 953. [Google Scholar] [CrossRef]
- Lunney, J.K.; Fang, Y.; Ladinig, A.; Chen, N.; Li, Y.; Rowland, B.; Renukaradhya, G.J. Porcine Reproductive and Respiratory Syndrome Virus (PRRSV): Pathogenesis and Interaction with the Immune System. Annu. Rev. Anim. Biosci. 2016, 4, 129–154. [Google Scholar] [CrossRef] [PubMed]
- Pileri, E.; Mateu, E. Review on the transmission porcine reproductive and respiratory syndrome virus between pigs and farms and impact on vaccination. Vet. Res. 2016, 47, 108. [Google Scholar] [CrossRef] [PubMed]
- Zhu, H.; Li, X.; Ren, X.; Chen, H.; Qian, P. Improving cross-protection against influenza virus in mice using a nanoparticle vaccine of mini-HA. Vaccine 2022, 40, 6352–6361. [Google Scholar] [CrossRef] [PubMed]
- Niederwerder, M.C. Role of the microbiome in swine respiratory disease. Vet. Microbiol. 2017, 209, 97–106. [Google Scholar] [CrossRef]
- Qiu, M.; Li, S.; Ye, M.; Li, J.; Sun, Z.; Li, X.; Xu, Y.; Xiao, Y.; Li, C.; Feng, B.; et al. Systemic Homologous Neutralizing Antibodies Are Inadequate for the Evaluation of Vaccine Protective Efficacy against Coinfection by High Virulent PEDV and PRRSV. Microbiol. Spectr. 2022, 10, e0257421. [Google Scholar] [CrossRef] [PubMed]
- You, X.; Li, G.; Lei, Y.; Xu, Z.; Zhang, P.; Yang, Y. Role of genetic factors in different swine breeds exhibiting varying levels of resistance/susceptibility to PRRSV. Virus Res. 2023, 326, 199057. [Google Scholar] [CrossRef] [PubMed]
- Dekkers, J.; Rowland, R.R.R.; Lunney, J.K.; Plastow, G. Host genetics of response to porcine reproductive and respiratory syndrome in nursery pigs. Vet. Microbiol. 2017, 209, 107–113. [Google Scholar] [CrossRef] [PubMed]
- Xu, K.; Zhou, Y.; Mu, Y.; Liu, Z.; Hou, S.; Xiong, Y.; Fang, L.; Ge, C.; Wei, Y.; Zhang, X.; et al. CD163 and pAPN double-knockout pigs are resistant to PRRSV and TGEV and exhibit decreased susceptibility to PDCoV while maintaining normal production performance. Elife 2020, 9, e57132. [Google Scholar] [CrossRef]
- Burkard, C.; Lillico, S.G.; Reid, E.; Jackson, B.; Mileham, A.J.; Ait-Ali, T.; Whitelaw, C.B.; Archibald, A.L. Precision engineering for PRRSV resistance in pigs: Macrophages from genome edited pigs lacking CD163 SRCR5 domain are fully resistant to both PRRSV genotypes while maintaining biological function. PLoS Pathog. 2017, 13, e1006206. [Google Scholar] [CrossRef]
Virus | Prime | Sequence (5′-3′) | Size (bp) |
---|---|---|---|
PRV | gE-F | GCTGTACGTGCTCGTGAT | 101 |
gE-R | TCAGCTCCTTGATGACCGTGA | ||
gE-Probe | HEX-CACAACGGCCACGTCGCCACCTG-BHQ1 | ||
CSFV-F | TACAGGACAGTCGTCAGTTCGA | ||
CSFV | CSFV-R | CCGCTAGGGTTAAGGTGTGTCT | 92 |
CSFV-Probe | FAM-CCCACCTCGAGATGCTATGTGGACGA-TAMRA | ||
PCV2 | PCV2-F | CACGGATATTGTAGTCCTGGT | 500 |
PCV2-R | CGCACCTTCGGATATACTGTC | ||
PCV3 | PCV3-F | TTACTTAGAGAACGGACTTGTAACG | 645 |
PCV3-R | AAATGAGACACAGAGCTATATCAG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhu, H.; Wei, L.; Liu, X.; Liu, S.; Chen, H.; Chen, P.; Li, X.; Qian, P. Pathogenicity Studies of NADC34-like Porcine Reproductive and Respiratory Syndrome Virus LNSY-GY and NADC30-like Porcine Reproductive and Respiratory Syndrome Virus GXGG-8011 in Piglets. Viruses 2023, 15, 2247. https://doi.org/10.3390/v15112247
Zhu H, Wei L, Liu X, Liu S, Chen H, Chen P, Li X, Qian P. Pathogenicity Studies of NADC34-like Porcine Reproductive and Respiratory Syndrome Virus LNSY-GY and NADC30-like Porcine Reproductive and Respiratory Syndrome Virus GXGG-8011 in Piglets. Viruses. 2023; 15(11):2247. https://doi.org/10.3390/v15112247
Chicago/Turabian StyleZhu, Hechao, Liuqing Wei, Xiangzu Liu, Shudan Liu, Huanchun Chen, Pin Chen, Xiangmin Li, and Ping Qian. 2023. "Pathogenicity Studies of NADC34-like Porcine Reproductive and Respiratory Syndrome Virus LNSY-GY and NADC30-like Porcine Reproductive and Respiratory Syndrome Virus GXGG-8011 in Piglets" Viruses 15, no. 11: 2247. https://doi.org/10.3390/v15112247
APA StyleZhu, H., Wei, L., Liu, X., Liu, S., Chen, H., Chen, P., Li, X., & Qian, P. (2023). Pathogenicity Studies of NADC34-like Porcine Reproductive and Respiratory Syndrome Virus LNSY-GY and NADC30-like Porcine Reproductive and Respiratory Syndrome Virus GXGG-8011 in Piglets. Viruses, 15(11), 2247. https://doi.org/10.3390/v15112247