First Detection and Genome Characterization of a New RNA Virus, Hibiscus Betacarmovirus, and a New DNA Virus, Hibiscus Soymovirus, Naturally Infecting Hibiscus spp. in Hawaii
Abstract
1. Introduction
2. Materials and Methods
2.1. Plant Material Collection and Sample Preparation
2.2. HTS Sequencing and Genome Assembly
2.3. RT-PCR Detection and Virus Survey
2.4. Phylogenetic and Bioinformatic Analyses
2.5. Mechanical Inoculation
3. Results
3.1. HTS Data Analyses
3.2. Identification of a New RNA Virus, Hibiscus Betacarmovirus (HBCV)
3.3. Identification of a New DNA Virus, Hibiscus Soymovirus (HSV)
3.4. Virus Survey
3.5. Mechanical Inoculation
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Mall, S.; Pandey, V.; Srivastava, A.; Gaur, R.K. Detection and characterization of plant viruses infecting hibiscus rosa-sinensis L. In Virus Diseases of Ornamental Plants; Springer: Berlin/Heidelberg, Germany, 2021; pp. 151–164. [Google Scholar] [CrossRef]
- Melzer, M.J.; Simbajon, N.; Carillo, J.; Borth, W.B.; Freitas-Astúa, J.; Kitajima, E.W.; Neupane, K.R.; Hu, J.S. A cilevirus infects ornamental hibiscus in Hawaii. Arch. Virol. 2013, 158, 2421–2424. [Google Scholar] [CrossRef] [PubMed]
- Olmedo-Velarde, A.; Hu, J.; Melzer, M.J. A virus infecting hibiscus rosa-sinensis represents an evolutionary link between cileviruses and higreviruses. Front. Microbiol. 2021, 12, 660237. [Google Scholar] [CrossRef] [PubMed]
- Villamor, D.E.V.; Ho, T.; Al Rwahnih, M.; Martin, R.R.; Tzanetakis, I.E. High throughput sequencing for plant virus detection and discovery. Phytopathology 2019, 109, 716–725. [Google Scholar] [CrossRef] [PubMed]
- Kumar, S.; Stecher, G.; Tamura, K. Molecular evolutionary genetics analysis (MEGA) for macOS. Mol. Biol. Evol. 2020, 37, 1237–1239. [Google Scholar] [CrossRef]
- Adams, M.J.; Lefkowitz, E.J.; King, A.M.Q.; Harrach, B.; Harrison, R.L.; Knowles, N.J.; Kropinski, A.M.; Krupovic, M.; Kuhn, J.H.; Mushegian, A.R.; et al. Ratification vote on taxonomic proposals to the International Committee on Taxonomy of Viruses (2016). Arch. Virol. 2016, 161, 2921–2949. [Google Scholar] [CrossRef] [PubMed]
- Scheets, K.; White, K.A.; Rubino, L.; Martelli, G.; Rochon, D.A. ICTV Taxonomic proposal 2015.007a-rP.v1.split_Carmovirus. Divide the genus Carmovirus (family Tombusviridae) into three new genera: Alphacarmovirus, Betacarmovirus, and Gammacarmovirus. Available online: http://www.ictvonline.org/proposals-15/2015.007a-rP.A.v1.split_Carmovirus.pdf (accessed on 25 October 2022).
- King, A.M.Q.; Adams, M.J.; Carstens, E.B.; Lefkowitz, E. Virus Taxonomy: Ninth Report of the International Committee on Taxonomy of Viruses; Elsevier: Amsterdam, The Netherlands, 2011; pp. 435–436. [Google Scholar]
- Maachi, A.; Hernando, Y.; Aranda, M.A.; Donaire, L. Complete genome sequence of malva-associated soymovirus 1: A novel virus infecting common mallow. Virus Genes 2022, 58, 372–375. [Google Scholar] [CrossRef] [PubMed]
- Zhang, F.; Yang, Z.; Hong, N.; Wang, G.; Wang, A.; Wang, L. Identification and characterization of water chestnut soymovirus-1 (WCSV-1), a novel Soymovirus in water chestnuts (Eleocharis dulcis). BMC Plant Biol. 2019, 19, 159. [Google Scholar] [CrossRef] [PubMed]
Purpose | ID | Sequence-5′ to 3′ | Length |
---|---|---|---|
HBCV detection | BCVF1 | CCTGAGGTTTGAGCACAGCA | 659 bp |
BCVR1 | GACCAAGGCTCCTCTTTGCA | ||
HSV detection | SVF1 | AGGAAGATGGTCGTTTTGGG | 429 bp |
SVR1 | ACTGGACTGCTGGTTGTATG | ||
5′-RACE | HBCV _GSP1 | GATTACGCCAAGCTTTGGGTTATGCCCAAGACCAC | - |
3′-RACE | HBCV _GSP2 | GATTACGCCAAGCTTAAAACCGGTGTTATTGCCGC | - |
Isolate | Nucleotide | Amino Acid | RdRp | CP |
---|---|---|---|---|
Israel | KC876666 | AGN70380 | 53.3% | 32.6% |
Taiwan | DQ392986 | ABD48708 | 52.9% | 33.1% |
Malaysia | MN080500 | QDJ95885 | 53.3% | 33.4% |
Singapore | X86448 | CAB81767 | 53.0% | 34.0% |
Hawaii | MT512573 | QWX21617 | 53.0% | 33.7% |
China | KY933060 | AVK94112 | 53.1% | 34.0% |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wang, X.; Larrea-Sarmiento, A.E.; Olmedo-Velarde, A.; Kong, A.; Borth, W.; Suzuki, J.Y.; Wall, M.M.; Melzer, M.J.; Hu, J. First Detection and Genome Characterization of a New RNA Virus, Hibiscus Betacarmovirus, and a New DNA Virus, Hibiscus Soymovirus, Naturally Infecting Hibiscus spp. in Hawaii. Viruses 2023, 15, 90. https://doi.org/10.3390/v15010090
Wang X, Larrea-Sarmiento AE, Olmedo-Velarde A, Kong A, Borth W, Suzuki JY, Wall MM, Melzer MJ, Hu J. First Detection and Genome Characterization of a New RNA Virus, Hibiscus Betacarmovirus, and a New DNA Virus, Hibiscus Soymovirus, Naturally Infecting Hibiscus spp. in Hawaii. Viruses. 2023; 15(1):90. https://doi.org/10.3390/v15010090
Chicago/Turabian StyleWang, Xupeng, Adriana E. Larrea-Sarmiento, Alejandro Olmedo-Velarde, Alexandra Kong, Wayne Borth, Jon Y Suzuki, Marisa M Wall, Michael J Melzer, and John Hu. 2023. "First Detection and Genome Characterization of a New RNA Virus, Hibiscus Betacarmovirus, and a New DNA Virus, Hibiscus Soymovirus, Naturally Infecting Hibiscus spp. in Hawaii" Viruses 15, no. 1: 90. https://doi.org/10.3390/v15010090
APA StyleWang, X., Larrea-Sarmiento, A. E., Olmedo-Velarde, A., Kong, A., Borth, W., Suzuki, J. Y., Wall, M. M., Melzer, M. J., & Hu, J. (2023). First Detection and Genome Characterization of a New RNA Virus, Hibiscus Betacarmovirus, and a New DNA Virus, Hibiscus Soymovirus, Naturally Infecting Hibiscus spp. in Hawaii. Viruses, 15(1), 90. https://doi.org/10.3390/v15010090