Development and Validation of an In-House Real-Time Reverse-Transcriptase Polymerase Chain Reaction Assay for SARS-CoV-2 Omicron Lineage Subtyping between BA.1 and BA.2
Abstract
:1. Introduction
2. Materials and Methods
2.1. Population and Samples
2.2. Extraction of Viral Nucleic Acid
2.3. Assay Design
2.4. Genomic Sequencing
2.5. Analytical Performance
3. Results
3.1. Analytical Sensitivity
3.2. Analytical Specificity
3.3. Reproducibility
3.4. Accuracy
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- World Health Organization. WHO Coronavirus (COVID-19) Dashboard. Available online: https://covid19.who.int/ (accessed on 19 June 2022).
- Coronaviridae Study Group of the International Committee on Taxonomy of Viruses. The species Severe acute respiratory syndrome-related coronavirus: Classifying 2019-nCoV and naming it SARS-CoV-2. Nat. Microbiol. 2020, 5, 536–544. [Google Scholar] [CrossRef] [PubMed]
- Tang, X.; Wu, C.; Li, X.; Song, Y.; Yao, X.; Wu, X.; Duan, Y.; Zhang, H.; Wang, Y.; Qian, Z.; et al. On the origin and continuing evolution of SARS-CoV-2. Natl. Sci. Rev. 2020, 7, 1012–1023. [Google Scholar] [CrossRef] [PubMed]
- World Health Organization. Tracking SARS-CoV-2 Variants. Available online: https://www.who.int/activities/tracking-SARS-CoV-2-variants (accessed on 19 June 2022).
- Rambaut, A.; Holmes, E.C.; O’Toole, Á.; Hill, V.; McCrone, J.T.; Ruis, C.; Plessis, L.d.; Pybus, O.G. A dynamic nomenclature proposal for SARS-CoV-2 lineages to assist genomic epidemiology. Nat. Microbiol. 2020, 5, 1403–1407. [Google Scholar] [CrossRef] [PubMed]
- Forster, P.; Forster, L.; Renfrew, C.; Forster, M. Phylogenetic network analysis of SARS-CoV-2 genomes. Proc. Natl. Acad. Sci. USA 2020, 117, 9241–9243. [Google Scholar] [CrossRef] [PubMed]
- Greaney, A.J.; Loes, A.N.; Crawford, K.H.D.; Starr, T.N.; Malone, K.D.; Chu, H.Y.; Bloom, J.D. Comprehensive mapping of mutations in the SARS-CoV-2 receptor-binding domain that affect recognition by polyclonal human plasma antibodies. Cell Host Microbe 2021, 29, 463–476.e6. [Google Scholar] [CrossRef]
- World Health Organization. Genomic Sequencing of SARS-CoV-2: A Guide to Implementation for Maximum Impact on Public Health. 2021. Available online: https://www.who.int/publications/i/item/9789240018440 (accessed on 19 June 2022).
- Planas, D.; Saunders, N.; Maes, P.; Guivel-Benhassine, F.; Planchais, C.; Buchrieser, J.; Bolland, W.; Porrot, F.; Staropoli, I.; Lemoine, F.; et al. Considerable escape of SARS-CoV-2 Omicron to antibody neutralization. Nature 2022, 602, 671–675. [Google Scholar] [CrossRef]
- Planas, D.; Veyer, D.; Baidaliuk, A.; Staropoli, I.; Guivel-Benhassine, F.; Rajah, M.M.; Planchais, C.; Porrot, F.; Robillard, N.; Puech, J.; et al. Reduced sensitivity of SARS-CoV-2 variant Delta to antibody neutralization. Nature 2021, 596, 276–280. [Google Scholar] [CrossRef]
- Iketani, S.; Liu, L.; Guo, Y.; Liu, L.; Chan, J.F.W.; Huang, Y.; Wang, M.; Luo, Y.; Yu, J.; Chu, H.; et al. Antibody evasion properties of SARS-CoV-2 Omicron sublineages. Nature 2022, 604, 553–556. [Google Scholar] [CrossRef]
- Pabbaraju, K.; Zelyas, N.; Wong, A.; Croxen, M.A.; Lynch, T.; Buss, E.; Murphy, S.; Shokoples, S.; Kanji, J.; Tipples, G. Evolving strategy for an evolving virus: Development of real-time PCR assays for detecting all SARS-CoV-2 variants of concern. J. Virol. Methods 2022, 307, 114553. [Google Scholar] [CrossRef]
- Wang, H.; Miller, J.A.; Verghese, M.; Sibai, M.; Solis, D.; Mfuh, K.O.; Jiang, B.; Iwai, N.; Mar, M.; Huang, C.; et al. Multiplex SARS-CoV-2 genotyping Reverse Transcriptase PCR for population-level variant screening and epidemiologic surveillance. J. Clin. Microbiol. 2021, 59, e0085921. [Google Scholar] [CrossRef]
- Meng, B.; Kemp, S.A.; Papa, G.; Datir, R.; Ferreira, I.A.T.M.; Marelli, S.; Harvey, W.T.; Lytras, S.; Mohamed, A.; Gallo, G.; et al. Recurrent emergence of SARS-CoV-2 spike deletion H69/V70 and its role in the Alpha variant B.1.1.7. Cell Rep. 2021, 35, 109292. [Google Scholar] [CrossRef] [PubMed]
- Brown, K.A.; Gubbay, J.; Hopkins, J.; Patel, S.; Buchan, S.A.; Daneman, N.; Goneau, L.W. S-Gene target failure as a marker of variant B.1.1.7 among SARS-CoV-2 isolates in the Greater Toronto Area, December 2020 to March 2021. JAMA 2021, 325, 2115. [Google Scholar] [CrossRef] [PubMed]
- Subramoney, K.; Mtileni, N.; Bharuthram, A.; Davis, A.; Kalenga, B.; Rikhotso, M.; Maphahlele, M.; Giandhari, J.; Naidoo, Y.; Pillay, S.; et al. Identification of SARS-CoV-2 Omicron variant using spike gene target failure and genotyping assays, Gauteng, South Africa, 2021. J. Med. Virol. 2022, 94, 3676–3684. [Google Scholar] [CrossRef] [PubMed]
- Chen, C.; Nadeau, S.; Yared, M.; Voinov, P.; Ning, X.; Roemer, C.; Stadler, T. CoV-Spectrum: Analysis of globally shared SARS-CoV-2 data to Identify and Characterize New Variants. Bioinformatics 2021, 38, 1735–1737. [Google Scholar] [CrossRef] [PubMed]
- University of Hong Kong, School of Public Health. Detection of 2019 Novel Coronavirus (2019-nCoV) in Suspected Human Cases by RT-PCR. 2020. Available online: https://www.who.int/docs/default-source/coronaviruse/peiris-protocol-16-1-20.pdf (accessed on 19 June 2022).
- Basile, K.; McPhie, K.; Carter, I.; Alderson, S.; Rahman, H.; Donovan, L.; Kumar, S.; Tran, T.; Ko, D.; Sivaruban, T.; et al. Cell-based culture informs infectivity and safe de-isolation assessments in patients with Coronavirus Disease 2019. Clin. Infect. Dis. 2021, 73, e2952–e2959. [Google Scholar] [CrossRef]
- Freed, N.; Silander, O. SARS-CoV-2 Genome Sequencing Protocol (1200 bp Amplicon “Midnight” Primer Set, Using Nanopore Rapid Kit) V.6. 2021. Available online: https://www.protocols.io/view/sars-cov2-genome-sequencing-protocol-1200bp-amplic-rm7vz8q64vx1/v6 (accessed on 19 June 2022).
- Eden, J.S.; Rockett, R.; Carter, I.; Rahman, H.; de Ligt, J.; Hadfield, J.; Storey, M.; Ren, X.; Tulloch, R.; Basile, K.; et al. An emergent clade of SARS-CoV-2 linked to returned travellers from Iran. Virus Evol. 2020, 6, veaa027. [Google Scholar] [CrossRef]
- Rockett, R.J.; Arnott, A.; Lam, C.; Sadsad, R.; Timms, V.; Gray, K.A.; Eden, J.; Chang, S.; Gall, M.; Draper, J.; et al. Revealing COVID-19 transmission in Australia by SARS-CoV-2 genome sequencing and agent-based modeling. Nat. Med. 2020, 26, 1398–1404. [Google Scholar] [CrossRef]
- Arnott, A.; Draper, J.; Rockett, R.J.; Lam, C.; Sadsad, R.; Gall, M.; Martinez, E.; Byun, R.; Musto, J.; Marais, B.; et al. Documenting elimination of co-circulating COVID-19 clusters using genomics in New South Wales, Australia. BMC Res. Notes 2021, 14, 415. [Google Scholar] [CrossRef]
- Borillo, G.A.; Kagan, R.M.; Marlowe, E.M. Rapid and accurate identification of SARS-CoV-2 variants using Real Time PCR assays. Front. Cell. Infect. Microbiol. 2022, 12. [Google Scholar] [CrossRef]
- Rockett, R.; Basile, K.; Maddocks, S.; Fong, W.; Agius, J.E.; Johnson-Mackinnon, J.; Arnott, A.; Chandra, S.; Gall, M.; Draper, J.; et al. Resistance mutations in SARS-CoV-2 Delta variant after Sotrovimab use. N. Engl. J. Med. 2022, 386, 1477–1479. [Google Scholar] [CrossRef]
- Kubik, S.; Marques, A.C.; Xing, X.; Silvery, J.; Bertelli, C.; de Maio, F.; Pournaras, S.; Burr, T.; Duffourd, Y.; Siemens, H.; et al. Recommendations for accurate genotyping of SARS-CoV-2 using amplicon-based sequencing of clinical samples. Clin. Microbiol. Infect. 2021, 27, 1036.e1–1036.e8. [Google Scholar] [CrossRef] [PubMed]
- Borcard, L.; Gempeler, S.; Terrazos Miani, M.A.; Baumann, C.; Grädel, C.; Dijkman, R.; Suter-Riniker, F.; Leib, S.L.; Bittel, P.; Neuenschwander, S.; et al. Investigating the extent of primer dropout in SARS-CoV-2 genome sequences during the early circulation of delta variants. Front. Virol. 2022, 2. [Google Scholar] [CrossRef]
- Vogels, C.B.F.; Breban, M.I.; Ott, I.M.; Alpert, T.; Petrone, M.E.; Watkins, A.E.; Kalinich, C.C.; Earnest, R.; Rothman, J.E.; de Jesus, J.G.; et al. Multiplex qPCR discriminates variants of concern to enhance global surveillance of SARS-CoV-2. PLOS Biol. 2021, 19, e3001236. [Google Scholar] [CrossRef] [PubMed]
- Wang, H.; Jean, S.; Eltringham, R.; Madison, J.; Snyder, P.; Tu, H.; Jones, D.M.; Leber, A.L. Mutation-specific SARS-CoV-2 PCR screen: Rapid and accurate detection of Variants of Concern and the identification of a newly emerging variant with spike L452R mutation. J. Clin. Microbiol. 2021, 59, e0092621. [Google Scholar] [CrossRef]
- Nörz, D.; Pfefferle, S.; Grunwald, M.; Fischer, N.; Aepfelbacher, M.; Lütgehetmann, M. Modifying a diagnostic SARS-CoV-2 spike PCR to turn a Del69/70 dropout into a discriminatory on-target assay. J. Mol. Diagn. 2021, 23, 777–778. [Google Scholar] [CrossRef]
- Fu, J.Y.L.; Chong, Y.M.; Sam, I.C.; Chan, Y.F. SARS-CoV-2 multiplex RT-PCR to detect variants of concern (VOCs) in Malaysia, between January to May 2021. J. Virol. Methods 2022, 301, 114462. [Google Scholar] [CrossRef] [PubMed]
- Phan, T.; Boes, S.; McCullough, M.; Gribschaw, J.; Marsh, J.; Harrison, L.H.; Wells, A. Development of a one-step qualitative RT-PCR Assay to detect the SARS-CoV-2 Omicron (B.1.1.529) variant in respiratory specimens. J. Clin. Microbiol. 2022, 60, e0002422. [Google Scholar] [CrossRef]
- Vega-Magaña, N.; Sánchez-Sánchez, R.; Hernández-Bello, J.; Venancio-Landeros, A.A.; Peña-Rodríguez, M.; Vega-Zepeda, R.A.; Galindo-Ornelas, B.; Díaz-Sánchez, M.; García-Chagollán, M.; Macedo-Ojeda, G.; et al. RT-qPCR Assays for Rapid Detection of the N501Y, 69-70del, K417N, and E484K SARS-CoV-2 Mutations: A Screening Strategy to Identify Variants with Clinical Impact. Front. Cell. Infect. Microbiol. 2021, 11, 672562. [Google Scholar] [CrossRef] [PubMed]
Previous VOC | Previous VOI | Current VOC | |||
---|---|---|---|---|---|
Alpha | 99.35% | Epsilon | 1.20% | Omicron (all) | 57.02% |
Beta | 0.05% | Zeta | 0.02% | Omicron BA.1 | 99.33% |
Gamma | 0.24% | Eta | 98.07% | Omicron BA.2 | 0.66% |
Delta | 0.26% | Theta | 0.30% | Omicron BA.3 | 99.36% |
Iota | 0.09% | Omicron BA.4 | 99.04% | ||
Kappa | 0.13% | Omicron BA.5 | 99.55% | ||
Lambda | 1.79% | ||||
Mu | 0.18% |
A | ||
---|---|---|
Target | Name | Primer/Probe Sequence (5′-3′) |
S:del69–70 | S:del69–70_FOR | AATGTTACTTGGTTCCATGTTATCTC * |
S:del69–70_REV | TCTAAAGTAGTACCAAAAATCCAGCC | |
S:del69–70_PROBE | HEX-TGCTTCCATTGAGAAGTCTAACA-BHQ2 | |
HKU-N | HKU-N_FOR | TAATCAGACAAGGAACTGATTA |
HKU-N_REV | CGAAGGTGTGACTTCCATG | |
HKU-N_PROBE | FAM-GCAAATTGTGCAATTTGCGG-BHQ1 | |
B | ||
S:del69–70 | HKU-N | Interpretation |
Detected | Detected | S:del69–70 detected (presumptive BA.1) |
Detected | Not detected | S:del69–70 detected (presumptive BA.1) |
Not detected | Detected | S:del69–70 not detected (presumptive BA.2) |
Not detected | Not detected | Invalid result |
S:del69–70 | HKU-N | |
---|---|---|
S:del69–70 (BA.1) control | Mean: 29.58 Range: 28.26–31.49 Standard deviation: 0.89 Coefficient of variation: 3% | Mean: 29.08 Range: 27.40–31.07 Standard deviation: 0.96 Coefficient of variation: 3.3% |
S:69–70 wild-type (BA.2) control | Not detected | Mean: 30.33 Range: 28.62–32.77 Standard deviation: 1.35 Coefficient of variation: 4.45% |
No-template control | Not detected | Not detected |
Gold Standard: WGS | ||||||
---|---|---|---|---|---|---|
BA.1 | BA.2 | Other | Invalid | Total | ||
Candidate assay: RT-PCR | Presumptive BA.1 | 146 | 4 1 | 3 2 | 30 | 183 |
Presumptive BA.2 | 0 | 690 | 5 3 | 93 | 788 | |
Invalid | 0 | 0 | 0 | 39 | 39 | |
Total | 146 | 694 | 8 | 162 | 1010 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Pham, D.; Maddocks, S.; Dwyer, D.E.; Sintchenko, V.; Kok, J.; Rockett, R.J. Development and Validation of an In-House Real-Time Reverse-Transcriptase Polymerase Chain Reaction Assay for SARS-CoV-2 Omicron Lineage Subtyping between BA.1 and BA.2. Viruses 2022, 14, 1760. https://doi.org/10.3390/v14081760
Pham D, Maddocks S, Dwyer DE, Sintchenko V, Kok J, Rockett RJ. Development and Validation of an In-House Real-Time Reverse-Transcriptase Polymerase Chain Reaction Assay for SARS-CoV-2 Omicron Lineage Subtyping between BA.1 and BA.2. Viruses. 2022; 14(8):1760. https://doi.org/10.3390/v14081760
Chicago/Turabian StylePham, David, Susan Maddocks, Dominic E. Dwyer, Vitali Sintchenko, Jen Kok, and Rebecca J. Rockett. 2022. "Development and Validation of an In-House Real-Time Reverse-Transcriptase Polymerase Chain Reaction Assay for SARS-CoV-2 Omicron Lineage Subtyping between BA.1 and BA.2" Viruses 14, no. 8: 1760. https://doi.org/10.3390/v14081760
APA StylePham, D., Maddocks, S., Dwyer, D. E., Sintchenko, V., Kok, J., & Rockett, R. J. (2022). Development and Validation of an In-House Real-Time Reverse-Transcriptase Polymerase Chain Reaction Assay for SARS-CoV-2 Omicron Lineage Subtyping between BA.1 and BA.2. Viruses, 14(8), 1760. https://doi.org/10.3390/v14081760