Identification of NP Protein-Specific B-Cell Epitopes for H9N2 Subtype of Avian Influenza Virus
Abstract
1. Introduction
2. Materials and Methods
2.1. Viruses, Cells and Plasmids
2.2. NP Gene Cloning and Recombinant Protein Expression
2.3. Mice Immunization
2.4. Cell Fusion and Identification of Monoclonal Antibodies
2.5. Enzyme-Linked Immunosorbent Assay (ELISA)
2.6. NP Gene Truncation Design and Expression
2.7. SDS-PAGE and Western Blotting
2.8. Indirect Immunofluorescence Assay (IFA)
2.9. Biological Information Analysis
3. Results
3.1. Cloning, Expression and Purification of Recombinant NP Protein
3.2. Screen of Monoclonal Antibody Specific to NP Proteins
3.3. Screening of B-Cell Determinants Specific to the Monoclonal Antibody
3.4. The Identified Epitope Is Highly Conserved in AIV Strains
3.5. Spatial Location Prediction of Epitope Binding
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Gu, M.; Xu, L.; Wang, X.; Liu, X. Current situation of H9N2 subtype avian influenza in China. Vet. Res. 2017, 48, 49. [Google Scholar] [CrossRef]
- Liu, Q.; Zhao, L.; Guo, Y.; Zhao, Y.; Li, Y.; Chen, N.; Lu, Y.; Yu, M.; Deng, L.; Ping, J. Antigenic Evolution Characteristics and Immunological Evaluation of H9N2 Avian Influenza Viruses from 1994-2019 in China. Viruses 2022, 14, 726. [Google Scholar] [CrossRef] [PubMed]
- Gu, M.; Chen, H.; Li, Q.; Huang, J.; Zhao, M.; Gu, X.; Jiang, K.; Wang, X.; Peng, D.; Liu, X. Enzootic genotype S of H9N2 avian influenza viruses donates internal genes to emerging zoonotic influenza viruses in China. Vet. Microbiol. 2014, 174, 309–315. [Google Scholar] [CrossRef] [PubMed]
- Guan, Y.; Shortridge, K.F.; Krauss, S.; Chin, P.S.; Dyrting, K.C.; Ellis, T.M.; Webster, R.G.; Peiris, M. H9N2 influenza viruses possessing H5N1-like internal genomes continue to circulate in poultry in southeastern China. J. Virol. 2000, 74, 9372–9380. [Google Scholar] [CrossRef]
- RahimiRad, S.; Alizadeh, A.; Alizadeh, E.; Hosseini, S.M. The avian influenza H9N2 at avian-human interface: A possible risk for the future pandemics. J. Res. Med. Sci. 2016, 21, 51. [Google Scholar] [CrossRef]
- Shen, Y.Y.; Ke, C.W.; Li, Q.; Yuan, R.Y.; Xiang, D.; Jia, W.X.; Yu, Y.D.; Liu, L.; Huang, C.; Qi, W.B.; et al. Novel Reassortant Avian Influenza A(H5N6) Viruses in Humans, Guangdong, China, 2015. Emerg. Infect. Dis. 2016, 22, 1507–1509. [Google Scholar] [CrossRef]
- Zhang, Z.; Li, R.; Jiang, L.; Xiong, C.; Chen, Y.; Zhao, G.; Jiang, Q. The complexity of human infected AIV H5N6 isolated from China. BMC Infect. Dis. 2016, 16, 600. [Google Scholar] [CrossRef]
- Chenavas, S.; Crepin, T.; Delmas, B.; Ruigrok, R.W.; Slama-Schwok, A. Influenza virus nucleoprotein: Structure, RNA binding, oligomerization and antiviral drug target. Future Microbiol. 2013, 8, 1537–1545. [Google Scholar] [CrossRef]
- Leser, G.P.; Lamb, R.A. Influenza virus assembly and budding in raft-derived microdomains: A quantitative analysis of the surface distribution of HA, NA and M2 proteins. Virology 2005, 342, 215–227. [Google Scholar] [CrossRef]
- Bullido, R.; Gomez-Puertas, P.; Albo, C.; Portela, A. Several protein regions contribute to determine the nuclear and cytoplasmic localization of the influenza A virus nucleoprotein. J. Gen. Virol. 2000, 81, 135–142. [Google Scholar] [CrossRef]
- Baudin, F.; Petit, I.; Weissenhorn, W.; Ruigrok, R.W.H. In vitro dissection of the membrane and RNP binding activities of influenza virus M1 protein. Virology 2001, 281, 102–108. [Google Scholar] [CrossRef] [PubMed]
- Liu, S.; Zhuang, Q.; Wang, S.; Jiang, W.; Jin, J.; Peng, C.; Hou, G.; Li, J.; Yu, J.; Yu, X.; et al. Control of avian influenza in China: Strategies and lessons. Transbound Emerg. Dis. 2020, 67, 1463–1471. [Google Scholar] [CrossRef] [PubMed]
- Terajima, M.; Babon, J.A.; Co, M.D.; Ennis, F.A. Cross-reactive human B cell and T cell epitopes between influenza A and B viruses. Virol. J. 2013, 10, 244. [Google Scholar] [CrossRef] [PubMed]
- Yu, Y.N.; Zheng, Y.; Hao, S.S.; Zhang, Z.; Cai, J.X.; Zong, M.M.; Feng, X.L.; Liu, Q.T. The molecular evolutionary characteristics of new isolated H9N2 AIV from East China and the function of vimentin on virus replication in MDCK cells. Virol. J. 2020, 17, 78. [Google Scholar] [CrossRef] [PubMed]
- Li, C.; Huang, X.; Cai, J.; Lu, A.; Hao, S.; Zhang, Z.; Sun, H.; Feng, X. The Immunomodulatory Functions of Various CpG Oligodeoxynucleotideson CEF Cells and H9N2 Subtype Avian Influenza Virus Vaccination. Vaccines 2022, 10, 616. [Google Scholar] [CrossRef]
- Prokudina, E.N.; Semenova, N.; Chumakov, V.; Stitz, L. An antigenic epitope of influenza virus nucleoprotein (NP) associated with polymeric forms of NP. Virol. J. 2008, 5, 37. [Google Scholar] [CrossRef][Green Version]
- Mytle, N.; Leyrer, S.; Inglefield, J.R.; Harris, A.M.; Hickey, T.E.; Minang, J.; Lu, H.; Ma, Z.; Andersen, H.; Grubaugh, N.D.; et al. Influenza Antigens NP and M2 Confer Cross Protection to BALB/c Mice against Lethal Challenge with H1N1, Pandemic H1N1 or H5N1 Influenza A Viruses. Viruses 2021, 13, 1708. [Google Scholar] [CrossRef]
- Rao, R.R.; Lakshi, V. Science challenging HIV infection. Ind. J. Pathol. Microbiol. 1993, 36, 176–189. [Google Scholar]
- ter Meulen, J.; van den Brink, E.N.; Poon, L.L.; Marissen, W.E.; Leung, C.S.; Cox, F.; Cheung, C.Y.; Bakker, A.Q.; Bogaards, J.A.; van Deventer, E.; et al. Human monoclonal antibody combination against SARS coronavirus: Synergy and coverage of escape mutants. PLoS Med. 2006, 3, e237. [Google Scholar] [CrossRef]
- Chen, C.W.; Chang, C.Y. Peptide Scanning-assisted Identification of a Monoclonal Antibody-recognized Linear B-cell Epitope. J. Vis. Exp. 2017, 121, e55417. [Google Scholar] [CrossRef]
- Fu, D.; Zhang, G.; Wang, Y.; Zhang, Z.; Hu, H.; Shen, S.; Wu, J.; Li, B.; Li, X.; Fang, Y.; et al. Structural basis for SARS-CoV-2 neutralizing antibodies with novel binding epitopes. PLoS Biol. 2021, 19, e3001209. [Google Scholar] [CrossRef] [PubMed]
- Schoenle, M.V.; Li, Y.; Yuan, M.; Clarkson, M.W.; Wilson, I.A.; Peti, W.; Page, R. NMR Based SARS-CoV-2 Antibody Screening. J. Am. Chem. Soc. 2021, 143, 7930–7934. [Google Scholar] [CrossRef] [PubMed]
- Sheehan, J.; Marasco, W.A. Phage and Yeast Display. Microbiol. Spectr. 2015, 3, AID-0028-2014. [Google Scholar] [CrossRef] [PubMed]
- Gui, X.; Ge, P.; Wang, X.; Yang, K.; Yu, H.; Zhao, Q.; Chen, Y.; Xia, N. Identification of a highly conserved and surface exposed B-cell epitope on the nucleoprotein of influenza A virus. J. Med. Virol. 2014, 86, 995–1002. [Google Scholar] [CrossRef]
- Varich, N.L.; Kochergin-Nikitsky, K.S.; Usachev, E.V.; Usacheva, O.V.; Prilipov, A.G.; Webster, R.G.; Kaverin, N.V. Location of antigenic sites recognized by monoclonal antibodies in the influenza A virus nucleoprotein molecule. J. Gen. Virol. 2009, 90, 1730–1733. [Google Scholar] [CrossRef]
- Bai, G.R.; Sakoda, Y.; Mweene, A.S.; Fujii, N.; Minakawa, H.; Kida, H. Improvement of a rapid diagnosis kit to detect either influenza A or B virus infections. J. Vet. Med. Sci. 2006, 68, 35–40. [Google Scholar] [CrossRef][Green Version]
- Noisumdaeng, P.; Roytrakul, T.; Prasertsopon, J.; Pooruk, P.; Lerdsamran, H.; Assanasen, S.; Kitphati, R.; Auewarakul, P.; Puthavathana, P. T cell mediated immunity against influenza H5N1 nucleoprotein, matrix and hemagglutinin derived epitopes in H5N1 survivors and non-H5N1 subjects. PeerJ 2021, 9, e11021. [Google Scholar] [CrossRef]
- McGee, M.C.; Huang, W. Evolutionary conservation and positive selection of influenza A nucleoprotein CTL epitopes for universal vaccination. J. Med. Virol. 2022, 94, 2578–2587. [Google Scholar] [CrossRef]
- Morrissey, B.; Streamer, M.; Downard, K.M. Antigenic characterisation of H3N2 subtypes of the influenza virus by mass spectrometry. J. Virol. Methods 2007, 145, 106–114. [Google Scholar] [CrossRef]






| Gene Name | Primer Name | Primer Sequence (5′–3′) | Primer Size | Tm(°C) | Product Size (bp) |
|---|---|---|---|---|---|
| NP | NP-F | CCGGAATTCTTTGATGAAAGGAGGAACAGATACC | 34 | 74.9 | 519 |
| NP-R | CCCAAGCTTTCGCACTTGATCCATCATTGCTCTT | 34 | 75.1 | ||
| NP-N-96 | NP-N-96-F | CCGGAATTCTTTGATGAAAGGAGGAACAG | 29 | 71.3 | 288 |
| NP-N-96-R | ACGCGTCGACCAGAGAGCACATCCTGGGAT | 30 | 72 | ||
| NP-C-103 | NP-C-103-F | CCGGAATTCTCCAACCTAAATGATGCCAC | 29 | 67.2 | 309 |
| NP-C-103-R | ACGCGTCGACTCGCACTTGATCCATCATTG | 30 | 73.5 | ||
| NP-C-54 | NP-C-54-F | CCGGAATTCCTGATGCAAGGATCAACTCTCCCGA | 34 | 72.3 | 162 |
| NP-C-54-R | ACGCGTCGACATATGCAATCCTTGTTCTTCTTCCA | 35 | 74.5 | ||
| NP-C-49 | NP-C-49-F | CCGGAATTCCGGATGATAAAGCGAGGGATCAACG | 34 | 72 | 147 |
| NP-C-49-R | ACGCGTCGACTCGCACTTGATCCATCATTGCTCTT | 35 | 72.5 |
| Monoclonal Antibody | Antibody of Cell Culture Supernatant Potency | Ascites Potency | Heavy Chain | Light Chain |
|---|---|---|---|---|
| 4F5 | 1:6400 | 1:128,000 | IgG1 | κ |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Huang, X.; Huang, J.; Yin, G.; Cai, Y.; Chen, M.; Hu, J.; Feng, X. Identification of NP Protein-Specific B-Cell Epitopes for H9N2 Subtype of Avian Influenza Virus. Viruses 2022, 14, 1172. https://doi.org/10.3390/v14061172
Huang X, Huang J, Yin G, Cai Y, Chen M, Hu J, Feng X. Identification of NP Protein-Specific B-Cell Epitopes for H9N2 Subtype of Avian Influenza Virus. Viruses. 2022; 14(6):1172. https://doi.org/10.3390/v14061172
Chicago/Turabian StyleHuang, Xiangyu, Jingwen Huang, Guihu Yin, Yiqin Cai, Mengli Chen, Jianing Hu, and Xiuli Feng. 2022. "Identification of NP Protein-Specific B-Cell Epitopes for H9N2 Subtype of Avian Influenza Virus" Viruses 14, no. 6: 1172. https://doi.org/10.3390/v14061172
APA StyleHuang, X., Huang, J., Yin, G., Cai, Y., Chen, M., Hu, J., & Feng, X. (2022). Identification of NP Protein-Specific B-Cell Epitopes for H9N2 Subtype of Avian Influenza Virus. Viruses, 14(6), 1172. https://doi.org/10.3390/v14061172

