Histamine Is Responsible for the Neuropathic Itch Induced by the Pseudorabies Virus Variant in a Mouse Model
Abstract
:1. Introduction
2. Materials and Methods
2.1. Viruses and Cells
2.2. Virus Titration
2.3. Behavioral Observation of the PRV-Infected Mice
2.4. Isolation of the DRG Neurons and Skin from the PRV-Infected Mice
2.5. RNA-Seq Analysis
2.6. Reverse Transcription-Quantitative PCR (RT-qPCR)
2.7. Effects of Chlorphenamine Hydrogen Maleate Treatment on the PRV TJ-Infected Mice
2.8. Hematoxylin and Eosin Staining and Immunohistochemistry (IHC)
2.9. Comparison of Itch in the Mice Infected with Different PRV Strains
2.10. qPCR
2.11. Statistical Analysis
3. Results
3.1. The Severity of the Itch Caused by PRV TJ Infection Gradually Increased with Time
3.2. Different Expression Profiles of the Molecules Relevant to Itch-Signal Transmission Were Noted in the DRG Neurons
3.3. The Expression of HDC Was Increased in the PRV TJ-Infected DRG Neurons
3.4. Histamine Produced in the DRG Neurons Contributed to PRV-Induced Itch and Could Be Inhibited by Chlorpheniramine
3.5. The Severity of Itch Was Different between the Three PRV Strains and Was Consistent with the HDC Expression
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Conflicts of Interest
References
- Pomeranz, L.E.; Reynolds, A.E.; Hengartner, C.J. Molecular Biology of Pseudorabies Virus: Impact on Neurovirology and Veterinary Medicine. Microbiol. Mol. Biol. Rev. 2005, 69, 462–500. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Aujeszky, A. Über Eine Neue Infektionskrankheit Bei Haustieren. Zentralbl. Bakteriol. Parasitenkd. Infektionskr. Hyg. Abt. 1 Orig. 1902, 32, 353–357. [Google Scholar]
- Hanson, R.P. The History of Pseudorabies in the United States. J. Am. Vet. Med. Assoc. 1954, 124, 259–261. [Google Scholar] [PubMed]
- Liu, Q.; Wang, X.; Xie, C.; Ding, S.; Yang, H.; Guo, S.; Li, J.; Qin, L.; Ban, F.; Wang, D.; et al. A Novel Human Acute Encephalitis Caused by Pseudorabies Virus Variant Strain. Clin. Infect. Dis. 2021, 73, e3690–e3700. [Google Scholar] [CrossRef] [PubMed]
- Wang, D.; Tao, X.; Fei, M.; Chen, J.; Guo, W.; Li, P.; Wang, J. Human Encephalitis Caused by Pseudorabies Virus Infection: A Case Report. J. Neurovirol. 2020, 26, 442–448. [Google Scholar] [CrossRef]
- Luo, Y.; Li, N.; Cong, X.; Wang, C.H.; Du, M.; Li, L.; Zhao, B.; Yuan, J.; Liu, D.D.; Li, S.; et al. Pathogenicity and Genomic Characterization of a Pseudorabies Virus Variant Isolated from Bartha-K61-Vaccinated Swine Population in China. Vet. Microbiol. 2014, 174, 107–115. [Google Scholar] [CrossRef]
- Dong, X.; Dong, X. Peripheral and Central Mechanisms of Itch. Neuron 2018, 98, 482–494. [Google Scholar] [CrossRef] [Green Version]
- Akiyama, T.; Carstens, E. Neural Processing of Itch. Neuroscience 2013, 250, 697–714. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Andoh, T.; Kuraishi, Y. Nitric Oxide Enhances Substance P-Induced Itch-Associated Responses in Mice. Br. J. Pharmacol. 2003, 138, 202–208. [Google Scholar] [CrossRef] [Green Version]
- Wahlgren, C.F.; Tengvall Linder, M.; Hägermark, O.; Scheynius, A. Itch and Inflammation Induced by Intradermally Injected Interleukin-2 in Atopic Dermatitis Patients and Healthy Subjects. Arch. Dermatol. Res. 1995, 287, 572–580. [Google Scholar] [CrossRef]
- Sonkoly, E.; Muller, A.; Lauerma, A.I.; Pivarcsi, A.; Soto, H.; Kemeny, L.; Alenius, H.; Dieu-Nosjean, M.C.; Meller, S.; Rieker, J.; et al. IL-31: A New Link between T Cells and Pruritus in Atopic Skin Inflammation. J. Allergy Clin. Immunol. 2006, 117, 411–417. [Google Scholar] [CrossRef] [PubMed]
- Sutaria, N.; Adawi, W.; Goldberg, R.; Roh, Y.S.; Choi, J.; Kwatra, S.G. Itch: Pathogenesis and Treatment. J. Am. Acad. Dermatol. 2021, 86, 17–34. [Google Scholar] [CrossRef] [PubMed]
- Hosogi, M.; Schmelz, M.; Miyachi, Y.; Ikoma, A. Bradykinin Is a Potent Pruritogen in Atopic Dermatitis: A Switch from Pain to Itch. Pain 2006, 126, 16–23. [Google Scholar] [CrossRef] [Green Version]
- Weisshaar, E.; Ziethen, B.; Gollnick, H. Can a Serotonin Type 3 (5-HT3) Receptor Antagonist Reduce Experimentally-Induced Itch? Inflamm. Res. 1997, 46, 412–416. [Google Scholar] [CrossRef]
- Inagaki, N.; Nakamura, N.; Nagao, M.; Musoh, K.; Kawasaki, H.; Nagai, H. Participation of Histamine H1 and H2 Receptors in Passive Cutaneous Anaphylaxis-Induced Scratching Behavior in ICR Mice. Eur. J. Pharmacol. 1999, 367, 361–371. [Google Scholar] [CrossRef]
- Bartha, A. Experimental Reduction of Virulence of Aujeszky’s Disease Virus. Magy. Allatorv. Lapja 1961, 16, 42–45. [Google Scholar]
- Delva, J.L.; Nauwynck, H.J.; Mettenleiter, T.C.; Favoreel, H.W. The Attenuated Pseudorabies Virus Vaccine Strain Bartha K61: A Brief Review on the Knowledge Gathered during 60 Years of Research. Pathogens 2020, 9, 897. [Google Scholar] [CrossRef]
- Yuan, Q.; Li, Z.; Nan, X.; Wu, Y.; Li, Y. Isolation and Identification of Pseudorabies Virus. Chin. J. Prev. Vet. Med. 1987, 3, 10–11. [Google Scholar]
- Qi, H.; Wu, H.; Abid, M.; Qiu, H.J.; Sun, Y. Establishment of a Fosmid Library for Pseudorabies Virus SC Strain and Application in Viral Neuronal Tracing. Front. Microbiol. 2020, 11, 1168. [Google Scholar] [CrossRef]
- Németh, B.; Fasseeh, A.; Molnár, A.; Bitter, I.; Horváth, M.; Kóczián, K.; Götze, Á.; Nagy, B. A Systematic Review of Health Economic Models and Utility Estimation Methods in Schizophrenia. Expert Rev. Pharmacoecon. Outcomes Res. 2018, 18, 267–275. [Google Scholar] [CrossRef]
- Akiyama, T.; Carstens, M.I.; Ikoma, A.; Cevikbas, F.; Steinhoff, M.; Carstens, E. Mouse Model of Touch-Evoked Itch (Alloknesis). J. Invest. Dermatol. 2012, 132, 1886–1891. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ohayon, S.; Avni, O.; Taylor, A.L.; Perona, P.; Roian Egnor, S.E. Automated Multi-Day Tracking of Marked Mice for the Analysis of Social Behaviour. J. Neurosci. Methods 2013, 219, 10–19. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sakai, K.; Sanders, K.M.; Youssef, M.R.; Yanushefski, K.M.; Jensen, L.; Yosipovitch, G.; Akiyama, T. Mouse Model of Imiquimod-Induced Psoriatic Itch. Pain 2016, 157, 2536–2543. [Google Scholar] [CrossRef] [PubMed]
- Lin, Y.T.; Chen, J.C. Dorsal Root Ganglia Isolation and Primary Culture to Study Neurotransmitter Release. J. Vis. Exp. 2018, 140, 57569. [Google Scholar] [CrossRef] [Green Version]
- Cardiff, R.D.; Miller, C.H.; Munn, R.J. Manual Hematoxylin and Eosin Staining of Mouse Tissue Sections. Cold Spring Harb. Protoc. 2014, 2014, 655–658. [Google Scholar] [CrossRef]
- Zhang, L.; Zhong, C.; Wang, J.; Lu, Z.; Liu, L.; Yang, W.; Lyu, Y. Pathogenesis of Natural and Experimental Pseudorabies Virus Infections in Dogs. Virol. J. 2015, 12, 44. [Google Scholar] [CrossRef] [Green Version]
- Meng, X.Y.; Luo, Y.; Liu, Y.; Shao, L.; Sun, Y.; Li, Y.; Li, S.; Ji, S.; Qiu, H.J. A Triplex Real-Time PCR for Differential Detection of Classical, Variant and Bartha-K61 Vaccine Strains of Pseudorabies Virus. Arch. Virol. 2016, 161, 2425–2430. [Google Scholar] [CrossRef]
- Takahashi, H.; Yoshikawa, Y.; Kai, C.; Yamanouchi, K. Mechanism of Pruritus and Peracute Death in Mice Induced by Pseudorabies Virus (PRV) Infection. J. Vet. Med. Sci. 1993, 55, 913–920. [Google Scholar] [CrossRef] [Green Version]
- Laval, K.; Enquist, L.W. The Neuropathic Itch Caused by Pseudorabies Virus. Pathogens 2020, 9, 254. [Google Scholar] [CrossRef] [Green Version]
- Veglia, E.; Pini, A.; Moggio, A.; Grange, C.; Premoselli, F.; Miglio, G.; Tiligada, K.; Fantozzi, R.; Chazot, P.L.; Rosa, A.C. Histamine Type 1-Receptor Activation by Low Dose of Histamine Undermines Human Glomerular Slit Diaphragm Integrity. Pharmacol. Res. 2016, 114, 27–38. [Google Scholar] [CrossRef] [Green Version]
- Márquez-Valadez, B.; Aquino-Miranda, G.; Quintero-Romero, M.O.; Papacostas-Quintanilla, H.; Bueno-Nava, A.; López-Rubalcava, C.; Díaz, N.F.; Arias-Montaño, J.A.; Molina-Hernández, A. The Systemic Administration of the Histamine H (1) Receptor Antagonist/Inverse Agonist Chlorpheniramine to Pregnant Rats Impairs the Development of Nigro-Striatal Dopaminergic Neurons. Front. Neurosci. 2019, 13, 360. [Google Scholar] [CrossRef]
- Brittle, E.E.; Reynolds, A.E.; Enquist, L.W. Two Modes of Pseudorabies Virus Neuroinvasion and Lethality in Mice. J. Virol. 2004, 78, 12951–12963. [Google Scholar] [CrossRef] [Green Version]
- Liu, Q.; Sikand, P.; Ma, C.; Tang, Z.; Han, L.; Li, Z.; Sun, S.; LaMotte, R.H.; Dong, X. Mechanisms of Itch Evoked by β-Alanine. J. Neurosci. 2012, 32, 14532–14537. [Google Scholar] [CrossRef] [PubMed]
- Qu, L.; Fan, N.; Ma, C.; Wang, T.; Han, L.; Fu, K.; Wang, Y.; Shimada, S.G.; Dong, X.; LaMotte, R.H. Enhanced Excitability of MRGPRA3- and MRGPRD-Positive Nociceptors in a Model of Inflammatory Itch and Pain. Brain 2014, 137, 1039–1050. [Google Scholar] [CrossRef] [Green Version]
- Frölich, M.; Enk, A.; Diepgen, T.L.; Weisshaar, E. Successful Treatment of Therapy-Resistant Pruritus in Lichen Amyloidosis with Menthol. Acta Derm. Venereol. 2009, 89, 524–526. [Google Scholar] [CrossRef] [PubMed]
- Han, J.H.; Choi, H.K.; Kim, S.J. Topical TRPM8 Agonist (Icilin) Relieved Vulva Pruritus Originating from Lichen Sclerosus et Atrophicus. Acta Derm. Venereol. 2012, 92, 561. [Google Scholar] [CrossRef] [Green Version]
- Han, S.K.; Mancino, V.; Simon, M.I. Phospholipase Cbeta 3 Mediates the Scratching Response Activated by the Histamine H1 Receptor on C-Fiber Nociceptive Neurons. Neuron 2006, 52, 691–703. [Google Scholar] [CrossRef] [Green Version]
- Mishra, G.P.; Tamboli, V.; Jwala, J.; Mitra, A.K. Recent Patents and Emerging Therapeutics in the Treatment of Allergic Conjunctivitis. Recent Pat. Inflamm. Allergy Drug Discov. 2011, 5, 26–36. [Google Scholar] [CrossRef] [PubMed]
- Arthur, J.S.; Ley, S.C. Mitogen-Activated Protein Kinases in Innate Immunity. Nat. Rev. Immunol. 2013, 13, 679–692. [Google Scholar] [CrossRef] [PubMed]
- Chuang, H.C.; Wang, X.; Tan, T.H. MAP4K Family Kinases in Immunity and Inflammation. Adv. Immunol. 2016, 129, 277–314. [Google Scholar]
- Laval, K.; Van Cleemput, J.; Vernejoul, J.B.; Enquist, L.W. Alphaherpesvirus Infection of Mice Primes PNS Neurons to an Inflammatory State Regulated by TLR2 and Type I IFN Signaling. PLoS Pathog. 2019, 15, e1008087. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhang, Y.; Liu, S.; Jiang, H.; Deng, H.; Dong, C.; Shen, W.; Chen, H.; Gao, C.; Xiao, S.; Liu, Z.F.; et al. G (2)-Quadruplex in the 3’UTR of IE180 Regulates Pseudorabies Virus Replication by Enhancing Gene Expression. RNA Biol. 2020, 17, 816–827. [Google Scholar] [CrossRef] [PubMed]
- Miltenberger, R.J.; Farnham, P.J.; Smith, D.E.; Stommel, J.M.; Cornwell, M.M. V-Raf Activates Transcription of Growth-Responsive Promoters via GC-Rich Sequences that Bind the Transcription Factor Sp1. Cell Growth Differ. 1995, 6, 549–556. [Google Scholar] [PubMed]
- Buckland, K.F.; Williams, T.J.; Conroy, D.M. Histamine Induces Cytoskeletal Changes in Human Eosinophils via the H(4) Receptor. Br. J. Pharmacol. 2003, 140, 1117–1127. [Google Scholar] [CrossRef] [Green Version]
- Gutzmer, R.; Mommert, S.; Gschwandtner, M.; Zwingmann, K.; Stark, H.; Werfel, T. The Histamine H4 Receptor Is Functionally Expressed on T(H)2 Cells. J. Allergy Clin. Immunol. 2009, 123, 619–625. [Google Scholar] [CrossRef]
- Jemima, E.A.; Prema, A.; Thangam, E.B. Functional Characterization of Histamine H4 Receptor on Human Mast Cells. Mol. Immunol. 2014, 62, 19–28. [Google Scholar] [CrossRef]
- Laval, K.; Vernejoul, J.B.; Van Cleemput, J.; Koyuncu, O.O.; Enquist, L.W. Virulent Pseudorabies Virus Infection Induces a Specific and Lethal Systemic Inflammatory Response in Mice. J. Virol. 2018, 92, e01614-18. [Google Scholar] [CrossRef] [Green Version]
- Desai, P.; Thurmond, R.L. Histamine H4 Receptor Activation Enhances LPS-Induced IL-6 Production in Mast Cells via ERK and PI3K Activation. Eur. J. Immunol. 2011, 41, 1764–1773. [Google Scholar] [CrossRef]
- Morse, K.L.; Behan, J.; Laz, T.M.; West, R.E., Jr.; Greenfeder, S.A.; Anthes, J.C.; Umland, S.; Wan, Y.; Hipkin, R.W.; Gonsiorek, W.; et al. Cloning and Characterization of a Novel Human Histamine Receptor. J. Pharmacol. Exp. Ther. 2001, 296, 1058–1566. [Google Scholar]
- Wang, B.; Wu, H.X.; Li, M.; Gao, Y.; Yuan, M.Q.; Qiu, H.J.; Sun, Y. Transcriptomic Analysis of the Dorsal Root Ganglia of Mice Infected with Pseudorabies Virus. Chin. J. Prev. Vet. Med. 2022, 44, 1–7. (In Chinese) [Google Scholar]
Primers | Sequences (5′-3′) |
---|---|
HRH1-F | ACTTGAACCGAGAGCGGAAG |
HRH1-R | TTGCACAGCGGGTAGATGAG |
TRPV4-F | TCACCCTCCTGAATCCGTGC |
TRPV4-R | TCTCACCCATGAGGGCGAT |
TRPA1-F | GGAAGTAATTCCTTTTCAGAGTGTC |
TRPA1-R | ACTCCTCAACCACCCTGTGT |
TRPV1-F | ACCACGGCTGCTTACTAT |
TRPV1-R | AACTCTTGAGGGATGGTC |
TRPM8-F | TACTCTGGCAGCCTTGGG |
TRPM8-R | TCGCAGGAGTAGACCAGTAG |
MrgprD-F | ATGAACTCCACTCTTGAC |
MrgprD-R | AGCACATAGACACAGAAG |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wang, B.; Wu, H.; Qi, H.; Li, H.; Pan, L.; Li, L.; Zhang, K.; Yuan, M.; Wang, Y.; Qiu, H.-J.; et al. Histamine Is Responsible for the Neuropathic Itch Induced by the Pseudorabies Virus Variant in a Mouse Model. Viruses 2022, 14, 1067. https://doi.org/10.3390/v14051067
Wang B, Wu H, Qi H, Li H, Pan L, Li L, Zhang K, Yuan M, Wang Y, Qiu H-J, et al. Histamine Is Responsible for the Neuropathic Itch Induced by the Pseudorabies Virus Variant in a Mouse Model. Viruses. 2022; 14(5):1067. https://doi.org/10.3390/v14051067
Chicago/Turabian StyleWang, Bing, Hongxia Wu, Hansong Qi, Hanglin Li, Li Pan, Lianfeng Li, Kehui Zhang, Mengqi Yuan, Yimin Wang, Hua-Ji Qiu, and et al. 2022. "Histamine Is Responsible for the Neuropathic Itch Induced by the Pseudorabies Virus Variant in a Mouse Model" Viruses 14, no. 5: 1067. https://doi.org/10.3390/v14051067
APA StyleWang, B., Wu, H., Qi, H., Li, H., Pan, L., Li, L., Zhang, K., Yuan, M., Wang, Y., Qiu, H.-J., & Sun, Y. (2022). Histamine Is Responsible for the Neuropathic Itch Induced by the Pseudorabies Virus Variant in a Mouse Model. Viruses, 14(5), 1067. https://doi.org/10.3390/v14051067