High-Sulfated Glycosaminoglycans Prevent Coronavirus Replication
Abstract
1. Introduction
2. Materials and Methods
2.1. Cells and Virus
2.2. Polymers and Chemicals for Synthesis
2.3. Synthesis of High-Sulfated GAGs
2.4. Characterisation of High-Sulfated GAGs
2.5. Plaque Reduction Assay
2.6. Cytotoxicity Determination
2.7. Yield Assay
2.8. Effects of Pre-, Co- and Post-Treatment
2.9. Attachment Assay
2.10. Penetration Assay
2.11. Effect of GAGs on Virus Inactivation
2.12. SARS-CoV-2 Infection
2.13. BCoV Infection
2.14. Real-Time RT PCR Assays
2.15. Statistical Analysis
3. Results
3.1. Synthesis of Sulfated GAG Derivatives
3.2. Antiviral Activity
3.3. Effects of Pre-, Co- and Post-Treatment
3.4. Effect on Viral Attachment to the Host Cells
3.5. Influence on Viral Penetration
3.6. Effect on Infectivity of Viruses
3.7. Effect on Viral Genome Content
3.8. Efficacy on SARS-CoV-2 Replication
3.9. Efficacy of the Compounds against SARS-CoV-2 Variants
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Almeida, J.D.; Berrry, D.M.; Cunningham, C.H.; Hamre, D.; Hofstad, M.S.; Mallucci, L.; McIntosh, K.; Tyrell, D.A.J. Coronaviruses. Nature 1968, 220, 650. [Google Scholar]
- Woo, P.C.; Lau, S.K.; Lam, C.S.; Lau, C.C.; Tsang, A.K.; Lau, J.H.; Bai, R.; Teng, J.L.; Tsang, C.C.; Wang, M.; et al. Discovery of seven novel Mammalian and avian coronaviruses in the genus deltacoronavirus supports bat coronaviruses as the gene source of alphacoronavirus and betacoronavirus and avian coronaviruses as the gene source of gammacoronavirus and deltacoronavirus. J. Virol. 2012, 86, 3995–4008. [Google Scholar] [CrossRef] [PubMed]
- Azizzadeh, M.; Shooroki, H.F.; Kamalabadi, A.S.; Stevenson, M.A. Factors affecting calf mortality in Iranian Holstein dairy herds. Prev. Vet. Med. 2012, 104, 335–340. [Google Scholar] [CrossRef] [PubMed]
- Bok, M.; Miño, S.; Rodriguez, D.; Badaracco, A.; Nuñes, I.; Souza, S.P.; Bilbao, G.; Louge Uriarte, E.; Galarza, R.; Vega, C.; et al. Molecular and antigenic characterization of bovine Coronavirus circulating in Argentinean cattle during 1994–2010. Vet. Microbiol. 2015, 181, 221–229. [Google Scholar] [CrossRef]
- Johnson, K.K.; Pendell, D.L. Market Impacts of Reducing the Prevalence of Bovine Respiratory Disease in United States Beef Cattle Feedlots. Front. Vet. Sci. 2017, 4, 189. [Google Scholar] [CrossRef]
- Gagneur, A.; Sizun, J.; Vallet, S.; Legr, M.C.; Picard, B.; Talbot, P.J. Coronavirus-related nosocomial viral respiratory infections in a neonatal and paediatric intensive care unit: A prospective study. J. Hosp. Infect. 2002, 51, 59–64. [Google Scholar] [CrossRef]
- Drosten, C.; Günther, S.; Preiser, W.; van der Werf, S.; Brodt, H.R.; Becker, S.; Rabenau, H.; Panning, M.; Kolesnikova, L.; Fouchier, R.A.; et al. Identification of a novel coronavirus in patients with severe acute respiratory syndrome. N. Engl. J. Med. 2003, 348, 1967–1976. [Google Scholar] [CrossRef]
- Zhu, N.; Zhang, D.; Wang, W.; Li, X.; Yang, B.; Song, J.; Zhao, X.; Huang, B.; Shi, W.; Lu, R.; et al. A novel coronavirus from patients with pneumonia in China, 2019. N. Engl. J. Med. 2020, 382, 727–733. [Google Scholar] [CrossRef]
- Zaki, A.M.; Van Boheemen, S.; Bestebroer, T.M.; Osterhaus, A.D.; Fouchier, R.A. Isolation of a novel coronavirus from a man with pneumonia in Saudi Arabia. N. Engl. J. Med. 2012, 367, 1814–1820. [Google Scholar] [CrossRef]
- Zumla, A.; Hui, D.S.; Perlman, S. Middle East Respiratory syndrome. Lancet 2015, 386, 995–1007. [Google Scholar] [CrossRef]
- Li, F. Structure, function, and evolution of coronavirus spike proteins. Annu. Rev. Virol. 2016, 3, 237–261. [Google Scholar] [CrossRef] [PubMed]
- Belouzard, S.; Millet, J.K.; Licitra, B.N.; Whittaker, G.R. Mechanisms of coronavirus cell entry mediated by the viral spike protein. Viruses 2012, 4, 1011–1033. [Google Scholar] [CrossRef] [PubMed]
- Schoemann, D.; Fieldung, B.C. Coronavirus envelope protein: Current knowledge. Virol. J. 2019, 16, 69. [Google Scholar] [CrossRef]
- Zeng, Q.; Langereis, M.A.; van Vliet, A.L.W.; Huizinga, E.G.; de Groot, R.J. Structure of coronavirus hemagglutinin-esterase offers insight into corona and influenza virus evolution. Proc. Natl. Acad. Sci. USA 2008, 105, 9065–9069. [Google Scholar] [CrossRef] [PubMed]
- Egorova, A.; Bogner, E.; Novoselova, E.; Zorn, K.M.; Ekins, S.; Makarov, V. Dispirotripiperazine-core compounds, their biological activity with a focus on broad antiviral property, and perpectives in drug design (mini-review). Eur. J. Med. Chem. 2021, 211, 113014. [Google Scholar] [CrossRef] [PubMed]
- Clausen, T.M.; Sandoval, D.R.; Spliid, C.B.; Pihl, J.; Perrett, H.R.; Painter, C.D.; Narayanan, A.; Majowicz, S.A.; Kwong, E.M.; McVicar, R.N.; et al. SARS-CoV-2 Infection Depends on Cellular Heparan Sulfate and ACE2. Cell 2020, 83, 1043–1057.e15. [Google Scholar] [CrossRef] [PubMed]
- Vlasak, R.; Luytjes, W.; Spaan, W.; Palese, P. Human and bovine coronaviruses recognize sialic acid-containing receptors similar to those of influenza C viruses. Proc. Natl. Acad. Sci. USA 1988, 85, 4526–4529. [Google Scholar] [CrossRef]
- Szczepanski, A.; Owczarek, K.; Bzowska, M.; Gula, K.; Drebot, I.; Ochman, M.; Maksym, B.; Rajfur, Z.; Mitchell, J.A.; Pyrc, K. Canine Respiratory Coronavirus, Bovine Coronavirus, and Human Coronavirus OC43: Receptors and Attachment Factors. Viruses 2019, 11, 328. [Google Scholar] [CrossRef]
- Chen, L.; Huang, G. The antiviral activity of polysaccharides and their derivatives. Int. J. Biol. Macromol. 2018, 115, 77–82. [Google Scholar] [CrossRef]
- Song, S.; Peng, H.; Wang, Q.; Liu, Z.; Dong, X.; Wen, C.; Ai, C.; Zhang, Y.; Wang, Z.; Zhu, B. Inhibitory activities of marine sulfated polysaccharides against SARS-CoV-2. Food Funct. 2020, 11, 7415–7420. [Google Scholar] [CrossRef]
- Buck, C.B.; Thompson, C.D.; Roberts, J.N.; Müller, M.; Lowy, D.R.; Schiller, J.T. Carrageenan is a potent inhibitor of papillomavirus infection. PLoS Pathog. 2006, 2, e69. [Google Scholar] [CrossRef] [PubMed]
- Jang, Y.; Shin, H.; Lee, M.K.; Kwon, O.S.; Shin, J.S.; Kim, Y.I.; Kim, C.W.; Lee, H.R.; Kim, M. Antiviral activity of lambda-carrageenan against influenza viruses and severe acute respiratory syndrome coronavirus 2. Sci. Rep. 2021, 11, 821. [Google Scholar] [CrossRef]
- Mercorelli, B.; Oreste, P.; Sinigalia, E.; Muratore, G.; Lembo, D.; Palù, G.; Loregian, A. Sulfated Derivatives of Escherichia coli K5 Capsular Polysaccharide Are Potent Inhibitors of Human Cytomegalovirus. Antimicrob. Agents Chemother. 2010, 54, 4561–4567. [Google Scholar] [CrossRef] [PubMed]
- Jinno-Oue, A.; Tanaka, A.; Shimizu, N.; Mori, T.; Sugiura, N.; Kimata, K.; Isomura, H.; Hoshino, H. Inhibitory Effect of Chondroitin Sulfate Type E on the Binding Step of Human T-Cell Leukemia Virus Type 1. AIDS Res. Hum. Retrovir. 2013, 29, 621–629. [Google Scholar] [CrossRef] [PubMed]
- Kato, D.; Era, S.; Watanabe, I.; Arihara, M.; Sugiura, N.; Kimata, K.; Suzuki, Y.; Morita, K.; Hidari, K.I.P.J.; Suzuki, T. Antiviral activity of chondroitin sulphate E targeting dengue virus envelope protein. Antiviral. Res. 2010, 88, 236–243. [Google Scholar] [CrossRef]
- Möller, S.; Schmidtke, M.; Weiss, D.; Schiller, J.; Pawlik, K.; Wutzler, P.; Schnabelrauch, M. Synthesis and antiherpetic activity of novel hyaluronan derivatives with varying degrees of carboxymethylation and sulfation. Carbohydr. Polym. 2012, 90, 608–615. [Google Scholar] [CrossRef]
- Kanno, T.; Hatama, S.; Ishihara, R.; Uchida, I. Molecular analysis of the S glycoprotein gene of bovine coronaviruses isolated in Japan from 1999 to 2006. J. Gen. Virol. 2007, 88, 1218–1224. [Google Scholar] [CrossRef]
- Smuda, C.; Bogner, E.; Radsak, K. The human cytomegalovirus glycoprotein B gene (ORF UL55) is expressed early in the infectious cycle. J. Gen. Virol. 1997, 78, 1981–1992. [Google Scholar] [CrossRef][Green Version]
- Kunze, R.; Rösler, M.; Möller, S.; Schnabelrauch, M.; Riemer, T.; Hempel, U.; Dieter, P. Sulfated hyaluronan derivatives reduce the prolifertion rate of primary rat calcvarial osteoblasts. Glycoconj. J. 2010, 27, 151–158. [Google Scholar] [CrossRef]
- Hintze, V.; Möller, S.; Schnabelrauch, M.; Bierbaum, S.; Viola, M.; Worch, H.; Scharnweber, D. Modifications of hyaluronan influence the interaction with human bone morphogenetic protein-4 (hBMP-4). Biomacromolecules 2009, 10, 3290–3297. [Google Scholar] [CrossRef]
- Hintze, V.; Miron, A.; Moeller, S.T.; Schnabelrauch, M.; Wiesmann, H.P.; Worch, H.; Scharnweber, D. Sulfated hyaluronan and chondroitin sulfate derivatives interact differently with human transforming growth factor-β1 (TGF-β1). Acta Biomater. 2012, 8, 2144–2152. [Google Scholar] [CrossRef] [PubMed]
- Hempel, U.; Möller, S.; Noack, C.; Hintze, V.; Scharnweber, D.; Schnabelrauch, M.; Dieter, P. Sulfated hyaluronan/collagen I-matrices enhance osteogenic differentiation of human mesenchymal stromal cells in vitro even in the absence of dexamethasone. Acta Biomater. 2012, 8, 4064–4072. [Google Scholar] [CrossRef] [PubMed]
- Van der Smissen, A.; Hintze, V.; Scharnweber, D.; Möller, S.; Schnabelrauch, M.; Majok, A.; Simon, J.C.; Anderegg, U. Growth promoting substrates for human dermal fibroblasts provided by artificial extracellular matrices composed of collagen I and sulfated glycosaminoglycans. Biomaterials 2011, 32, 8938–8946. [Google Scholar] [CrossRef] [PubMed]
- Hempel, U.; Hintze, V.; Möller, S.; Schnabelrauch, M.; Scharnweber, D.; Dieter, P. Artificial extracellular matrices composed of collagen I and sulfated hyaluronan with adsorbed transforming growth factor β1 promote collagen synthesis of human mesenchymal stromal cells. Acta Biomater. 2012, 8, 659–666. [Google Scholar] [CrossRef] [PubMed]
- Paeschke, R.; Woskobojnik, I.; Makarov, V.; Schmidtke, M.; Bogner, E. DSTP-27 prevents entry of human cytomeglovirus. Antimicrob. Agents Chemother. 2014, 58, 1963–1971. [Google Scholar] [CrossRef] [PubMed]
- Schroeder, S.; Pott, F.; Niemeyer, D.; Veith, T.; Richer, A.; Muth, D.; Gofffinet, C.; Müller, M.A.; Drosten, C. Interferon antagonism by SARS-CoV-2: A functional study using reverse genetics. Lancet Microbe 2021, 2, e210–e218. [Google Scholar] [CrossRef]
- Corman, V.M.; Landt, O.; Kaiser, M.; Molenkamp, R.; Meijer, A.; Chu, D.K.; Bleicker, T.; Brünink, S.; Schneider, J.; Schmidt, M.L.; et al. Detection of 2019 novel coronavirus (2019-nCoV) by real-time RT-PCR. Euro Surveill. 2020, 25, 2000045. [Google Scholar] [CrossRef]
- Dare, R.K.; Fry, A.M.; Chittaganpitch, M.; Sawanpanyalert, P.; Olsen, S.J.; Erdman, D.D. Human coronavirus infections in rural Thailand: A comprehensive study using real-time reverse-transcription polymerase chain reaction assays. J. Infect. Dis. 2007, 196, 1321–1328. [Google Scholar] [CrossRef]
- Wright, S.P. Adjusted P-values for simultaneous interference. Biometrics 1992, 48, 1005–1013. [Google Scholar] [CrossRef]
- Woo, P.C.Y.; Lau, S.K.P.; Huang, Y.; Yuen, K.-Y. Coronavirus Diversity, Phylogeny and Interspecies Jumping. Exp. Biol. Med. 2009, 234, 1117–1127. [Google Scholar] [CrossRef]
- Corman, V.M.; Muth, D.; Niemeyer, D.; Drosten, C. Chapter Eight—Hosts and sources of endemic human coronaviruses. Adv. Virus Res. 2018, 100, 163–188. [Google Scholar] [CrossRef] [PubMed]
- Vijgen, L.; Keyaerts, E.; Moes, E.; Thoelen, I.; Wollants, E.; Lemey, P.; Vandamme, A.M.; Van Ranst, M. Complete genomic sequence of human coronavirus OC43: Molecular clock analysis suggests a relatively recent zoonotic coronavirus transmissionevent. J. Virol. 2005, 79, 1595–1604. [Google Scholar] [CrossRef] [PubMed]
- Leung, W.K.; To, K.F.; Chan, P.K.; Chan, H.L.; Wu, A.K.; Lee, N.; Yuen, K.Y.; Sung, J.J. Enteric involvement of severe acute respiratory syndromeassociated coronavirus infection. Gastroenterology 2003, 125, 1011–1017. [Google Scholar] [CrossRef]
- Wang, W.; Xu, Y.; Gao, R.; Lu, R.; Han, K.; Wu, G.; Tan, W. Detection of SARS-CoV-2 in different types of clinical specimens. JAMA 2020, 323, 1843–1844. [Google Scholar] [CrossRef]
- Hwang, J.-S.; Kregler, O.; Schilf, R.; Bannert, N.; Drach, J.C.; Townsend, L.B.; Bogner, E. Identification of acetylated, tetrahalogenated benzimidazole D-ribonucleotides with enhanced activity against human cytomegalovirus. J. Virol. 2007, 81, 11604–11611. [Google Scholar] [CrossRef] [PubMed]
- Hwang, J.-S.; Schilf, R.; Drach, J.C.; Townsend, L.B.; Bogner, E. Susceptibilities of HCMV clinical isolates and other herpesviruses to new acetylated, tetrahalogenated benzimidazole D-ribonucleosides. Antimicrob. Agents Chemother. 2009, 53, 5095–5101. [Google Scholar] [CrossRef]
- Chen, X.; Han, W.; Wang, G.; Zhao, V. Application prospect of polysaccharides in the development of anti-novel coronavirus drugs and vaccines. Int. J. Biol. Macromol. 2020, 164, 331–343. [Google Scholar] [CrossRef]
- Aquino, R.S.; Park, P.W. Glycosaminoglycans and infection. Front. Biosci. 2016, 21, 1260–1277. [Google Scholar] [CrossRef]
- Tandon, R.; Sharp, J.S.; Zhang, F.; Pomin, V.H.; Ashpole, N.M.; Mitra, D.; McCandless, M.G.; Jin, W.; Liu, H.; Sharma, P.; et al. Effective Inhibition of SARS-CoV-2 Entry by Heparin and Enoxaparin Derivatives. J. Virol. 2021, 95, e01987-20. [Google Scholar] [CrossRef]
- Milewska, A.; Zarebski, M.; Nowak, P.; Stozek, K.; Potempa, J.; Pyrc, K. Human coronavirus NL63 utilizes heparan sulfate proteoglycans for attachment to target cells. J. Virol. 2014, 88, 13221–13230. [Google Scholar] [CrossRef]
- Rother, S.; Samsonov, S.A.; Hempel, U.; Vogel, S.; Möller, S.; Blaszkiewicz, J.; Köhling, S.; Schnabelrauch, M.; Rademann, J.; Pisabarro, M.T.; et al. Sulfated hyaluronan alters the interaction profile of TIMP-3 with the endocytic receptor LRP-1 clusters II and IV and increases the extracellular TIMP-3 level of human bone marrow stromal cells. Biomacromolecules 2016, 17, 3252–3261. [Google Scholar] [CrossRef] [PubMed]










| Primer/Probe | Gene Target | Sequence (5′-3′) |
|---|---|---|
| BCoV | Nucleocapsid gene | |
| Forward | CGA TGA GGC TAT TCC GAC TAG GT | |
| Reverse | CCT TCC TGA GCC TTC AAT ATA GTA ACC | |
| Probe | FAM-TCC GCC TGG CAC GGT ACT CCC T-BBQ | |
| SARS-CoV-2 | Envelope gene | |
| Forward | ACAGGTACGTTAATAGTTAATAGCGT | |
| Reverse | ATATTGCAGCAGTACGCACACA | |
| Probe | FAM-ACACTAGCCATCCTTACTGCGCTTCG-BBQ |
| Sample | sHA3 | sCS3 |
|---|---|---|
| D.S. | 3.7 | 3.6 |
| Mn (g mol−1) | 56,180 (87,750) | 23,180 (26,180) |
| Mw (g mol−1) | 83,450 (150,040) | 26,230 (40,120) |
| Dispersity (Đ) | 1.7 | 1.5 |
| Compound | Mean EC50 (µM) a | Mean CC50 (µM) b | SI (µM) |
|---|---|---|---|
| Plaque Reduction | Cell Proliferation | CC50/EC50 | |
| sHA3 | 0.2996 ± 2.27 | 69.710 ± 0.80 | 232.68 |
| sCS3 | 1.7156 ± 1.08 | 141.360 ± 0.04 | 82.39 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Möller, S.; Theiß, J.; Deinert, T.I.L.; Golat, K.; Heinze, J.; Niemeyer, D.; Wyrwa, R.; Schnabelrauch, M.; Bogner, E. High-Sulfated Glycosaminoglycans Prevent Coronavirus Replication. Viruses 2022, 14, 413. https://doi.org/10.3390/v14020413
Möller S, Theiß J, Deinert TIL, Golat K, Heinze J, Niemeyer D, Wyrwa R, Schnabelrauch M, Bogner E. High-Sulfated Glycosaminoglycans Prevent Coronavirus Replication. Viruses. 2022; 14(2):413. https://doi.org/10.3390/v14020413
Chicago/Turabian StyleMöller, Stephanie, Janine Theiß, Thaira I. L. Deinert, Karoline Golat, Julian Heinze, Daniela Niemeyer, Ralf Wyrwa, Matthias Schnabelrauch, and Elke Bogner. 2022. "High-Sulfated Glycosaminoglycans Prevent Coronavirus Replication" Viruses 14, no. 2: 413. https://doi.org/10.3390/v14020413
APA StyleMöller, S., Theiß, J., Deinert, T. I. L., Golat, K., Heinze, J., Niemeyer, D., Wyrwa, R., Schnabelrauch, M., & Bogner, E. (2022). High-Sulfated Glycosaminoglycans Prevent Coronavirus Replication. Viruses, 14(2), 413. https://doi.org/10.3390/v14020413

