Secondary Structure of Subgenomic RNA M of SARS-CoV-2
Abstract
:1. Introduction
2. Material and Method
2.1. Experimental Constructs
2.2. Oligonucleotides Synthesis and Labelling
2.3. RNA Synthesis
2.4. RNA Folding
2.5. Chemical Mapping Using NMIA, DMS and CMCT
2.6. Processing of Chemical Mapping Data
2.7. Bioinformatic Analysis of Base Pairs Probabilities
2.8. Covariation Analysis
3. Results and Discussion
3.1. Structure Probing of sgRNA M of SARS-CoV-2
3.2. Base Pair Probabilities
3.3. Model of Secondary Structure for sgRNA M
3.4. Local Structural Motifs in sgRNA M Are Mostly Independent of Leader Sequence
3.5. Covariation Analysis of the sgRNA M Secondary Structure
3.6. Possible Influence of Nucleotide Mutation on sgRNA M Structure of SARS-CoV-2 Variants
4. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Gloster, A.T.; Lamnisos, D.; Lubenko, J.; Presti, G.; Squatrito, V.; Constantinou, M.; Nicolaou, C.; Papacostas, S.; Aydın, G.; Chong, Y.Y.; et al. Impact of COVID-19 pandemic on mental health: An international study. PLoS ONE 2020, 15, e0244809. [Google Scholar] [CrossRef] [PubMed]
- Rehman, S.U.; Shafique, L.; Ihsan, A.; Liu, Q. Evolutionary trajectory for the emergence of novel coronavirus SARS-CoV-2. Pathogens 2020, 9, 240. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kirtipal, N.; Bharadwaj, S.; Kang, S.G. From SARS to SARS-CoV-2, insights on structure, pathogenicity and immunity aspects of pandemic human coronaviruses. Infect. Genet. Evol. 2020, 85, 104502. [Google Scholar] [CrossRef] [PubMed]
- Arya, R.; Kumari, S.; Pandey, B.; Mistry, H.; Bihani, S.C.; Das, A.; Prashar, V.; Gupta, G.D.; Panicker, L.; Kumar, M. Structural insights into SARS-CoV-2 proteins. J. Mol. Biol. 2021, 433, 166725. [Google Scholar] [CrossRef] [PubMed]
- Wu, Y.C.; Chen, C.S.; Chan, Y.J. The outbreak of COVID-19: An overview. J. Chinese Med. Assoc. 2020, 83, 217–220. [Google Scholar] [CrossRef] [PubMed]
- Romano, M.; Ruggiero, A.; Squeglia, F.; Maga, G.; Berisio, R. A Structural View of SARS-CoV-2 RNA Replication Machinery: RNA Synthesis, Proofreading and Final Capping. Cells 2020, 9, 1267. [Google Scholar] [CrossRef] [PubMed]
- V’kovski, P.; Kratzel, A.; Steiner, S.; Stalder, H.; Thiel, V. Coronavirus biology and replication: Implications for SARS-CoV-2. Nat. Rev. Microbiol. 2021, 19, 155–170. [Google Scholar] [CrossRef]
- Kim, D.; Lee, J.Y.; Yang, J.S.; Kim, J.W.; Kim, V.N.; Chang, H. The Architecture of SARS-CoV-2 Transcriptome. Cell 2020, 181, 914–921. [Google Scholar] [CrossRef]
- Hartenian, E.; Nandakumar, D.; Lari, A.; Ly, M.; Tucker, J.M.; Glaunsinger, B.A. The molecular virology of coronaviruses. J. Biol. Chem. 2020, 295, 12910–12934. [Google Scholar] [CrossRef]
- Nomburg, J.; Meyerson, M.; DeCaprio, J.A. Pervasive generation of non-canonical subgenomic RNAs by SARS-CoV-2. Genome Med. 2020, 12, 108. [Google Scholar] [CrossRef]
- Sola, I.; Almazán, F.; Zúñiga, S.; Enjuanes, L. Continuous and Discontinuous RNA Synthesis in Coronaviruses. Annu. Rev. Virol. 2015, 2, 265–288. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Thiel, V.; Ivanov, K.A.; Putics, Á.; Hertzig, T.; Schelle, B.; Bayer, S.; Weißbrich, B.; Snijder, E.J.; Rabenau, H.; Doerr, H.W.; et al. Mechanisms and enzymes involved in SARS coronavirus genome expression. J. Gen. Virol. 2003, 84, 2305–2315. [Google Scholar] [CrossRef] [PubMed]
- Kiening, M.; Ochsenreiter, R.; Hellinger, H.J.; Rattei, T.; Hofacker, I.; Frishman, D. Conserved secondary structures in viral mRNAs. Viruses 2019, 11, 401. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- de Cesaris Araujo Tavares, R.; Mahadeshwar, G.; Wan, H.; Huston, N.C.; Pyle, A.M. The Global and Local Distribution of RNA Structure throughout the SARS-CoV-2 Genome. J. Virol. 2020, 95, e02190-20. [Google Scholar] [CrossRef]
- Andrews, R.J.; O’Leary, C.A.; Tompkins, V.S.; Peterson, J.M.; Haniff, H.S.; Williams, C.; Disney, M.D.; Moss, W.N. A map of the SARS-CoV-2 RNA structurome. NAR Genomics Bioinforma. 2021, 3, lqab043. [Google Scholar] [CrossRef]
- Rangan, R.; Zheludev, I.N.; Hagey, R.J.; Pham, E.A.; Wayment-Steele, H.K.; Glenn, J.S.; Das, R. RNA genome conservation and secondary structure in SARS-CoV-2 and SARS-related viruses: A first look. RNA 2020, 26, 937–959. [Google Scholar] [CrossRef]
- Simmonds, P. Pervasive RNA secondary structure in the genomes of SARS-CoV-2 and other coronaviruses. MBio 2020, 11, e01661-20. [Google Scholar] [CrossRef] [PubMed]
- Vandelli, A.; Monti, M.; Milanetti, E.; Armaos, A.; Rupert, J.; Zacco, E.; Bechara, E.; Delli Ponti, R.; Tartaglia, G.G. Structural analysis of SARS-CoV-2 genome and predictions of the human interactome. Nucleic Acids Res. 2020, 48, 11270–11283. [Google Scholar] [CrossRef]
- Manfredonia, I.; Nithin, C.; Ponce-Salvatierra, A.; Ghosh, P.; Wirecki, T.K.; Marinus, T.; Ogando, N.S.; Snijder, E.J.; van Hemert, M.J.; Bujnicki, J.M.; et al. Genome-wide mapping of SARS-CoV-2 RNA structures identifies therapeutically-relevant elements. Nucleic Acids Res. 2020, 48, 12436–12452. [Google Scholar] [CrossRef]
- Lan, T.; Allan, M.; Malsick, L.; Khandwala, S.; Nyeo, S.; Sun, Y.; Guo, J.U.; Bathe, M.; Griffiths, A.; Rouskin, S. Insights into the secondary structural ensembles of the full SARS-CoV-2 RNA genome in infected cells. bioRxiv 2021. 2020.06.29. [Google Scholar]
- Sun, L.; Li, P.; Ju, X.; Rao, J.; Huang, W.; Ren, L.; Zhang, S.; Xiong, T.; Xu, K.; Zhou, X.; et al. In vivo structural characterization of the SARS-CoV-2 RNA genome identifies host proteins vulnerable to repurposed drugs. Cell 2021, 184, 1865–1883.e20. [Google Scholar] [CrossRef] [PubMed]
- Sanders, W.; Fritch, E.J.; Madden, E.A.; Graham, R.L.; Vincent, H.A.; Heise, M.T.; Baric, R.S.; Moorman, N.J. Comparative analysis of coronavirus genomic RNA structure reveals conservation in SARS-like coronaviruses. bioRxiv 2020. 2020.06.15. [Google Scholar] [CrossRef]
- Yang, S.L.; DeFalco, L.; Anderson, D.E.; Zhang, Y.; Aw, J.; Lim, S.Y.; Lim, X.N.; Tan, K.Y.; Zhang, T.; Chawla, T.; et al. Comprehensive mapping of SARS-CoV-2 interactions in vivo reveals functional virus-host interactions. Nat Commun. 2021, 12, 5113. [Google Scholar] [CrossRef] [PubMed]
- Kierzek, E.; Kierzek, R. The thermodynamic stability of RNA duplexes and hairpins containing N6-alkyladenosines and 2-methylthio-N6-alkyladenosines. Nucleic Acids Res. 2003, 31, 4472–4480. [Google Scholar] [CrossRef]
- Xia, T.; SantaLucia, J.; Burkard, M.E.; Kierzek, R.; Schroeder, S.J.; Jiao, X.; Cox, C.; Turner, D.H. Thermodynamic parameters for an expanded nearest-neighbor model for formation of RNA duplexes with Watson - Crick base pairs. Biochemistry 1998, 37, 14719–14735. [Google Scholar] [CrossRef] [Green Version]
- Ehresmann, C.; Baudin, F.; Mougel, M.; Romby, P.; Ebel, J.P.; Ehresmann, B. Probing the structure of RNAs in solution. Nucleic Acids Res. 1987, 15, 9109–9128. [Google Scholar] [CrossRef] [Green Version]
- Merino, E.J.; Wilkinson, K.A.; Coughlan, J.L.; Weeks, K.M. RNA structure analysis at single nucleotide resolution by Selective 2′-Hydroxyl Acylation and Primer Extension (SHAPE). J. Am. Chem. Soc. 2005, 127, 4223–4231. [Google Scholar] [CrossRef]
- Ziehler, W.A.; Engelke, D.R. Probing RNA Structure with Chemical Reagents and Enzymes. Curr. Protoc. Nucleic Acid Chem. 2001. Chapter 6, Unit 6.1. [Google Scholar] [CrossRef]
- Karabiber, F.; McGinnis, J.L.; Favorov, O.V.; Weeks, K.M. QuShape: Rapid, accurate, and best-practices quantification of nucleic acid probing information, resolved by capillary electrophoresis. RNA 2013, 19, 63–73. [Google Scholar] [CrossRef] [Green Version]
- Reuter, J.S.; Mathews, D.H. RNAstructure: Software for RNA secondary structure prediction and analysis. BMC Bioinformatics 2010, 11, 129. [Google Scholar] [CrossRef] [Green Version]
- Deigan, K.E.; Li, T.W.; Mathews, D.H.; Weeks, K.M. Accurate SHAPE-directed RNA structure determination. Proc. Natl. Acad. Sci. USA 2009, 106, 97–102. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Mathews, D.H.; Disney, M.D.; Childs, J.L.; Schroeder, S.J.; Zuker, M.; Turner, D.H. Incorporating chemical modification constraints into a dynamic programming algorithm for prediction of RNA secondary structure. Proc. Natl. Acad. Sci. USA 2004, 101, 7287–7292. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Nawrocki, E.P.; Eddy, S.R. Infernal 1.1: 100-fold faster RNA homology searches. Bioinformatics 2013, 29, 2933–2935. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Nawrocki, E.P.; Kolbe, D.L.; Eddy, S.R. Infernal 1.0: Inference of RNA alignments. Bioinformatics 2009, 25, 1335–1337. [Google Scholar] [CrossRef] [Green Version]
- Rivas, E.; Clements, J.; Eddy, S.R. A statistical test for conserved RNA structure shows lack of evidence for structure in lncRNAs. Nat. Methods 2016, 14, 45–48. [Google Scholar] [CrossRef] [Green Version]
- Rivas, E.; Clements, J.; Eddy, S.R. Estimating the power of sequence covariation for detecting conserved RNA structure. Bioinformatics 2020, 36, 3072–3076. [Google Scholar] [CrossRef] [Green Version]
- Pickett, B.E.; Sadat, E.L.; Zhang, Y.; Noronha, J.M.; Squires, R.B.; Hunt, V.; Liu, M.; Kumar, S.; Zaremba, S.; Gu, Z.; et al. ViPR: An open bioinformatics database and analysis resource for virology research. Nucleic Acids Res. 2012, 40, D593–D598. [Google Scholar] [CrossRef]
- Pickett, B.E.; Greer, D.S.; Zhang, Y.; Stewart, L.; Zhou, L.; Sun, G.; Gu, Z.; Kumar, S.; Zaremba, S.; Larsen, C.N.; et al. Virus pathogen Database and Analysis Resource (ViPR): A comprehensive bioinformatics Database and Analysis Resource for the Coronavirus research community. Viruses 2012, 4, 3209–3226. [Google Scholar] [CrossRef] [Green Version]
- Katoh, K.; Rozewicki, J.; Yamada, K.D. MAFFT online service: Multiple sequence alignment, interactive sequence choice and visualization. Brief. Bioinform. 2018, 20, 1160–1166. [Google Scholar] [CrossRef] [Green Version]
- Lu, Z.J.; Gloor, J.W.; Mathews, D.H. Improved RNA secondary structure prediction by maximizing expected pair accuracy. RNA 2009, 15, 1805–1813. [Google Scholar] [CrossRef] [Green Version]
- Miao, Z.; Tidu, A.; Eriani, G.; Martin, F. Secondary structure of the SARS-CoV-2 5’-UTR. RNA Biol. 2021, 18, 447–456. [Google Scholar] [CrossRef] [PubMed]
- Wacker, A.; Weigand, J.E.; Akabayov, S.R.; Altincekic, N.; Bains, J.K.; Banijamali, E.; Binas, O.; Castillo-Martinez, J.; Cetiner, E.; Ceylan, B.; et al. Secondary structure determination of conserved SARS-CoV-2 RNA elements by NMR spectroscopy. Nucleic Acids Res. 2020, 48, 7204–7205. [Google Scholar] [CrossRef] [PubMed]
- Ziv, O.; Price, J.; Shalamova, L.; Kamenova, T.; Goodfellow, I.; Weber, F.; Miska, E.A. The Short- and Long-Range RNA-RNA Interactome of SARS-CoV-2. Mol. Cell 2020, 80, 1067–1077. [Google Scholar] [CrossRef] [PubMed]
- Chen, S.C.; Olsthoorn, R.C.L. Group-specific structural features of the 5′-proximal sequences of coronavirus genomic RNAs. Virology 2010, 401, 29–41. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Li, L.; Kang, H.; Liu, P.; Makkinje, N.; Williamson, S.T.; Leibowitz, J.L.; Giedroc, D.P. Structural Lability in Stem-Loop 1 Drives a 5′ UTR-3′ UTR Interaction in Coronavirus Replication. J. Mol. Biol. 2008, 377, 790–803. [Google Scholar] [CrossRef] [PubMed]
- Liu, P.; Li, L.; Millership, J.J.; Kang, H.; Leibowitz, J.L.; Giedroc, D.P. A U-turn motif-containing stem-loop in the coronavirus 5′ untranslated region plays a functional role in replication. RNA 2007, 13, 763–780. [Google Scholar] [CrossRef] [Green Version]
- Xu, L.; Khadijah, S.; Fang, S.; Wang, L.; Tay, F.P.L.; Liu, D.X. The Cellular RNA Helicase DDX1 Interacts with Coronavirus Nonstructural Protein 14 and Enhances Viral Replication. J. Virol. 2010, 84, 8571–8583. [Google Scholar] [CrossRef] [Green Version]
- Vlachogiannis, N.I.; Verrou, K.-M.; Stellos, K.; Sfikakis, P.P.; Paraskevis, D. The role of A-to-I RNA editing in infections by RNA viruses: Possible implications for SARS-CoV-2 infection. Clin. Immunol. 2021, 226, 108699. [Google Scholar] [CrossRef]
- Sarkar, S.N.; Bandyopadhyay, S.; Ghosh, A.; Sen, G.C. Enzymatic characteristics of recombinant medium isozyme of 2’-5’ oligoadenylate synthetase. J. Biol. Chem. 1999, 274, 1848–1855. [Google Scholar] [CrossRef] [Green Version]
- Sarkar, S.N.; Ghosh, A.; Wang, H.W.; Sung, S.S.; Sen, G.C. The nature of the catalytic domain of 2’-5’-oligoadenylate synthetases. J. Biol. Chem. 1999, 274, 25535–25542. [Google Scholar] [CrossRef] [Green Version]
- Wu, C.H.; Chen, P.J.; Yeh, S.H. Nucleocapsid phosphorylation and RNA helicase DDX1 recruitment enables coronavirus transition from discontinuous to continuous transcription. Cell Host Microbe 2014, 16, 462–472. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ponti, R.D.; Armaos, A.; Vandelli, A.; Tartaglia, G.G. CROSSalive: A web server for predicting the in vivo structure of RNA molecules. Bioinformatics 2020, 36, 940–941. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- de Groot, N.S.; Armaos, A.; Graña-Montes, R.; Alriquet, M.; Calloni, G.; Vabulas, R.M.; Tartaglia, G.G. RNA structure drives interaction with proteins. Nat. Commun. 2019, 10, 3246. [Google Scholar] [CrossRef] [PubMed]
- Cid-Samper, F.; Gelabert-Baldrich, M.; Lang, B.; Lorenzo-Gotor, N.; Ponti, R.D.; Severijnen, L.A.W.F.M.; Bolognesi, B.; Gelpi, E.; Hukema, R.K.; Botta-Orfila, T.; et al. An Integrative Study of Protein-RNA Condensates Identifies Scaffolding RNAs and Reveals Players in Fragile X-Associated Tremor/Ataxia Syndrome. Cell Rep. 2018, 25, 3422–3434. [Google Scholar] [CrossRef] [Green Version]
- Cerase, A.; Armaos, A.; Neumayer, C.; Avner, P.; Guttman, M.; Tartaglia, G.G. Phase separation drives X-chromosome inactivation: A hypothesis. Nat. Struct. Mol. Biol. 2019, 26, 331–334. [Google Scholar] [CrossRef]
- Huston, N.C.; Wan, H.; Strine, M.S.; de Cesaris Araujo Tavares, R.; Wilen, C.B.; Pyle, A.M. Comprehensive in vivo secondary structure of the SARS-CoV-2 genome reveals novel regulatory motifs and mechanisms. Mol. Cell 2021, 81, 584–598.e5. [Google Scholar] [CrossRef]
Primer Name | Primer Length (nt) | Sequence 5′→3′ |
---|---|---|
FM | 46 | GCGTAATACGACTCACTATAGGGATTAAAGGTTTATACCTTCCCAG |
RM | 29 | TTACTGTACAAGCAAAGCAATATTGTCAC |
F1 | 54 | CTTGTAGATCTGTTCTCTAAACGAACTAAATATTATATTAGTTTTTCTGTTTGG |
F2 | 48 | GTAACAAACCAACCAACTTTCGATCT CTTGTAGATCTGTTCTCTAAAC |
F3 | 45 | ATTAAAGGTTTATACCTTCCCAGGTAACAAACCAACCAACTTTCG |
FC | 29 | TTCTGCAG ATTAAAGGTTTATACCTTCCC |
RC | 37 | ATGAATTCTTACTGTACAAGCAAAGCAATATTGTCAC |
M13F | 24 | CGCCAGGGTTTTCCCAGTCACGAC |
Primer Name | Primer Length (nt) | Sequence 5′→3′ |
---|---|---|
M1 | 27 | TTACTGTACAAGCAAAGCAATATTGTC |
M2 | 21 | CAGCTCCGATTACGAGTTCAC |
M3 | 24 | CAAGCTAAAGTTACTGGCCATAAC |
Nucleotide Mutations in Coding Region 1 | SARS-CoV-2 Variants and Variants Representatives 2 | Amino Acid Mutation 3 | Influence of Nucleotide Mutations on RNA Structure 4 |
---|---|---|---|
8(127) A > G | Omicron-B.1.1.529 (EPI ISL 6704867) Omicron BA.1 (EPI ISL 8482282) Omicron BA.2 (EPI ISL 8479001) | 3D > G | consistent mutation A-U > G●U |
46(165) C > A | AT.1 (EPI ISL 1652580) | 16L > I | inconsistent mutationG-C > G..A |
55(174) C > G | Omicron-B.1.1.529 (EPI ISL 6704867) Omicron BA.1 (EPI ISL 8482282) Omicron BA.2 (EPI ISL 8479001) | 19Q > E | single-stranded region—no influence |
82(201) U > C | R.1 (EPI ISL 1123466) | 28F > L | single-stranded region—no influence |
84(203) C > U | B.1.619.1 (EPI ISL 2361101) | - | single-stranded region—no influence |
85(204) C > U | C.1.2 (EPI ISL 2942287) | 29L > F | single-stranded region—no influence |
159(278) C > U | A.2.5.2 (EPI ISL 1502915) Kappa-B.1.617.1 (EPI ISL 1384866) Epsilon-B.1.429 (EPI ISL 648527) Epsilon-B.1.427 (EPI ISL 1531902) | - | consistent mutation C-G > U●G |
187(306) G > A | Omicron-B.1.1.529 (EPI ISL 6704867) Omicron BA.1 (EPI ISL 8482282) Omicron BA.2 (EPI ISL 8479001) AV.1 B.1.1.482.1 (EPI ISL 2179526) | 63A > T | inconsistent mutations G-C > A..C |
213(332) C > U | B.1.466.2 (EPI ISL 1533080) | - | consistent mutation C-G > U●G |
241(361) G > U | Delta-AY.27 B.1.617.2 (EPI ISL 3910943) | 81A > S | single-stranded region—no influence |
245(364) U > C | Delta-B.1.617.2 (EPI ISL 1758376) C.1.2 (EPI ISL 2942287) B.1.640 (EPI ISL 5655471) Eta-B.1.525 (EPI ISL 760883) C.36.3 (EPI ISL 1245879) B.1.1.318 (EPI ISL 986813) B.1.619.1 (EPI ISL 2361101) B.1.575 (EPI ISL 2634469) B.1.1.523 (EPI ISL 2448704) AZ.5 (EPI ISL 2834919) Delta-B.1.617.2 (EPI ISL 2519798) Delta-AY.4.2 B.1.617.2 (EPI ISL 2851674) Delta-AY.33 B.1.617.2 (EPI ISL 4506526) Delta-AY.27 B.1.617.2 (EPI ISL 3910943) Delta-AY.26 B.1.617.2 (EPI ISL 2306061) Delta-AY.25 (EPI ISL 2295285) Delta-AY.3 B.1.617.2 (EPI ISL 3459265) Delta-AY.43 (EPI ISL 3565601) Delta-AY.47 (EPI ISL 2611181) Delta-AY.98.1 (EPI ISL 3305991) Delta-B.1.617.2 (EPI ISL 2306894) | 82I > T | single-stranded region—no influence |
245(364) U > G | Kappa-B.1.617.1 (EPI ISL 1384866) | 82I > S | single-stranded region—no influence |
279(398) C > G | B.1.177.82 (EPI ISL 617709) | - | single-stranded region—no influence |
372(491) C > U | Lambda-C.37 (EPI ISL 1138413) N10 (EPI ISL 1465243) | - | single-stranded region—no influence |
373(492) C > U | AV.1 B.1.1.482.1 (EPI ISL 2179526) | 125H > Y | single-stranded region—no influence |
450(569) U > C | B.1.258.17 (EPI ISL 618584) | - | single-stranded region—no influence |
621(740) C > U | A.2.5.2 (EPI ISL 1502915) | - | single-stranded region—no influence |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Soszynska-Jozwiak, M.; Ruszkowska, A.; Kierzek, R.; O’Leary, C.A.; Moss, W.N.; Kierzek, E. Secondary Structure of Subgenomic RNA M of SARS-CoV-2. Viruses 2022, 14, 322. https://doi.org/10.3390/v14020322
Soszynska-Jozwiak M, Ruszkowska A, Kierzek R, O’Leary CA, Moss WN, Kierzek E. Secondary Structure of Subgenomic RNA M of SARS-CoV-2. Viruses. 2022; 14(2):322. https://doi.org/10.3390/v14020322
Chicago/Turabian StyleSoszynska-Jozwiak, Marta, Agnieszka Ruszkowska, Ryszard Kierzek, Collin A. O’Leary, Walter N. Moss, and Elzbieta Kierzek. 2022. "Secondary Structure of Subgenomic RNA M of SARS-CoV-2" Viruses 14, no. 2: 322. https://doi.org/10.3390/v14020322
APA StyleSoszynska-Jozwiak, M., Ruszkowska, A., Kierzek, R., O’Leary, C. A., Moss, W. N., & Kierzek, E. (2022). Secondary Structure of Subgenomic RNA M of SARS-CoV-2. Viruses, 14(2), 322. https://doi.org/10.3390/v14020322