Rapid Extraction and Detection of African Swine Fever Virus DNA Based on Isothermal Recombinase Polymerase Amplification Assay
Abstract
:1. Introduction
2. Materials and Methods
2.1. Clinical Samples and Ethical Statement
2.2. Molecular DNA Standard and RPA Oligonucleotides
2.3. RPA Conditions
2.4. Analytical Sensitivity and Specificity
2.5. Nucleic Acid Extraction Procedures
2.6. Real-Time PCR Conditions
2.7. Pilot Field Deployment
3. Results
3.1. Selection of RPA Primers and Probe
3.2. Analytical Sensitivity and Specificity
3.3. Clinical Samples
3.4. Field Deployment in Low-Resource Settings
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Alonso, C.; Borca, M.; Dixon, L.; Revilla, Y.; Rodriguez, F.; Escribano, J.M. ICTV virus taxonomy profile: Asfarviridae. J. Gen. Virol. 2018, 99, 613–614. [Google Scholar] [CrossRef] [PubMed]
- Galindo, I.; Alonso, C. African swine fever virus: A review. Viruses 2017, 9, 103. [Google Scholar] [CrossRef] [Green Version]
- Bastos, A.D.; Penrith, M.L.; Cruciere, C.; Edrich, J.L.; Hutchings, G.; Roger, F.; Couacy-Hymann, E.; Thomson, G.R. Genotyping field strains of African swine fever virus by partial p72 gene characterisation. Arch. Virol. 2003, 148, 693–706. [Google Scholar] [CrossRef] [PubMed]
- Malogolovkin, A.; Burmakina, G.; Titov, I.; Sereda, A.; Gogin, A.; Baryshnikova, E.; Kolbasov, D. Comparative analysis of African swine fever virus genotypes and serogroups. Emerg. Infect. Dis. 2015, 21, 312. [Google Scholar] [CrossRef]
- Boshoff, C.I.; Bastos, A.D.; Gerber, L.; Vosloo, W. Genetic characterisation of African swine fever viruses from outbreaks in southern Africa (1973–1999). Vet. Microbiol. 2007, 121, 45–55. [Google Scholar] [CrossRef] [Green Version]
- Lubisi, B.A.; Bastos, A.D.S.; Dwarka, R.M.; Vosloo, W. Intra-genotypic resolution of African swine fever viruses from an East African domestic pig cycle: A combined p72-CVR approach. Virus Genes 2007, 35, 729–735. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Achenbach, J.; Gallardo, C.; Nieto-Pelegrín, E.; Rivera-Arroyo, B.; Degefa-Negi, T.; Arias, M.; Jenberie, S.; Mulisa, D.; Gizaw, D.; Gelaye, E. Identification of a new genotype of African swine fever virus in domestic pigs from Ethiopia. Transbound. Emerg. Dis. 2017, 64, 1393–1404. [Google Scholar] [CrossRef]
- Quembo, C.J.; Jori, F.; Vosloo, W.; Heath, L. Genetic characterization of African swine fever virus isolates from soft ticks at the wildlife/domestic interface in Mozambique and identification of a novel genotype. Transbound. Emerg. Dis. 2018, 65, 420–431. [Google Scholar] [CrossRef] [Green Version]
- Montgomery, R.E. On a form of swine fever occurring in British East Africa (Kenya Colony). J. Comp. Pathol. Ther. 1921, 34, 159–191. [Google Scholar] [CrossRef] [Green Version]
- Beltran-Alcrudo, D.; Gallardo, M.; Kramer, S.; Penrith, M.; Kamata, A.; Wiersma, L. African Swine Fever: Detection and Diagnosis; Food and Agriculture Organization of the United Nations (FAO): Rome, Italy, 2017. [Google Scholar]
- Manso Ribeiro, J.; Azevedo, R.; Teixeira, J.; Braco, M.; Rodrıguez, A.; Oliveira, E.; Noronha, F.; Grave, C.; Vigario, J. An atypical strain of swine fever virus in Portugal. Bull. OIE 1963, 50, 516–534. [Google Scholar]
- Rowlands, R.J.; Michaud, V.; Heath, L.; Hutchings, G.; Oura, C.; Vosloo, W.; Dwarka, R.; Onashvili, T.; Albina, E.; Dixon, L.K. African swine fever virus isolate, Georgia, 2007. Emerg. Infect. Dis. 2008, 14, 1870. [Google Scholar] [CrossRef] [PubMed]
- Sauter-Louis, C.; Forth, J.H.; Probst, C.; Staubach, C.; Hlinak, A.; Rudovsky, A.; Holland, D.; Schlieben, P.; Göldner, M.; Schatz, J. Joining the club: First detection of African swine fever in wild boar in Germany. Transbound. Emerg. Dis. 2020, 68, 1744–1752. [Google Scholar] [CrossRef]
- Pejsak, Z.; Truszczyński, M.; Kozak, E.; Markowska-Daniel, I. Epidemiological analysis of two first cases of African swine fever in wild boars in Poland. Med. Weter. 2014, 70, 369–372. [Google Scholar]
- Frant, M.; Lyjak, M.; Bocian, L.; Barszcz, A.; Niemczuk, K.; Wozniakowski, G. African swine fever virus (ASFV) in Poland: Prevalence in a wild boar population (2017–2018). Veterinární Med. 2020, 65, 143–158. [Google Scholar] [CrossRef] [Green Version]
- Cwynar, P.; Stojkov, J.; Wlazlak, K. African swine fever status in Europe. Viruses 2019, 11, 310. [Google Scholar] [CrossRef] [Green Version]
- Dixon, L.; Sun, H.; Roberts, H. African swine fever. Antivir. Res. 2019, 165, 34–41. [Google Scholar] [CrossRef]
- Blome, S.; Franzke, K.; Beer, M. African swine fever—A review of current knowledge. Virus Res. 2020, 287, 198099. [Google Scholar] [CrossRef]
- Sánchez-Vizcaíno, J.; Mur, L.; Gomez-Villamandos, J.; Carrasco, L. An update on the epidemiology and pathology of African swine fever. J. Comp. Pathol. 2015, 152, 9–21. [Google Scholar] [CrossRef] [PubMed]
- King, D.P.; Reid, S.M.; Hutchings, G.H.; Grierson, S.S.; Wilkinson, P.J.; Dixon, L.K.; Bastos, A.D.S.; Drew, T.W. Development of a TaqMan® PCR assay with internal amplification control for the detection of African swine fever virus. J. Virol. Methods 2003, 107, 53–61. [Google Scholar] [CrossRef]
- Aguero, M.; Fernandez, J.; Romero, L.J.; Zamora, M.J.; Sanchez, C.; Belak, S.; Arias, M.; Sanchez-Vizcaino, J.M. A highly sensitive and specific gel-based multiplex RT-PCR assay for the simultaneous and differential diagnosis of African swine fever and Classical swine fever in clinical samples. Vet. Res. 2004, 35, 551–563. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Fernandez-Pinero, J.; Gallardo, C.; Elizalde, M.; Robles, A.; Gomez, C.; Bishop, R.; Heath, L.; Couacy-Hymann, E.; Fasina, F.O.; Pelayo, V.; et al. Molecular diagnosis of African Swine Fever by a new real-time PCR using universal probe library. Transbound Emerg. Dis. 2013, 60, 48–58. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Elnagar, A.; Pikalo, J.; Beer, M.; Blome, S.; Hoffmann, B. Swift and Reliable “Easy Lab” Methods for the Sensitive Molecular Detection of African Swine Fever Virus. Int. J. Mol. Sci. 2021, 22, 2307. [Google Scholar] [CrossRef] [PubMed]
- Abd El Wahed, A.; El-Deeb, A.; El-Tholoth, M.; Abd El Kader, H.; Ahmed, A.; Hassan, S.; Hoffmann, B.; Haas, B.; Shalaby, M.A.; Hufert, F.T.; et al. A portable reverse transcription recombinase polymerase amplification assay for rapid detection of foot-and-mouth disease virus. PLoS ONE 2013, 8, e71642. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Best, N.; Rodoni, B.; Rawlin, G.; Beddoe, T. The development and deployment of a field-based loop mediated isothermal amplification assay for virulent Dichelobacter nodosus detection on Australian sheep. PLoS ONE 2018, 13, e0204310. [Google Scholar] [CrossRef] [PubMed]
- Li, J.; Macdonald, J.; von Stetten, F. A comprehensive summary of a decade development of the recombinase polymerase amplification. Analyst 2018, 144, 31–67. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- R Core Team, R. R: A Language and Environment for Statistical Computing. 2013. Available online: https://www.R-project.org/ (accessed on 2 April 2021).
- Hadley, W. Ggplot2: Elegrant Graphics for Data Analysis; Springer: New York, NY, USA, 2016. [Google Scholar]
- Yu, M.; Morrissy, C.J.; Westbury, H.A. Strong sequence conservation of African swine fever virus p72 protein provides the molecular basis for its antigenic stability. Arch. Virol. 1996, 141, 1795–1802. [Google Scholar] [CrossRef] [PubMed]
- OIE. Manual of Diagnostic Tests and Vaccines for Terrestrial Animals; OIE: Paris, France, 2019. [Google Scholar]
- Liu, L.; Atim, S.; LeBlanc, N.; Rauh, R.; Esau, M.; Chenais, E.; Mwebe, R.; Nelson, W.M.; Masembe, C.; Nantima, N.; et al. Overcoming the challenges of pen-side molecular diagnosis of African swine fever to support outbreak investigations under field conditions. Transbound. Emerg. Dis. 2019, 66, 908–914. [Google Scholar] [CrossRef]
- Daigle, J.; Onyilagha, C.; Truong, T.; Le, V.P.; Nga, B.T.T.; Nguyen, T.L.; Clavijo, A.; Ambagala, A. Rapid and highly sensitive portable detection of African swine fever virus. Transbound. Emerg. Dis. 2020, 68, 952–959. [Google Scholar] [CrossRef]
- Zhang, Y.; Li, Q.; Guo, J.; Li, D.; Wang, L.; Wang, X.; Xing, G.; Deng, R.; Zhang, G. An Isothermal Molecular Point of Care Testing for African Swine Fever Virus Using Recombinase-Aided Amplification and Lateral Flow Assay Without the Need to Extract Nucleic Acids in Blood. Front. Cell. Infect. Microbiol. 2021, 11, 131. [Google Scholar] [CrossRef] [PubMed]
- El Wahed, A.A.; Patel, P.; Maier, M.; Pietsch, C.; Rüster, D.; Böhlken-Fascher, S.; Kissenkötter, J.; Behrmann, O.; Frimpong, M.; Diagne, M.M. Suitcase Lab for Rapid Detection of SARS-CoV-2 Based on Recombinase Polymerase Amplification Assay. Anal. Chem. 2021, 93, 2627–2634. [Google Scholar] [CrossRef]
- Kersting, S.; Rausch, V.; Bier, F.F.; von Nickisch-Rosenegk, M. Rapid detection of Plasmodium falciparum with isothermal recombinase polymerase amplification and lateral flow analysis. Malar. J. 2014, 13, 1–9. [Google Scholar] [CrossRef] [Green Version]
- Piepenburg, O.; Williams, C.H.; Stemple, D.L.; Armes, N.A. DNA Detection Using Recombination Proteins. PLoS Biol. 2006, 4, e204. [Google Scholar] [CrossRef]
- Deepak, S.; Kottapalli, K.; Rakwal, R.; Oros, G.; Rangappa, K.; Iwahashi, H.; Masuo, Y.; Agrawal, G. Real-time PCR: Revolutionizing detection and expression analysis of genes. Curr. Genom. 2007, 8, 234–251. [Google Scholar] [CrossRef] [PubMed]
- Mondal, D.; Ghosh, P.; Khan, M.A.A.; Hossain, F.; Böhlken-Fascher, S.; Matlashewski, G.; Kroeger, A.; Olliaro, P.; Abd El Wahed, A. Mobile suitcase laboratory for rapid detection of Leishmania donovani using recombinase polymerase amplification assay. Parasites Vectors 2016, 9, 1–8. [Google Scholar] [CrossRef] [Green Version]
- Faye, O.; Faye, O.; Soropogui, B.; Patel, P.; Abd El Wahed, A.; Loucoubar, C.; Fall, G.; Kiory, D.; Magassouba, N.F.; Keita, S. Development and deployment of a rapid recombinase polymerase amplification Ebola virus detection assay in Guinea in 2015. Eurosurveillance 2015, 20, 30053. [Google Scholar] [CrossRef] [PubMed]
- Abd El Wahed, A.; Weidmann, M.; Hufert, F.T. Diagnostics-in-a-Suitcase: Development of a portable and rapid assay for the detection of the emerging avian influenza A (H7N9) virus. J. Clin. Virol. 2015, 69, 16–21. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- James, H.E.; Ebert, K.; McGonigle, R.; Reid, S.M.; Boonham, N.; Tomlinson, J.A.; Hutchings, G.H.; Denyer, M.; Oura, C.A.; Dukes, J.P. Detection of African swine fever virus by loop-mediated isothermal amplification. J. Virol. Methods 2010, 164, 68–74. [Google Scholar] [CrossRef] [PubMed]
- Wang, D.; Yu, J.; Wang, Y.; Zhang, M.; Li, P.; Liu, M.; Liu, Y. Development of a real-time loop-mediated isothermal amplification (LAMP) assay and visual LAMP assay for detection of African swine fever virus (ASFV). J. Virol. Methods 2020, 276, 113775. [Google Scholar] [CrossRef] [PubMed]
- Gao, Y.; Meng, X.-Y.; Zhang, H.; Luo, Y.; Sun, Y.; Li, Y.; Abid, M.; Qiu, H.-J. Cross-priming amplification combined with immunochromatographic strip for rapid on-site detection of African swine fever virus. Sens. Actuators B Chem. 2018, 274, 304–309. [Google Scholar] [CrossRef]
- Frączyk, M.; Woźniakowski, G.; Kowalczyk, A.; Niemczuk, K.; Pejsak, Z. Development of cross-priming amplification for direct detection of the African Swine Fever Virus, in pig and wild boar blood and sera samples. Lett. Appl. Microbiol. 2016, 62, 386–391. [Google Scholar] [CrossRef] [Green Version]
- Woźniakowski, G.; Frączyk, M.; Mazur, N. Comparison of loop-mediated isothermal amplification (LAMP) and cross-priming amplification (CPA) for detection of African swine fever virus. Pol. J. Vet. Sci. 2018, 21, 827–830. [Google Scholar] [PubMed]
- Ren, M.; Mei, H.; Zhou, M.; Fu, Z.F.; Han, H.; Bi, D.; Peng, F.; Zhao, L. Development of A Super-Sensitive Diagnostic Method for African Swine Fever Using CRISPR Techniques. Virol. Sin. 2021, 36, 220–230. [Google Scholar] [CrossRef]
- Zhang, S.; Sun, A.; Wan, B.; Du, Y.; Wu, Y.; Zhang, A.; Jiang, D.; Ji, P.; Wei, Z.; Zhuang, G.; et al. Development of a Directly Visualized Recombinase Polymerase Amplification–SYBR Green I Method for the Rapid Detection of African Swine Fever Virus. Front. Microbiol. 2020, 11, 3. [Google Scholar] [CrossRef] [PubMed]
- Fan, X.; Li, L.; Zhao, Y.; Liu, Y.; Liu, C.; Wang, Q.; Dong, Y.; Wang, S.; Chi, T.; Song, F.; et al. Clinical Validation of Two Recombinase-Based Isothermal Amplification Assays (RPA/RAA) for the Rapid Detection of African Swine Fever Virus. Front Microbiol 2020, 11, 1696. [Google Scholar] [CrossRef]
- Wang, Z.-H.; Li, P.; Lin, X.; Jia, H.; Jiang, Y.-T.; Wang, X.-J.; Hou, S.-H. Application of portable real-time recombinase-aided amplification (rt-RAA) assay in the clinical diagnosis of ASFV and prospective DIVA diagnosis. Appl. Microbiol. Biotechnol. 2021, 105, 3249–3264. [Google Scholar] [CrossRef] [PubMed]
ID | Sequence (5′ to 3′) |
---|---|
Probe | ATCGATAAATTTCCATCAAAGTTCTGCAGC-BHQ1-THF-FAM-TACATACCCTTCCAC |
FP1 | TGGTATCAATCTTATCGATAAATTTCCATCAA |
FP2 | CCTATTATTAAAAACATTTCCGTAACTGCTCA |
FP3 | ATATTAGCCCCGTTACGTATCCGATCACATTA |
RP1 | AATTCTCTTGCTCTGGATACGTTAATATGACC |
RP2 | ACTGGGTTGGTATTCCTCCCGTGGCTTCAAAG |
RP3 | CAAAGGTAATCATCATCGCACCCGGATCATCG |
Virus Name | Virus Type | Number of Samples |
---|---|---|
African swine fever virus | DNA, enveloped, double-stranded | 10 |
Classical swine fever virus | RNA, enveloped, single-stranded | 11 |
Porcine parvovirus (NADL-2) | DNA, non-enveloped, single-stranded | 1 |
Foot and mouth disease virus | RNA, non-enveloped, single-stranded | 10 |
Modified vaccinia Ankara | DNA, enveloped, double-stranded | 1 |
Porcine circovirus-2 | DNA, non-enveloped, single-stranded | 1 |
Extraction Method | Sensitivity (n = 37) | Specificity (n = 36) | ||
---|---|---|---|---|
RPA | Real-Time PCR | RPA | Real-Time PCR | |
Qiagen DNeasy Blood & Tissue kit | 100% | 100% | 100% | 100% |
Heated sample in lysis buffer | 97% | 38% | 100% | 100% |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ceruti, A.; Kobialka, R.M.; Ssekitoleko, J.; Okuni, J.B.; Blome, S.; Abd El Wahed, A.; Truyen, U. Rapid Extraction and Detection of African Swine Fever Virus DNA Based on Isothermal Recombinase Polymerase Amplification Assay. Viruses 2021, 13, 1731. https://doi.org/10.3390/v13091731
Ceruti A, Kobialka RM, Ssekitoleko J, Okuni JB, Blome S, Abd El Wahed A, Truyen U. Rapid Extraction and Detection of African Swine Fever Virus DNA Based on Isothermal Recombinase Polymerase Amplification Assay. Viruses. 2021; 13(9):1731. https://doi.org/10.3390/v13091731
Chicago/Turabian StyleCeruti, Arianna, Rea Maja Kobialka, Judah Ssekitoleko, Julius Boniface Okuni, Sandra Blome, Ahmed Abd El Wahed, and Uwe Truyen. 2021. "Rapid Extraction and Detection of African Swine Fever Virus DNA Based on Isothermal Recombinase Polymerase Amplification Assay" Viruses 13, no. 9: 1731. https://doi.org/10.3390/v13091731
APA StyleCeruti, A., Kobialka, R. M., Ssekitoleko, J., Okuni, J. B., Blome, S., Abd El Wahed, A., & Truyen, U. (2021). Rapid Extraction and Detection of African Swine Fever Virus DNA Based on Isothermal Recombinase Polymerase Amplification Assay. Viruses, 13(9), 1731. https://doi.org/10.3390/v13091731