2′, 5′-Oligoadenylate Synthetase 2 (OAS2) Inhibits Zika Virus Replication through Activation of Type Ι IFN Signaling Pathway
Abstract
1. Introduction
2. Materials and Methods
2.1. Cell Culture and Zika Virus
2.2. RNA-Seq and Data Analysis
2.3. Zika Virus Infection
2.4. OAS2 Plasmid Preparation and Transfection
2.5. RNA Interference
2.6. RNA Isolation, Reverse Transcription and RT-qPCR
2.7. Dual Luciferase Reporter Assay
2.8. Protein Sample Preparation and Western Blot
2.9. Statistical Analysis
3. Results
3.1. ZIKV Infection Regulated Host Innate Antiviral Gene Expression
3.2. ZIKV Infection Induced OAS2 Expression through a RIG-I-Dependent Pathway
3.3. OAS2 Affected ZIKV Replication
3.4. OAS2 Stimulated the Production of IFNβ
3.5. OAS2 Inhibited ZIKV Replication through the IFN-Induced Activation of the Jak/STAT Signaling Pathway
4. Discussion
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Vorou, R. Zika virus, vectors, reservoirs, amplifying hosts, and their potential to spread worldwide: What we know and what we should investigate urgently. Int. J. Infect. Dis. 2016, 48, 85–90. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Haddow, A.J.; Williams, M.C.; Woodall, J.P.; Simpson, D.I.; Goma, L.K. Twelve Isolations of Zika Virus from Aedes (Stegomyia) Africanus (Theobald) Taken in and above a Uganda Forest. Bull. World Health Organ. 1964, 31, 57–69. [Google Scholar]
- Chambers, T.J.; Hahn, C.S.; Galler, R.; Rice, C.M. Flavivirus genome organization, expression, and replication. Annu. Rev. Microbiol. 1990, 44, 649–688. [Google Scholar] [CrossRef] [PubMed]
- Dick, G.W.; Kitchen, S.F.; Haddow, A.J. Zika virus. I. Isolations and serological specificity. Trans. R. Soc. Trop. Med. Hyg. 1952, 46, 509–520. [Google Scholar] [CrossRef] [Scilit]
- Song, B.H.; Yun, S.I.; Woolley, M.; Lee, Y.M. Zika virus: History, epidemiology, transmission, and clinical presentation. J. Neuroimmunol. 2017, 308, 50–64. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Miner, J.J.; Cao, B.; Govero, J.; Smith, A.M.; Fernandez, E.; Cabrera, O.H.; Garber, C.; Noll, M.; Klein, R.S.; Noguchi, K.K.; et al. Zika Virus Infection during Pregnancy in Mice Causes Placental Damage and Fetal Demise. Cell 2016, 165, 1081–1091. [Google Scholar] [CrossRef] [Scilit]
- Govero, J.; Esakky, P.; Scheaffer, S.M.; Fernandez, E.; Drury, A.; Platt, D.J.; Gorman, M.J.; Richner, J.M.; Caine, E.A.; Salazar, V.; et al. Zika virus infection damages the testes in mice. Nature 2016, 540, 438–442. [Google Scholar] [CrossRef] [Scilit]
- Motta, I.J.; Spencer, B.R.; Cordeiro da Silva, S.G.; Arruda, M.B.; Dobbin, J.A.; Gonzaga, Y.B.; Arcuri, I.P.; Tavares, R.C.; Atta, E.H.; Fernandes, R.F.; et al. Evidence for Transmission of Zika Virus by Platelet Transfusion. N. Engl. J. Med. 2016, 375, 1101–1103. [Google Scholar] [CrossRef] [Scilit]
- Cao-Lormeau, V.-M.; Blake, A.; Mons, S.; Lastère, S.; Roche, C.; Vanhomwegen, J.; Dub, T.; Baudouin, L.; Teissier, A.; Larre, P.; et al. Guillain-Barré Syndrome outbreak associated with Zika virus infection in French Polynesia: A case-control study. Lancet 2016, 387, 1531–1539. [Google Scholar] [CrossRef] [Scilit]
- Yoneyama, M.; Kikuchi, M.; Natsukawa, T.; Shinobu, N.; Imaizumi, T.; Miyagishi, M.; Taira, K.; Akira, S.; Fujita, T. The RNA helicase RIG-I has an essential function in double-stranded RNA-induced innate antiviral responses. Nat. Immunol. 2004, 5, 730–737. [Google Scholar] [CrossRef] [Scilit]
- Loo, Y.M.; Gale, M., Jr. Immune signaling by RIG-I-like receptors. Immunity 2011, 34, 680–692. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sadler, A.J.; Williams, B.R. Interferon-inducible antiviral effectors. Nat. Rev. Immunol. 2008, 8, 559–568. [Google Scholar] [CrossRef] [Scilit]
- Feng, X.; Petraglia, A.L.; Chen, M.; Byskosh, P.V.; Boos, M.D.; Reder, A.T. Low expression of interferon-stimulated genes in active multiple sclerosis is linked to subnormal phosphorylation of STAT1. J. Neuroimmunol. 2002, 129, 205–215. [Google Scholar] [CrossRef] [Scilit]
- Kristiansen, H.; Scherer, C.A.; McVean, M.; Iadonato, S.P.; Vends, S.; Thavachelvam, K.; Steffensen, T.B.; Horan, K.A.; Kuri, T.; Weber, F.; et al. Extracellular 2′-5′ oligoadenylate synthetase stimulates RNase L-independent antiviral activity: A novel mechanism of virus-induced innate immunity. J. Virol. 2010, 84, 11898–11904. [Google Scholar] [CrossRef] [Scilit]
- Kwon, Y.C.; Kang, J.I.; Hwang, S.B.; Ahn, B.Y. The ribonuclease L-dependent antiviral roles of human 2′,5′-oligoadenylate synthetase family members against hepatitis C virus. FEBS Lett. 2013, 587, 156–164. [Google Scholar] [CrossRef] [Scilit]
- Lin, R.J.; Yu, H.P.; Chang, B.L.; Tang, W.C.; Liao, C.L.; Lin, Y.L. Distinct antiviral roles for human 2′,5′-oligoadenylate synthetase family members against dengue virus infection. J. Immunol. 2009, 183, 8035–8043. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mashimo, T.; Lucas, M.; Simon-Chazottes, D.; Frenkiel, M.P.; Montagutelli, X.; Ceccaldi, P.E.; Deubel, V.; Guenet, J.L.; Despres, P. A nonsense mutation in the gene encoding 2′-5′-oligoadenylate synthetase/L1 isoform is associated with West Nile virus susceptibility in laboratory mice. Proc. Natl. Acad. Sci. USA 2002, 99, 11311–11316. [Google Scholar] [CrossRef] [Scilit]
- Mihm, U.; Ackermann, O.; Welsch, C.; Herrmann, E.; Hofmann, W.P.; Grigorian, N.; Welker, M.W.; Lengauer, T.; Zeuzem, S.; Sarrazin, C. Clinical relevance of the 2′-5′-oligoadenylate synthetase/RNase L system for treatment response in chronic hepatitis C. J. Hepatol. 2009, 50, 49–58. [Google Scholar] [CrossRef] [Scilit]
- Shindo, M.; Hamada, K.; Morikawa, T.; Harano, Y.; Nakajima, T.; Okuno, T. In vivo interferon system assessed by 2′-5′ oligoadenylate synthetase activity in chronic hepatitis C virus patients treated with pegylated interferon and ribavirin. Hepatol. Res. 2008, 38, 1213–1220. [Google Scholar] [CrossRef] [Scilit]
- Kim, K.I.; Kim, S.R.; Sasase, N.; Taniguchi, M.; Harada, S.; Kinoshita, K.; Kim, S.H.; Akimoto, Y.; Shikata, M.; Kimura, N.; et al. 2′-,5′-Oligoadenylate synthetase response ratio predicting virological response to PEG-interferon-alpha2b plus ribavirin therapy in patients with chronic hepatitis C. J. Clin. Pharm. Ther. 2006, 31, 441–446. [Google Scholar] [CrossRef] [Scilit]
- Zhao, M.; Wan, B.; Li, H.; He, J.; Chen, X.; Wang, L.; Wang, Y.; Xie, S.; Qiao, S.; Zhang, G. Porcine 2′, 5′-oligoadenylate synthetase 2 inhibits porcine reproductive and respiratory syndrome virus replication in vitro. Microb. Pathog. 2017, 111, 14–21. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zheng, S.; Zhu, D.; Lian, X.; Liu, W.; Cao, R.; Chen, P. Porcine 2′,5′-oligoadenylate synthetases inhibit Japanese encephalitis virus replication in vitro. J. Med. Virol. 2016, 88, 760–768. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Weger-Lucarelli, J.; Ruckert, C.; Chotiwan, N.; Nguyen, C.; Garcia Luna, S.M.; Fauver, J.R.; Foy, B.D.; Perera, R.; Black, W.C.; Kading, R.C.; et al. Vector Competence of American Mosquitoes for Three Strains of Zika Virus. PLoS Negl. Trop. Dis. 2016, 10, e0005101. [Google Scholar] [CrossRef] [Scilit]
- Yoneyama, M.; Kikuchi, M.; Matsumoto, K.; Imaizumi, T.; Miyagishi, M.; Taira, K.; Foy, E.; Loo, Y.M.; Gale, M.; Akira, S.; et al. Shared and Unique Functions of the DExD/H-Box Helicases RIG-I, MDA5, and LGP2 in Antiviral Innate Immunity. J. Immunol. 2005, 175, 2851–2858. [Google Scholar] [CrossRef] [Scilit]
- Xu, L.; Wang, W.; Li, Y.; Zhou, X.; Yin, Y.; Wang, Y.; de Man, R.A.; van der Laan, L.J.W.; Huang, F.; Kamar, N.; et al. RIG-I is a key antiviral interferon-stimulated gene against hepatitis E virus regardless of interferon production. Hepatology 2017, 65, 1823–1839. [Google Scholar] [CrossRef] [Scilit]
- Kato, H.; Oh, S.-W.; Fujita, T. RIG-I-Like Receptors and Type I Interferonopathies. J. Interferon Cytokine Res. 2017, 37, 207–213. [Google Scholar] [CrossRef] [Scilit]
- De Veer, M.J.; Holko, M.; Frevel, M.; Walker, E.; Der, S.; Paranjape, J.M.; Silverman, R.H.; Williams, B.R. Functional classification of interferon-stimulated genes identified using microarrays. J. Leukoc Biol. 2001, 69, 912–920. [Google Scholar]
- Francois-Newton, V.; Magno de Freitas Almeida, G.; Payelle-Brogard, B.; Monneron, D.; Pichard-Garcia, L.; Piehler, J.; Pellegrini, S.; Uze, G. USP18-based negative feedback control is induced by type I and type III interferons and specifically inactivates interferon alpha response. PLoS ONE 2011, 6, e22200. [Google Scholar] [CrossRef] [Scilit]
- Hong, X.X.; Carmichael, G.G. Innate immunity in pluripotent human cells: Attenuated response to interferon-beta. J. Biol. Chem. 2013, 288, 16196–16205. [Google Scholar] [CrossRef] [Scilit]
- Lazear, H.M.; Govero, J.; Smith, A.M.; Platt, D.J.; Fernandez, E.; Miner, J.J.; Diamond, M.S. A Mouse Model of Zika Virus Pathogenesis. Cell Host Microbe 2016, 19, 720–730. [Google Scholar] [CrossRef] [Scilit]
- Bayer, A.; Lennemann, N.J.; Ouyang, Y.; Bramley, J.C.; Morosky, S.; Marques, E.T., Jr.; Cherry, S.; Sadovsky, Y.; Coyne, C.B. Type III Interferons Produced by Human Placental Trophoblasts Confer Protection against Zika Virus Infection. Cell Host Microbe 2016, 19, 705–712. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Savidis, G.; Perreira, J.M.; Portmann, J.M.; Meraner, P.; Guo, Z.; Green, S.; Brass, A.L. The IFITMs Inhibit Zika Virus Replication. Cell Rep. 2016, 15, 2323–2330. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Robinson, C.L.; Chong, A.C.N.; Ashbrook, A.W.; Jeng, G.; Jin, J.; Chen, H.; Tang, E.I.; Martin, L.A.; Kim, R.S.; Kenyon, R.M.; et al. Male germ cells support long-term propagation of Zika virus. Nat. Commun. 2018, 9, 2090. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hamel, R.; Dejarnac, O.; Wichit, S.; Ekchariyawat, P.; Neyret, A.; Luplertlop, N.; Perera-Lecoin, M.; Surasombatpattana, P.; Talignani, L.; Thomas, F.; et al. Biology of Zika Virus Infection in Human Skin Cells. J. Virol. 2015, 89, 8880–8896. [Google Scholar] [CrossRef] [Scilit]
- Domingo-Gil, E.; Esteban, M. Role of mitochondria in apoptosis induced by the 2-5A system and mechanisms involved. Apoptosis 2006, 11, 725–738. [Google Scholar] [CrossRef] [Scilit]
- Drappier, M.; Michiels, T. Inhibition of the OAS/RNase L pathway by viruses. Curr. Opin. Virol. 2015, 15, 19–26. [Google Scholar] [CrossRef] [Scilit]
- Li, Y.; Banerjee, S.; Wang, Y.; Goldstein, S.A.; Dong, B.; Gaughan, C.; Silverman, R.H.; Weiss, S.R. Activation of RNase L is dependent on OAS3 expression during infection with diverse human viruses. Proc. Natl. Acad. Sci. USA 2016, 113, 2241–2246. [Google Scholar] [CrossRef] [Scilit]
- Elbahesh, H.; Jha, B.K.; Silverman, R.H.; Scherbik, S.V.; Brinton, M.A. The Flvr-encoded murine oligoadenylate synthetase 1b (Oas1b) suppresses 2-5A synthesis in intact cells. Virology 2011, 409, 262–270. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Whelan, J.N.; Li, Y.; Silverman, R.H.; Weiss, S.R. Zika Virus Production Is Resistant to RNase L Antiviral Activity. J. Virol. 2019, 93. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hertzog, J.; Dias Junior, A.G.; Rigby, R.E.; Donald, C.L.; Mayer, A.; Sezgin, E.; Song, C.; Jin, B.; Hublitz, P.; Eggeling, C.; et al. Infection with a Brazilian isolate of Zika virus generates RIG-I stimulatory RNA and the viral NS5 protein blocks type I IFN induction and signaling. Eur. J. Immunol. 2018, 48, 1120–1136. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kumar, A.; Hou, S.; Airo, A.M.; Limonta, D.; Mancinelli, V.; Branton, W.; Power, C.; Hobman, T.C. Zika virus inhibits type-I interferon production and downstream signaling. EMBO Rep. 2016, 17, 1766–1775. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wu, Y.; Liu, Q.; Zhou, J.; Xie, W.; Chen, C.; Wang, Z.; Yang, H.; Cui, J. Zika virus evades interferon-mediated antiviral response through the co-operation of multiple nonstructural proteins in vitro. Cell Discov. 2017, 3, 17006. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ding, Q.; Gaska, J.M.; Douam, F.; Wei, L.; Kim, D.; Balev, M.; Heller, B.; Ploss, A. Species-specific disruption of STING-dependent antiviral cellular defenses by the Zika virus NS2B3 protease. Proc. Natl. Acad. Sci. USA 2018, 115, E6310–E6318. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Grant, A.; Ponia, S.S.; Tripathi, S.; Balasubramaniam, V.; Miorin, L.; Sourisseau, M.; Schwarz, M.C.; Sanchez-Seco, M.P.; Evans, M.J.; Best, S.M.; et al. Zika Virus Targets Human STAT2 to Inhibit Type I Interferon Signaling. Cell Host Microbe 2016, 19, 882–890. [Google Scholar] [CrossRef] [Scilit]
- Xia, H.; Luo, H.; Shan, C.; Muruato, A.E.; Nunes, B.T.D.; Medeiros, D.B.A.; Zou, J.; Xie, X.; Giraldo, M.I.; Vasconcelos, P.F.C.; et al. An evolutionary NS1 mutation enhances Zika virus evasion of host interferon induction. Nat. Commun. 2018, 9, 414. [Google Scholar] [CrossRef] [Scilit]
- Shi, X.; Jiao, B.; Chen, Y.; Li, S.; Chen, L. MxA is a positive regulator of type I IFN signaling in HCV infection. J. Med. Virol. 2017, 89, 2173–2180. [Google Scholar] [CrossRef] [Scilit]
- Chen, Y.; Jiao, B.; Yao, M.; Shi, X.; Zheng, Z.; Li, S.; Chen, L. ISG12a inhibits HCV replication and potentiates the anti-HCV activity of IFN-alpha through activation of the Jak/STAT signaling pathway independent of autophagy and apoptosis. Virus Res. 2017, 227, 231–239. [Google Scholar] [CrossRef] [Scilit]







| Gene Name | Forward Primer (5′ to 3′) | Reverse Primer (5′ to 3′) |
|---|---|---|
| GAPDH | GCCTCCTGCACCACCAACTG | ACGCCTGCTTCACCACCTTC |
| IFNβ | AAACTC ATAGCAGTCTGCA | AGGAGATCTTCAGTTTCGGAGG |
| OAS1 | TGTCCAAGGTGGTAAAGGGTG | CCGGCGATTTAACTGATCCTG |
| OAS2 | ACCCGAACAGTTCCCCCTGGT | ACAAGGGTACCATCGGAGTTGCC |
| OAS3 | GAATTCTCCCATCAAAGTGATCAA | CTCAGATGCCGACCTCGTGGT |
| IL-8 | TTTTGCCAAGGAGTGCTAAAGA | AACCCTCTGCACCCAGTTTTC |
| TNFα | CCTCTCTCTAATCAGCCCTCTG | GAGGACCTGGGAGTAGATGAG |
| RIG-I | AGTGAGCATGCACGAATGAA | GGGATCCCTGGAAACACTTT |
| GZ01 NS5 | CCTTGGATTCTTGAACGAGGA | AGAGCTTCATTCTCCAGATCAA |
| MxA | GTGCATTGCAGAAGGTCAGA | CTGGTGATAGGCCATCAGGT |
| IFIT2 | CTTGACTGTGAGGAAGGG | CAATGGCGTTCTGAGATG |
| IRF7 | CCCCACGCTATACCATCTACCT | ACAGCCAGGGTTCCAGCTT |
| CMPK2 | GTACCTCCTTTATTCCTGAAGCC | ATGGCAACAACCTGGAACTTT |
| IFIT3 | AAAAGCCCAACAACCCAGAAT | CGTATTGGTTATCAGGACTCAGC |
| IFITM1 | CCAAGGTCCACCGTGATTAAC | ACCAGTTCAAGAAGAGGGTGTT |
| Clorf27 | GGAGGAAGTCTCAGAACGAGT | AGCCATGAGGATGATAATCCACT |
| DLG1 | GCAGGAGGTACGGACAACC | ATTGACCCGCAATCTTCCATC |
| EHBP1 | TGGTTGAGTGTACGAAGAAATGG | ACAACACCACGATAGGGATTTTT |
| RNase L | AAGAAGCACTTGGGTTTGGTGCAG | TCCGCCTCGCTGTCATAACAAGAT |
| ISG15 | CGCAGATCACCCAGAAGATT | GCCCTTGTTATTCCTCACCA |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Liao, X.; Xie, H.; Li, S.; Ye, H.; Li, S.; Ren, K.; Li, Y.; Xu, M.; Lin, W.; Duan, X.; et al. 2′, 5′-Oligoadenylate Synthetase 2 (OAS2) Inhibits Zika Virus Replication through Activation of Type Ι IFN Signaling Pathway. Viruses 2020, 12, 418. https://doi.org/10.3390/v12040418
Liao X, Xie H, Li S, Ye H, Li S, Ren K, Li Y, Xu M, Lin W, Duan X, et al. 2′, 5′-Oligoadenylate Synthetase 2 (OAS2) Inhibits Zika Virus Replication through Activation of Type Ι IFN Signaling Pathway. Viruses. 2020; 12(4):418. https://doi.org/10.3390/v12040418
Chicago/Turabian StyleLiao, Xinzhong, He Xie, Shilin Li, Haiyan Ye, Shuang Li, Kai Ren, Yujia Li, Min Xu, Wenyu Lin, Xiaoqiong Duan, and et al. 2020. "2′, 5′-Oligoadenylate Synthetase 2 (OAS2) Inhibits Zika Virus Replication through Activation of Type Ι IFN Signaling Pathway" Viruses 12, no. 4: 418. https://doi.org/10.3390/v12040418
APA StyleLiao, X., Xie, H., Li, S., Ye, H., Li, S., Ren, K., Li, Y., Xu, M., Lin, W., Duan, X., Yang, C., & Chen, L. (2020). 2′, 5′-Oligoadenylate Synthetase 2 (OAS2) Inhibits Zika Virus Replication through Activation of Type Ι IFN Signaling Pathway. Viruses, 12(4), 418. https://doi.org/10.3390/v12040418

