Construction of eGFP-Tagged Senecavirus A for Facilitating Virus Neutralization Test and Antiviral Assay
Abstract
1. Introduction
2. Materials and Methods
2.1. Cell Line, Plasmid and Virus
2.2. Construction of Plasmid
2.3. Rescue of rSVA-eGFP
2.4. Identification of rSVA-eGFP
2.4.1. RT-PCR Analysis
2.4.2. Indirect Immunofluorescence Assay (IFA) and Ultrathin Section
2.5. Characterization of rSVA-eGFP
2.5.1. Timeline of Fluorescence Appearance
2.5.2. Plaque Assay
2.5.3. Growth Curve
2.5.4. eGFP Stability during Passaging
2.6. rSVA-eGFP-Based VNT
2.6.1. Production of Anti-SVA Polyclonal Antibodies (PAb)
2.6.2. VNT of Porcine Sera
2.7. rSVA-eGFP-Based Antiviral Assay
2.7.1. Ribavirin
2.7.2. Apigenin
2.8. Statistics
3. Results
3.1. Construction and Characterization of rSVA-eGFP cDNA Clone
3.2. Rescue and Passaging of rSVA-eGFP
3.3. Identification of rSVA-eGFP
3.3.1. RT-PCR
3.3.2. IFA
3.3.3. Ultrathin Section
3.4. Characterization of rSVA-eGFP
3.4.1. Timeline of Fluorescence Appearance
3.4.2. Plaque Assay
3.4.3. Growth Curve
3.4.4. eGFP Stability during Passaging
3.5. rSVA-eGFP-Based VNT
3.6. Antiviral Assay
3.6.1. Ribavirin
3.6.2. Apigenin
4. Discussion
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Wu, Q.; Zhao, X.; Chen, Y.; He, X.; Zhang, G.; Ma, J. Complete Genome Sequence of Seneca Valley Virus CH-01-2015 Identified in China. Genome Announc. 2016, 4, e01509-15. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wu, Q.; Zhao, X.; Bai, Y.; Sun, B.; Xie, Q.; Ma, J. The First Identification and Complete Genome of Senecavirus A Affecting Pig with Idiopathic Vesicular Disease in China. Transbound. Emerg. Dis. 2017, 64, 1633–1640. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Leme, R.A.; Alfieri, A.F.; Alfieri, A.A. Update on Senecavirus Infection in Pigs. Viruses 2017, 9, 170. [Google Scholar] [CrossRef] [Scilit]
- Montiel, N.; Buckley, A.; Guo, B.; Kulshreshtha, V.; VanGeelen, A.; Hoang, H.; Rademacher, C.; Yoon, K.J.; Lager, K. Vesicular Disease in 9-Week-Old Pigs Experimentally Infected with Senecavirus A. Emerg. Infect. Dis. 2016, 22, 1246–1248. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Buckley, A.; Kulshreshtha, V.; van Geelen, A.; Montiel, N.; Guo, B.; Yoon, K.J.; Lager, K. Experimental Seneca Valley virus infection in market-weight gilts. Vet. Microbiol. 2019, 231, 7–10. [Google Scholar] [CrossRef] [Scilit]
- Pasma, T.; Davidson, S.; Shaw, S.L. Idiopathic vesicular disease in swine in Manitoba. Can. Vet. J. 2008, 49, 84–85. [Google Scholar]
- Singh, K.; Corner, S.; Clark, S.; Scherba, G.; Fredrickson, R. Seneca Valley Virus and Vesicular Lesions in a Pig with Idiopathic Vesicular Disease. J. Vet. Sci. Technol. 2012, 3, 1–3. [Google Scholar]
- Leme, R.A.; Zotti, E.; Alcantara, B.K.; Oliveira, M.V.; Freitas, L.A.; Alfieri, A.F.; Alfieri, A.A. Senecavirus A: An Emerging Vesicular Infection in Brazilian Pig Herds. Transbound. Emerg. Dis. 2015, 62, 603–611. [Google Scholar] [CrossRef] [Scilit]
- Saeng-Chuto, K.; Rodtian, P.; Temeeyasen, G.; Wegner, M.; Nilubol, D. The first detection of Senecavirus A in pigs in Thailand, 2016. Transbound. Emerg. Dis. 2018, 65, 285–288. [Google Scholar] [CrossRef] [Scilit]
- Arzt, J.; Bertram, M.R.; Vu, L.T.; Pauszek, S.J.; Hartwig, E.J.; Smoliga, G.R.; Palinski, R.; Stenfeldt, C.; Fish, I.H.; Hoang, B.H.; et al. First Detection and Genome Sequence of Senecavirus A in Vietnam. Microbiol. Resour. Announc. 2019, 8, e01247-18. [Google Scholar] [CrossRef] [Scilit]
- Sun, D.; Vannucci, F.; Knutson, T.P.; Corzo, C.; Marthaler, D.G. Emergence and whole-genome sequence of Senecavirus A in Colombia. Transbound. Emerg. Dis. 2017, 64, 1346–1349. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sun, Y.; Cheng, J.; Wu, R.T.; Wu, Z.X.; Chen, J.W.; Luo, Y.; Xie, Q.M.; Ma, J.Y. Phylogenetic and Genome Analysis of 17 Novel Senecavirus A Isolates in Guangdong Province, 2017. Front. Vet. Sci. 2018, 5, 314. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhu, Z.; Yang, F.; Chen, P.; Liu, H.; Cao, W.; Zhang, K.; Liu, X.; Zheng, H. Emergence of novel Seneca Valley virus strains in China, 2017. Transbound. Emerg. Dis. 2017, 64, 1024–1029. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Qian, S.; Fan, W.; Qian, P.; Chen, H.; Li, X. Isolation and full-genome sequencing of Seneca Valley virus in piglets from China, 2016. Virol. J. 2016, 13, 173. [Google Scholar] [CrossRef] [Scilit]
- Wang, H.; Li, C.; Zhao, B.; Yuan, T.; Yang, D.; Zhou, G.; Yu, L. Complete genome sequence and phylogenetic analysis of Senecavirus A isolated in Northeast China in 2016. Arch. Virol. 2017, 162, 3173–3176. [Google Scholar] [CrossRef] [Scilit]
- Zhang, X.; Zhu, Z.; Yang, F.; Cao, W.; Tian, H.; Zhang, K.; Zheng, H.; Liu, X. Review of Seneca Valley Virus: A Call for Increased Surveillance and Research. Front. Microbiol. 2018, 9, 940. [Google Scholar] [CrossRef] [Scilit]
- Hales, L.M.; Knowles, N.J.; Reddy, P.S.; Xu, L.; Hay, C.; Hallenbeck, P.L. Complete genome sequence analysis of Seneca Valley virus-001, a novel oncolytic picornavirus. J. Gen. Virol. 2008, 89, 1265–1275. [Google Scholar] [CrossRef] [Scilit]
- Chen, Z.; Yuan, F.; Li, Y.; Shang, P.; Schroeder, R.; Lechtenberg, K.; Henningson, J.; Hause, B.; Bai, J.; Rowland, R.R.R.; et al. Construction and characterization of a full-length cDNA infectious clone of emerging porcine Senecavirus A. Virology 2016, 497, 111–124. [Google Scholar] [CrossRef] [Scilit]
- Poirier, J.T.; Reddy, P.S.; Idamakanti, N.; Li, S.S.; Stump, K.L.; Burroughs, K.D.; Hallenbeck, P.L.; Rudin, C.M. Characterization of a full-length infectious cDNA clone and a GFP reporter derivative of the oncolytic picornavirus SVV-001. J. Gen. Virol. 2012, 93, 2606–2613. [Google Scholar] [CrossRef] [Scilit]
- Li, C.; Wang, H.; Shi, J.; Yang, D.; Zhou, G.; Chang, J.; Cameron, C.E.; Woodman, A.; Yu, L. Senecavirus-Specific Recombination Assays Reveal the Intimate Link between Polymerase Fidelity and RNA Recombination. J. Virol. 2019, 93, e00576-19. [Google Scholar] [CrossRef] [Scilit]
- Zhao, X.; Wu, Q.; Bai, Y.; Chen, G.; Zhou, L.; Wu, Z.; Li, Y.; Zhou, W.; Yang, H.; Ma, J. Phylogenetic and genome analysis of seven senecavirus A isolates in China. Transbound. Emerg. Dis. 2017, 64, 2075–2082. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Buchholz, U.J.; Finke, S.; Conzelmann, K.K. Generation of bovine respiratory syncytial virus (BRSV) from cDNA: BRSV NS2 is not essential for virus replication in tissue culture, and the human RSV leader region acts as a functional BRSV genome promoter. J. Virol. 1999, 73, 251–259. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Martin, C.T.; Muller, D.K.; Coleman, J.E. Processivity in early stages of transcription by T7 RNA polymerase. Biochemistry 1988, 27, 3966–3974. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Finney, D.J. Statistical Method in Biological Assay, 1st ed.; Charles Griffin and Company: London, UK, 1952. [Google Scholar]
- OIE. Manual of Diagnostic Tests and Vaccines for Terrestrial Animals (Chapter 3.7.9.), 8th ed.; World Organization for Animal Health: Paris, France, 2018. [Google Scholar]
- Li, X.; Zhang, H.; Zhang, Y.; Li, J.; Wang, Z.; Deng, C.; Jardim, A.C.G.; Terzian, A.C.B.; Nogueira, M.L.; Zhang, B. Development of a rapid antiviral screening assay based on eGFP reporter virus of Mayaro virus. Antivir. Res. 2019, 168, 82–90. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chao, Y.-C.; Young, S., III; Kim, K.S. Characterization of a picornavirus isolated from Pseudoplusia includens (Lepidoptera: Noctuidae). J. Invertebr. Pathol. 1986, 47, 247–257. [Google Scholar] [CrossRef] [Scilit]
- Sjostrand, F.S.; Polson, A. Macrocrystalline patterns of closely packed poliovirus particles in ultrathin sections. J. Ultrastruct. Res. 1958, 1, 365–374. [Google Scholar] [CrossRef] [Scilit]
- Peterson, J.E.; Studdert, M.J. Feline picornavirus. Structure of the virus and electron microscopic observations on infected cell cultures. Arch. Gesamte Virusforsch. 1970, 32, 249–260. [Google Scholar] [CrossRef] [Scilit]
- Liu, Z.; Chen, O.; Wall, J.B.J.; Zheng, M.; Zhou, Y.; Wang, L.; Ruth Vaseghi, H.; Qian, L.; Liu, J. Systematic comparison of 2A peptides for cloning multi-genes in a polycistronic vector. Sci. Rep. 2017, 7, 2193. [Google Scholar] [CrossRef] [Scilit]
- Flather, D.; Cathcart, A.L.; Cruz, C.; Baggs, E.; Ngo, T.; Gershon, P.D.; Semler, B.L. Generation of Recombinant Polioviruses Harboring RNA Affinity Tags in the 5’ and 3’ Noncoding Regions of Genomic RNAs. Viruses 2016, 8, 39. [Google Scholar] [CrossRef] [Scilit]
- Han, M.; Rajput, C.; Hinde, J.L.; Wu, Q.; Lei, J.; Ishikawa, T.; Bentley, J.K.; Hershenson, M.B. Construction of a recombinant rhinovirus accommodating fluorescent marker expression. Influenza Other Respir. Viruses 2018, 12, 717–727. [Google Scholar] [CrossRef] [Scilit]
- Rieder, E.; Henry, T.; Duque, H.; Baxt, B. Analysis of a foot-and-mouth disease virus type A24 isolate containing an SGD receptor recognition site in vitro and its pathogenesis in cattle. J. Virol. 2005, 79, 12989–12998. [Google Scholar] [CrossRef] [Scilit]
- Rajasekhar, R.; Hosamani, M.; Basagoudanavar, S.H.; Sreenivasa, B.P.; Tamil Selvan, R.P.; Saravanan, P.; Venkataramanan, R. Rescue of infective virus from a genome-length cDNA clone of the FMDV serotype O (IND-R2/75) vaccine strain and its characterization. Res. Vet. Sci. 2013, 95, 291–297. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Shang, B.; Deng, C.; Ye, H.; Xu, W.; Yuan, Z.; Shi, P.Y.; Zhang, B. Development and characterization of a stable eGFP enterovirus 71 for antiviral screening. Antivir. Res. 2013, 97, 198–205. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Strauss, M.; Jayawardena, N.; Sun, E.; Easingwood, R.A.; Burga, L.N.; Bostina, M. Cryo-Electron Microscopy Structure of Seneca Valley Virus Procapsid. J. Virol. 2018, 92, e01927-17. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liu, F.; Wu, X.; Li, L.; Zou, Y.; Liu, S.; Wang, Z. Evolutionary characteristics of morbilliviruses during serial passages in vitro: Gradual attenuation of virus virulence. Comp. Immunol. Microbiol. Infect. Dis 2016, 47, 7–18. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Xiao, Y.; Rouzine, I.M.; Bianco, S.; Acevedo, A.; Goldstein, E.F.; Farkov, M.; Brodsky, L.; Andino, R. RNA Recombination Enhances Adaptability and Is Required for Virus Spread and Virulence. Cell Host Microbe 2016, 19, 493–503. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Goolia, M.; Vannucci, F.; Yang, M.; Patnayak, D.; Babiuk, S.; Nfon, C.K. Validation of a competitive ELISA and a virus neutralization test for the detection and confirmation of antibodies to Senecavirus A in swine sera. J. Vet. Diagn. Investig. 2017, 29, 250–253. [Google Scholar] [CrossRef] [Scilit]
- Lo, M.K.; Nichol, S.T.; Spiropoulou, C.F. Evaluation of luciferase and GFP-expressing Nipah viruses for rapid quantitative antiviral screening. Antivir. Res. 2014, 106, 53–60. [Google Scholar] [CrossRef] [Scilit]
- Fan, Z.C.; Bird, R.C. Development of a reporter bovine viral diarrhea virus and initial evaluation of its application for high throughput antiviral drug screening. J. Virol. Methods 2012, 180, 54–61. [Google Scholar] [CrossRef] [Scilit]
- Marschall, M.; Freitag, M.; Weiler, S.; Sorg, G.; Stamminger, T. Recombinant green fluorescent protein-expressing human cytomegalovirus as a tool for screening antiviral agents. Antimicrob. Agents Chemother. 2000, 44, 1588–1597. [Google Scholar] [CrossRef] [Scilit]
- Kim, J.I.; Park, S.; Lee, I.; Lee, S.; Shin, S.; Won, Y.; Hwang, M.W.; Bae, J.Y.; Heo, J.; Hyun, H.E.; et al. GFP-expressing influenza A virus for evaluation of the efficacy of antiviral agents. J. Microbiol. 2012, 50, 359–362. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cai, Y.; Iwasaki, M.; Beitzel, B.F.; Yu, S.; Postnikova, E.N.; Cubitt, B.; DeWald, L.E.; Radoshitzky, S.R.; Bollinger, L.; Jahrling, P.B.; et al. Recombinant Lassa Virus Expressing Green Fluorescent Protein as a Tool for High-Throughput Drug Screens and Neutralizing Antibody Assays. Viruses 2018, 10, 655. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Shiffman, M.L. What future for ribavirin? Liver Int. 2009, 29 (Suppl. 1), 68–73. [Google Scholar] [CrossRef] [Scilit]
- Ruuskanen, O.; Waris, M.; Kainulainen, L. Treatment of persistent rhinovirus infection with pegylated interferon alpha2a and ribavirin in patients with hypogammaglobulinemia. Clin. Infect. Dis. 2014, 58, 1784–1786. [Google Scholar] [CrossRef] [Scilit]
- Smee, D.F.; Evans, W.J.; Nicolaou, K.C.; Tarbet, E.B.; Day, C.W. Susceptibilities of enterovirus D68, enterovirus 71, and rhinovirus 87 strains to various antiviral compounds. Antivir. Res. 2016, 131, 61–65. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, Z.H.; Li, C.M.; Ling, P.; Shen, F.H.; Chen, S.H.; Liu, C.C.; Yu, C.K. Ribavirin reduces mortality in enterovirus 71-infected mice by decreasing viral replication. J. Infect. Dis. 2008, 197, 854–857. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kang, H.; Kim, C.; Kim, D.E.; Song, J.H.; Choi, M.; Choi, K.; Kang, M.; Lee, K.; Kim, H.S.; Shin, J.S.; et al. Synergistic antiviral activity of gemcitabine and ribavirin against enteroviruses. Antivir. Res. 2015, 124, 1–10. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Choi, J.H.; Jeong, K.; Kim, S.M.; Ko, M.K.; You, S.H.; Lyoo, Y.S.; Kim, B.; Ku, J.M.; Park, J.H. Synergistic effect of ribavirin and vaccine for protection during early infection stage of foot-and-mouth disease. J. Vet. Sci. 2018, 19, 788–797. [Google Scholar] [CrossRef] [Scilit]
- Jeong, K.W.; Lee, J.H.; Park, S.M.; Choi, J.H.; Jeong, D.Y.; Choi, D.H.; Nam, Y.; Park, J.H.; Lee, K.N.; Kim, S.M.; et al. Synthesis and in-vitro evaluation of 2-amino-4-arylthiazole as inhibitor of 3D polymerase against foot-and-mouth disease (FMD). Eur. J. Med. Chem. 2015, 102, 387–397. [Google Scholar] [CrossRef] [Scilit]
- Yao, C.; Xi, C.; Hu, K.; Gao, W.; Cai, X.; Qin, J.; Lv, S.; Du, C.; Wei, Y. Inhibition of enterovirus 71 replication and viral 3C protease by quercetin. Virol. J. 2018, 15, 116. [Google Scholar] [CrossRef] [Scilit]
- Qian, S.; Fan, W.; Qian, P.; Zhang, D.; Wei, Y.; Chen, H.; Li, X. Apigenin restricts FMDV infection and inhibits viral IRES driven translational activity. Viruses 2015, 7, 1613–1626. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, W.; Qiao, H.; Lv, Y.; Wang, J.; Chen, X.; Hou, Y.; Tan, R.; Li, E. Apigenin inhibits enterovirus-71 infection by disrupting viral RNA association with trans-acting factors. PLoS ONE 2014, 9, e110429. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lv, X.; Qiu, M.; Chen, D.; Zheng, N.; Jin, Y.; Wu, Z. Apigenin inhibits enterovirus 71 replication through suppressing viral IRES activity and modulating cellular JNK pathway. Antivir. Res. 2014, 109, 30–41. [Google Scholar] [CrossRef] [Scilit] [PubMed]






| Primers | Sequences (5′ to 3′) | Length of RT-PCR Product (bp) | |
|---|---|---|---|
| rSVA-eGFP | rSVA | ||
| F1 | AGGCACAGAGGAGCAACATCCAA | 693 | 693 |
| R1 | ATCGTTCACCGATCTAGGGTATT | ||
| F2 | AAAAGCACCGCTGTAAAGCATGT | 1004 | 233 |
| R2 | TGTTGAACAGAGTGTACCATCTT | ||
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Liu, F.; Huang, Y.; Wang, Q.; Shan, H. Construction of eGFP-Tagged Senecavirus A for Facilitating Virus Neutralization Test and Antiviral Assay. Viruses 2020, 12, 283. https://doi.org/10.3390/v12030283
Liu F, Huang Y, Wang Q, Shan H. Construction of eGFP-Tagged Senecavirus A for Facilitating Virus Neutralization Test and Antiviral Assay. Viruses. 2020; 12(3):283. https://doi.org/10.3390/v12030283
Chicago/Turabian StyleLiu, Fuxiao, Yilan Huang, Qianqian Wang, and Hu Shan. 2020. "Construction of eGFP-Tagged Senecavirus A for Facilitating Virus Neutralization Test and Antiviral Assay" Viruses 12, no. 3: 283. https://doi.org/10.3390/v12030283
APA StyleLiu, F., Huang, Y., Wang, Q., & Shan, H. (2020). Construction of eGFP-Tagged Senecavirus A for Facilitating Virus Neutralization Test and Antiviral Assay. Viruses, 12(3), 283. https://doi.org/10.3390/v12030283

