Genetic Diversity of the Noncoding Control Region of the Novel Human Polyomaviruses
Abstract
:1. Introduction: Human Polyomaviruses
2. The Polyomavirus Genome: The Noncoding Control Region
3. KI and WU NCCR Variants
4. MCPyV NCCR Variants
5. HPyV 6 and HPyV7 NCCR Variants
6. TSPyV NCCR Variants
7. HPyV 9 NCCR Variants
8. HPyV10 NCCR Variants
9. STLPyV NCCR Variants
10. HPyV12, NJPyV, LIPyV and QPyV Variants
11. Conclusions
Supplementary Materials
Author Contributions
Funding
Conflicts of Interest
Abbreviations
bp | Base-pairs |
HPyV | Human polyomavirus |
IPPyV | Institute Pasteur polyomavirus |
KIPy | Karolinska Institute polyomavirus |
LIPyV | Lyon IARC polyomavirus |
LT | Large T antigen |
MCC | Merkel cell carcinoma |
MCPyV | Merkel cell polyomavirus |
MPyV | Mouse polyomavirus |
NCCR | Non-coding control region |
NJPyV | New Jersey polyomavirus |
PML | Progressive multifocal leukoencephalopathy |
QPyV | Quebec polyomavirus |
sT | Small T antigen |
STLPyV | Saint Louis polyomavirus |
TSPyV | Trichodisplasia spinulosa polyomavirus |
WUPyV | Washington University polyomavirus |
References
- DeCaprio, J.A.; Garcea, R.L. A cornucopia of human polyomaviruses. Nat. Rev. Microbiol. 2013, 11, 264–276. [Google Scholar] [CrossRef] [PubMed]
- Moens, U.; Krumbholz, A.; Ehlers, B.; Zell, R.; Johne, R.; Calvignac-Spencer, S.; Lauber, C. Biology, evolution, and medical importance of polyomaviruses: An update. Infect. Genet. Evol. 2017, 54, 18–38. [Google Scholar] [CrossRef] [PubMed]
- Peretti, A.; FitzGerald, P.C.; Bliskovsky, V.; Pastrana, D.V.; Buck, C.B. Genome Sequence of a Fish-Associated Polyomavirus, Black Sea Bass (Centropristis striata) Polyomavirus 1. Genome Announc. 2015, 3, e01476-14. [Google Scholar] [CrossRef] [PubMed]
- Buck, C.B.; Van Doorslaer, K.; Peretti, A.; Geoghegan, E.M.; Tisza, M.J.; An, P.; Katz, J.P.; Pipas, J.M.; McBride, A.A.; Camus, A.C.; et al. The Ancient Evolutionary History of Polyomaviruses. PLoS Pathog. 2016, 12, e1005574. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gardner, S.D.; Field, A.M.; Coleman, D.V.; Hulme, B. New human papovavirus (B.K.) isolated from urine after renal transplantation. Lancet 1971, 1, 1253–1257. [Google Scholar] [CrossRef]
- Padgett, B.L.; Walker, D.L.; ZuRhein, G.M.; Eckroade, R.J.; Dessel, B.H. Cultivation of papova-like virus from human brain with progressive multifocal leucoencephalopathy. Lancet 1971, 1, 1257–1260. [Google Scholar] [CrossRef]
- Allander, T.; Andreasson, K.; Gupta, S.; Bjerkner, A.; Bogdanovic, G.; Persson, M.A.; Dalianis, T.; Ramqvist, T.; Andersson, B. Identification of a third human polyomavirus. J. Virol. 2007, 81, 4130–4136. [Google Scholar] [CrossRef] [Green Version]
- Gaynor, A.M.; Nissen, M.D.; Whiley, D.M.; Mackay, I.M.; Lambert, S.B.; Wu, G.; Brennan, D.C.; Storch, G.A.; Sloots, T.P.; Wang, D. Identification of a novel polyomavirus from patients with acute respiratory tract infections. PLoS Pathog. 2007, 3, e64. [Google Scholar] [CrossRef]
- Feng, H.; Shuda, M.; Chang, Y.; Moore, P.S. Clonal integration of a polyomavirus in human Merkel cell carcinoma. Science 2008, 319, 1096–1100. [Google Scholar] [CrossRef] [Green Version]
- Schowalter, R.M.; Pastrana, D.V.; Pumphrey, K.A.; Moyer, A.L.; Buck, C.B. Merkel cell polyomavirus and two previously unknown polyomaviruses are chronically shed from human skin. Cell Host Microbe 2010, 7, 509–515. [Google Scholar] [CrossRef] [Green Version]
- van der Meijden, E.; Janssens, R.W.; Lauber, C.; Bouwes Bavinck, J.N.; Gorbalenya, A.E.; Feltkamp, M.C. Discovery of a new human polyomavirus associated with trichodysplasia spinulosa in an immunocompromized patient. PLoS Pathog. 2010, 6, e1001024. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Scuda, N.; Hofmann, J.; Calvignac-Spencer, S.; Ruprecht, K.; Liman, P.; Kühn, J.; Hengel, H.; Ehlers, B. A novel human polyomavirus closely related to the african green monkey-derived lymphotropic polyomavirus. J. Virol. 2011, 85, 4586–4590. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Buck, C.B.; Phan, G.Q.; Raiji, M.T.; Murphy, P.M.; McDermott, D.H.; McBride, A.A. Complete genome sequence of a tenth human polyomavirus. J. Virol. 2012, 86, 10887. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lim, E.S.; Reyes, A.; Antonio, M.; Saha, D.; Ikumapayi, U.N.; Adeyemi, M.; Stine, O.C.; Skelton, R.; Brennan, D.C.; Mkakosya, R.S.; et al. Discovery of STL polyomavirus, a polyomavirus of ancestral recombinant origin that encodes a unique T antigen by alternative splicing. Virology 2013, 436, 295–303. [Google Scholar] [CrossRef] [Green Version]
- Korup, S.; Rietscher, J.; Calvignac-Spencer, S.; Trusch, F.; Hofmann, J.; Moens, U.; Sauer, I.; Voigt, S.; Schmuck, R.; Ehlers, B. Identification of a novel human polyomavirus in organs of the gastrointestinal tract. PLoS ONE 2013, 8, e58021. [Google Scholar] [CrossRef] [Green Version]
- Mishra, N.; Pereira, M.; Rhodes, R.H.; An, P.; Pipas, J.M.; Jain, K.; Kapoor, A.; Briese, T.; Faust, P.L.; Lipkin, W.I. Identification of a novel polyomavirus in a pancreatic transplant recipient with retinal blindness and vasculitic myopathy. J. Infect. Dis. 2014, 210, 1595–1599. [Google Scholar] [CrossRef] [Green Version]
- Gheit, T.; Dutta, S.; Oliver, J.; Robitaille, A.; Hampras, S.; Combes, J.D.; McKay-Chopin, S.; Le Calvez-Kelm, F.; Fenske, N.; Cherpelis, B.; et al. Isolation and characterization of a novel putative human polyomavirus. Virology 2017, 506, 45–54. [Google Scholar] [CrossRef]
- Ondov, B.D.; Starrett, G.J.; Sappington, A.; Kostic, A.; Koren, S.; Buck, C.B.; Phillippy, A.M. Mash Screen: High-throughput sequence containment estimation for genome discovery. Genome Biol. 2019, 20, 232. [Google Scholar] [CrossRef] [Green Version]
- Calvignac-Spencer, S.; Feltkamp, M.C.; Daugherty, M.D.; Moens, U.; Ramqvist, T.; Johne, R.; Ehlers, B. A taxonomy update for the family Polyomaviridae. Arch. Virol. 2016, 161, 1739–1750. [Google Scholar] [CrossRef] [Green Version]
- Moens, U.; Calvignac-Spencer, S.; Lauber, C.; Ramqvist, T.; Feltkamp, M.C.W.; Daugherty, M.D.; Verschoor, E.J.; Ehlers, B. ICTV Report Consortium. ICTV Virus Taxonomy Profile: Polyomaviridae. J. Gen. Virol. 2017, 98, 1159–1160. [Google Scholar] [CrossRef]
- Kamminga, S.; van der Meijden, E.; Feltkamp, M.C.W.; Zaaijer, H.L. Seroprevalence of fourteen human polyomaviruses determined in blood donors. PLoS ONE 2018, 13, e0206273. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kourieh, A.; Combes, J.D.; Tommasino, M.; Dalstein, V.; Clifford, G.M.; Lacau St Guily, J.; Clavel, C.; Franceschi, S.; Gheit, T. For The Split Study, G. Prevalence and risk factors of human polyomavirus infections in non-malignant tonsils and gargles: The SPLIT study. J. Gen. Virol. 2018, 99, 1686–1698. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.; Keinonen, A.; Koskenmies, S.; Pitkänen, S.; Fyhrquist, N.; Sadeghi, M.; Mäkisalo, H.; Söderlund-Venermo, M.; Hedman, K. Occurrence of newly discovered human polyomaviruses in skin of liver transplant recipients and their relation with squamous cell carcinoma in situ and actinic keratosis—a single-center cohort study. Transpl. Int. 2019, 32, 516–522. [Google Scholar] [CrossRef] [PubMed]
- Fahsbender, E.; Altan, E.; Estrada, M.; Seguin, M.A.; Young, P.; Leutenegger, C.M.; Delwart, E. Lyon-IARC Polyomavirus DNA in Feces of Diarrheic Cats. Microbiol. Resour. Announc. 2019, 8. [Google Scholar] [CrossRef] [Green Version]
- Gaboriaud, P.; Ferté, M.; Arnold, F.; Leblond, V.; Nicol, J.; Debare, H.; Le Meur, M.; Martini, F.; Tognon, M.; Touzé, A. Age-specific seroprevalence of human polyomavirus 12 and Saint Louis and New Jersey polyomaviruses. Emerg. Microbes Infect. 2018, 7, 22. [Google Scholar] [CrossRef] [PubMed]
- Bialasiewicz, S.; Rockett, R.J.; Barraclough, K.A.; Leary, D.; Dudley, K.J.; Isbel, N.M.; Sloots, T.P. Detection of Recently Discovered Human Polyomaviruses in a Longitudinal Kidney Transplant Cohort. Am. J. Transpl. 2016, 16, 2734–2740. [Google Scholar] [CrossRef] [Green Version]
- Li, K.; Zhang, C.; Zhao, R.; Xue, Y.; Yang, J.; Peng, J.; Jin, Q. The prevalence of STL polyomavirus in stool samples from Chinese children. J. Clin. 2015, 66, 19–23. [Google Scholar] [CrossRef]
- Herberhold, S.; Hellmich, M.; Panning, M.; Bartok, E.; Silling, S.; Akgül, B.; Wieland, U. Human polyomavirus and human papillomavirus prevalence and viral load in non-malignant tonsillar tissue and tonsillar carcinoma. Med. Microbiol. Immunol. 2017, 206, 93–103. [Google Scholar] [CrossRef]
- Bergallo, M.; Daprà, V.; Fava, P.; Ponti, R.; Calvi, C.; Montanari, P.; Novelli, M.; Quaglino, P.; Galliano, I.; Fierro, M.T. DNA from Human Polyomaviruses, MWPyV, HPyV6, HPyV7, HPyV9 and HPyV12 in Cutaneous T-cell Lymphomas. Anticancer Res. 2018, 38, 4111–4114. [Google Scholar] [CrossRef]
- Daprà, V.; Galliano, I.; Rassu, M.; Calvi, C.; Montanari, P.; Merlino, C.; Bergallo, M. Lack of detection of HPyV12 DNA using real-time PCR in Italian infants with diarrhea. Minerva Pediatr. 2020. [Google Scholar] [CrossRef]
- Kamminga, S.; van der Meijden, E.; Wunderink, H.F.; Touzé, A.; Zaaijer, H.L.; Feltkamp, M.C.W. Development and Evaluation of a Broad Bead-Based Multiplex Immunoassay To Measure IgG Seroreactivity against Human Polyomaviruses. J. Clin. Microbiol. 2018, 56, e01566-17. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gedvilaite, A.; Tryland, M.; Ulrich, R.G.; Schneider, J.; Kurmauskaite, V.; Moens, U.; Preugschas, H.; Calvignac-Spencer, S.; Ehlers, B. Novel polyomaviruses in shrews (Soricidae) with close similarity to human polyomavirus 12. J. Gen. Virol. 2017, 98, 3060–3067. [Google Scholar] [CrossRef] [PubMed]
- Schowalter, R.M.; Buck, C.B. The Merkel cell polyomavirus minor capsid protein. PLoS Pathog. 2013, 9, e1003558. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Madeira, F.; Park, Y.M.; Lee, J.; Buso, N.; Gur, T.; Madhusoodanan, N.; Basutkar, P.; Tivey, A.R.N.; Potter, S.C.; Finn, R.D.; et al. The EMBL-EBI search and sequence analysis tools APIs in 2019. Nucleic Acids Res. 2019, 47, W636–W641. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Fanning, E.; Zhao, K. SV40 DNA replication: From the A gene to a nanomachine. Virology 2009, 384, 352–359. [Google Scholar] [CrossRef] [Green Version]
- Kelly, T.J. SV40 DNA replication. J. Biol. Chem. 1988, 263, 17889–17892. [Google Scholar] [PubMed]
- Farmerie, W.G.; Folk, W.R. Regulation of polyomavirus transcription by large tumor antigen. Proc. Natl. Acad. Sci. USA 1984, 81, 6919–6923. [Google Scholar] [CrossRef] [Green Version]
- Tjian, R. Regulation of viral transcription and DNA replication by the SV40 large T antigen. Curr. Top Microbiol. Immunol. 1981, 93, 5–24. [Google Scholar]
- Zenke, M.; Grundström, T.; Matthes, H.; Wintzerith, M.; Schatz, C.; Wildeman, A.; Chambon, P. Multiple sequence motifs are involved in SV40 enhancer function. EMBO J. 1986, 5, 387–397. [Google Scholar] [CrossRef]
- Rio, D.C.; Tjian, R. Multiple control elements involved in the initiation of SV40 late transcription. J. Mol. Appl. Gen. 1984, 2, 423–435. [Google Scholar]
- Cowie, A.; Kamen, R. Multiple binding sites for polyomavirus large T antigen within regulatory sequences of polyomavirus DNA. J. Virol. 1984, 52, 750–760. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Jones, K.A.; Tjian, R. Essential contact residues within SV40 large T antigen binding sites I and II identified by alkylation-interference. Cell 1984, 36, 155–162. [Google Scholar] [CrossRef]
- Lednicky, J.A.; Butel, J.S. Simian virus 40 regulatory region structural diversity and the association of viral archetypal regulatory regions with human brain tumors. Semin. Cancer Biol. 2001, 11, 39–47. [Google Scholar] [CrossRef] [PubMed]
- O’Neill, F.J.; Greenlee, J.E.; Carney, H. The archetype enhancer of simian virus 40 DNA is duplicated during virus growth in human cells and rhesus monkey kidney cells but not in green monkey kidney cells. Virology 2003, 310, 173–182. [Google Scholar] [CrossRef] [Green Version]
- Lednicky, J.A.; Wong, C.; Butel, J.S. Artificial modification of the viral regulatory region improves tissue culture growth of SV40 strain 776. Virus Res. 1995, 35, 143–153. [Google Scholar] [CrossRef]
- Sroller, V.; Vilchez, R.A.; Stewart, A.R.; Wong, C.; Butel, J.S. Influence of the viral regulatory region on tumor induction by simian virus 40 in hamsters. J. Virol. 2008, 82, 871–879. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Muller, W.J.; Mueller, C.R.; Mes, A.M.; Hassell, J.A. Polyomavirus origin for DNA replication comprises multiple genetic elements. J. Virol. 1983, 47, 586–599. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Pomerantz, B.J.; Hassell, J.A. Polyomavirus and simian virus 40 large T antigens bind to common DNA sequences. J. Virol. 1984, 49, 925–937. [Google Scholar] [CrossRef] [Green Version]
- Herbomel, P.; Bourachot, B.; Yaniv, M. Two distinct enhancers with different cell specificities coexist in the regulatory region of polyoma. Cell 1984, 39, 653–662. [Google Scholar] [CrossRef]
- Iacoangeli, A.; Melucci-Vigo, G.; Risuleo, G.; Santi, E. Role of mouse polyomavirus late region in the control of viral DNA replication: A review. Biochimie 1995, 77, 780–786. [Google Scholar] [CrossRef]
- Jat, P.; Novak, U.; Cowie, A.; Tyndall, C.; Kamen, R. DNA sequences required for specific and efficient initiation of transcription at the polyoma virus early promoter. Mol. Cell Biol. 1982, 2, 737–751. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Mueller, C.R.; Mes-Masson, A.M.; Bouvier, M.; Hassell, J.A. Location of sequences in polyomavirus DNA that are required for early gene expression in vivo and in vitro. Mol. Cell Biol. 1984, 4, 2594–2609. [Google Scholar] [CrossRef] [Green Version]
- Rochford, R.; Campbell, B.A.; Villarreal, L.P. Genetic analysis of the enhancer requirements for polyomavirus DNA replication in mice. J. Virol. 1990, 64, 476–485. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sekikawa, K.; Levine, A.J. Isolation and characterization of polyoma host range mutants that replicate in nullipotential embryonal carcinoma cells. Proc. Natl. Acad. Sci. USA 1981, 78, 1100–1104. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Veldman, G.M.; Lupton, S.; Kamen, R. Polyomavirus enhancer contains multiple redundant sequence elements that activate both DNA replication and gene expression. Mol. Cell Biol. 1985, 5, 649–658. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- White, M.K.; Khalili, K. Pathogenesis of progressive multifocal leukoencephalopathy—revisited. J. Infect. Dis. 2011, 203, 578–586. [Google Scholar] [CrossRef] [Green Version]
- Assetta, B.; Atwood, W.J. The biology of JC polyomavirus. Biol. Chem. 2017, 398, 839–855. [Google Scholar] [CrossRef]
- Chen, N.N.; Khalili, K. Transcriptional regulation of human JC polyomavirus promoters by cellular proteins YB-1 and Pur alpha in glial cells. J. Virol. 1995, 69, 5843–5848. [Google Scholar] [CrossRef] [Green Version]
- Sadowska, B.; Barrucco, R.; Khalili, K.; Safak, M. Regulation of human polyomavirus JC virus gene transcription by AP-1 in glial cells. J. Virol. 2003, 77, 665–672. [Google Scholar] [CrossRef] [Green Version]
- Romagnoli, L.; Sariyer, I.K.; Tung, J.; Feliciano, M.; Sawaya, B.E.; Del Valle, L.; Ferrante, P.; Khalili, K.; Safak, M.; White, M.K. Early growth response-1 protein is induced by JC virus infection and binds and regulates the JC virus promoter. Virology 2008, 375, 331–341. [Google Scholar] [CrossRef] [Green Version]
- Pietropaolo, V.; Prezioso, C.; Bagnato, F.; Antonelli, G. John Cunningham virus: An overview on biology and disease of the etiological agent of the progressive multifocal leukoencephalopathy. New Microbiol. 2018, 41, 179–186. [Google Scholar] [PubMed]
- Van Loy, T.; Thys, K.; Tritsmans, L.; Stuyver, L.J. Quasispecies analysis of JC virus DNA present in urine of healthy subjects. PLoS ONE 2013, 8, e70950. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kenney, S.; Natarajan, V.; Strike, D.; Khoury, G.; Salzman, N.P. JC virus enhancer-promoter active in human brain cells. Science 1984, 226, 1337–1339. [Google Scholar] [CrossRef] [PubMed]
- Yogo, Y.; Kitamura, T.; Sugimoto, C.; Ueki, T.; Aso, Y.; Hara, K.; Taguchi, F. Isolation of a possible archetypal JC virus DNA sequence from nonimmunocompromised individuals. J. Virol. 1990, 64, 3139–3143. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- L’Honneur, A.S.; Leh, H.; Laurent-Tchenio, F.; Hazan, U.; Rozenberg, F.; Bury-Moné, S. Exploring the role of NCCR variation on JC polyomavirus expression from dual reporter minicircles. PLoS ONE 2018, 13, e0199171. [Google Scholar] [CrossRef] [PubMed]
- Agostini, H.T.; Ryschkewitsch, C.F.; Stoner, G.L. Rearrangements of archetypal regulatory regions in JC virus genomes from urine. Res. Virol. 1998, 149, 163–170. [Google Scholar] [CrossRef]
- Bofill-Mas, S.; Clemente-Casares, P.; Major, E.O.; Curfman, B.; Girones, R. Analysis of the excreted JC virus strains and their potential oral transmission. J. Neurovirol. 2003, 9, 498–507. [Google Scholar] [CrossRef]
- Frisque, R.J.; Bream, G.L.; Cannella, M.T. Human polyomavirus JC virus genome. J. Virol. 1984, 51, 458–469. [Google Scholar] [CrossRef] [Green Version]
- Markowitz, R.B.; Dynan, W.S. Binding of cellular proteins to the regulatory region of BK virus DNA. J. Virol. 1988, 62, 3388–3398. [Google Scholar] [CrossRef] [Green Version]
- Moens, U.; Van Ghelue, M. Polymorphism in the genome of non-passaged human polyomavirus BK: Implications for cell tropism and the pathological role of the virus. Virology 2005, 331, 209–231. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Rubinstein, R.; Pare, N.; Harley, E.H. Structure and function of the transcriptional control region of nonpassaged BK virus. J. Virol. 1987, 61, 1747–1750. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bethge, T.; Ajuh, E.; Hirsch, H.H. Imperfect Symmetry of Sp1 and Core Promoter Sequences Regulates Early and Late Virus Gene Expression of the Bidirectional BK Polyomavirus Noncoding Control Region. J. Virol. 2016, 90, 10083–10101. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bethge, T.; Hachemi, H.A.; Manzetti, J.; Gosert, R.; Schaffner, W.; Hirsch, H.H. Sp1 sites in the noncoding control region of BK polyomavirus are key regulators of bidirectional viral early and late gene expression. J. Virol. 2015, 89, 3396–3411. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Helle, F.; Brochot, E.; Handala, L.; Martin, E.; Castelain, S.; Francois, C.; Duverlie, G. Biology of the BKPyV: An Update. Viruses 2017, 9, 327. [Google Scholar] [CrossRef] [Green Version]
- Moens, U.; Sundsfjord, A.; Flaegstad, T.; Traavik, T. BK virus early RNA transcripts in stably transformed cells: Enhanced levels induced by dibutyryl cyclic AMP, forskolin and 12-O-tetradecanoylphorbol-13-acetate treatment. J. Gen. Virol. 1990, 71, 1461–1471. [Google Scholar] [CrossRef]
- Moens, U.; Subramaniam, N.; Johansen, B.; Johansen, T.; Traavik, T. A steroid hormone response unit in the late leader of the noncoding control region of the human polyomavirus BK confers enhanced host cell permissivity. J. Virol. 1994, 68, 2398–2408. [Google Scholar] [CrossRef] [Green Version]
- Gorrill, T.S.; Khalili, K. Cooperative interaction of p65 and C/EBPbeta modulates transcription of BKV early promoter. Virology 2005, 335, 1–9. [Google Scholar] [CrossRef] [Green Version]
- Anselmo, A.; Prezioso, C.; Saccà, F.A.; Di Lella, F.M.; Palmieri, G.; Tisone, G.; Pietropaolo, V.; Ciotti, M. Kidney graft failure induced by BKPyV replication despite a strong reduction of the immunosuppressive therapy. J. Med. Virol. 2019, 91, 1698–1701. [Google Scholar] [CrossRef]
- Arthur, R.R.; Shah, K.V.; Baust, S.J.; Santos, G.W.; Saral, R. Association of BK viruria with hemorrhagic cystitis in recipients of bone marrow transplants. N. Engl. J. Med. 1986, 315, 230–234. [Google Scholar] [CrossRef]
- Rosen, S.; Harmon, W.; Krensky, A.M.; Edelson, P.J.; Padgett, B.L.; Grinnell, B.W.; Rubino, M.J.; Walker, D.L. Tubulo-interstitial nephritis associated with polyomavirus (BK type) infection. N. Engl. J. Med. 1983, 308, 1192–1196. [Google Scholar] [CrossRef]
- McIlroy, D.; Halary, F.; Bressollette-Bodin, C. Intra-patient viral evolution in polyomavirus-related diseases. Philos. Trans. R. Soc. B Biol. Sci. 2019, 374, 20180301. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Seif, I.; Khoury, G.; Dhar, R. The genome of human papovavirus BKV. Cell 1979, 18, 963–977. [Google Scholar] [CrossRef]
- Yang, J.F.; You, J. Regulation of Polyomavirus Transcription by Viral and Cellular Factors. Viruses 2020, 12, 1072. [Google Scholar] [CrossRef] [PubMed]
- Olsen, G.H.; Hirsch, H.H.; Rinaldo, C.H. Functional analysis of polyomavirus BK non-coding control region quasispecies from kidney transplant recipients. J. Med. Virol. 2009, 81, 1959–1967. [Google Scholar] [CrossRef]
- Degener, A.M.; Pietropaolo, V.; Di Taranto, C.; Jin, L.; Ameglio, F.; Cordiali-Fei, P.; Trento, E.; Sinibaldi, L.; Orsi, N. Identification of a new control region in the genome of the DDP strain of BK virus isolated from PBMC. J. Med. Virol. 1999, 58, 413–419. [Google Scholar] [CrossRef]
- Pietropaolo, V.; Videtta, M.; Fioriti, D.; Mischitelli, M.; Arancio, A.; Orsi, N.; Degener, A.M. Rearrangement patterns of JC virus noncoding control region from different biological samples. J. Neurovirol. 2003, 9, 603–611. [Google Scholar] [CrossRef] [PubMed]
- Mischitelli, M.; Fioriti, D.; Videtta, M.; Degener, A.M.; Antinori, A.; Cinque, P.; Giordano, A.; Pietropaolo, V. Investigation on the role of cell transcriptional factor Sp1 and HIV-1 TAT protein in PML onset or development. J. Cell Physiol. 2005, 204, 913–918. [Google Scholar] [CrossRef] [PubMed]
- Ciardi, M.R.; Zingaropoli, M.A.; Iannetta, M.; Prezioso, C.; Perri, V.; Pasculli, P.; Lichtner, M.; D’Ettorre, G.; Altieri, M.; Conte, A.; et al. JCPyV NCCR analysis in PML patients with different risk factors: Exploring common rearrangements as essential changes for neuropathogenesis. Virol. J. 2020, 17, 23. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Prezioso, C.; Zingaropoli, M.A.; Iannetta, M.; Rodio, D.M.; Altieri, M.; Conte, A.; Vullo, V.; Ciardi, M.R.; Palamara, A.T.; Pietropaolo, V. Which is the best PML risk stratification strategy in natalizumab-treated patients affected by multiple sclerosis? Mult. Scler. Relat. Disord. 2020, 41, 102008. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Prezioso, C.; Scribano, D.; Bellizzi, A.; Anzivino, E.; Rodio, D.M.; Trancassini, M.; Palamara, A.T.; Pietropaolo, V. Efficient propagation of archetype JC polyomavirus in COS-7 cells: Evaluation of rearrangements within the NCCR structural organization after transfection. Arch. Virol. 2017, 162, 3745–3752. [Google Scholar] [CrossRef] [Green Version]
- Prezioso, C.; Scribano, D.; Rodio, D.M.; Ambrosi, C.; Trancassini, M.; Palamara, A.T.; Pietropaolo, V. COS-7-based model: Methodological approach to study John Cunningham virus replication cycle. Virol. J. 2018, 15, 29. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Jiang, M.; Abend, J.R.; Johnson, S.F.; Imperiale, M.J. The role of polyomaviruses in human disease. Virology 2009, 384, 266–273. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Babakir-Mina, M.; Ciccozzi, M.; Perno, C.F.; Ciotti, M. The human polyomaviruses KI and WU: Virological background and clinical implications. APMIS 2013, 121, 746–754. [Google Scholar] [CrossRef] [PubMed]
- Jartti, T.; Jartti, L.; Ruuskanen, O.; Söderlund-Venermo, M. New respiratory viral infections. Curr. Opin. Pulm. Med. 2012, 18, 271–278. [Google Scholar] [CrossRef]
- Gelfand, Y.; Rodriguez, A.; Benson, G. TRDB—the Tandem Repeats Database. Nucleic Acids Res. 2007, 35, D80–D87. [Google Scholar] [CrossRef]
- Song, X.; Van Ghelue, M.; Ludvigsen, M.; Nordbø, S.A.; Ehlers, B.; Moens, U. Characterization of the non-coding control region of polyomavirus KI isolated from nasopharyngeal samples from patients with respiratory symptoms or infection and from blood from healthy blood donors in Norway. J. Gen. Virol. 2016, 97, 1647–1657. [Google Scholar] [CrossRef] [Green Version]
- Li, K.; Guo, J.; Zhao, R.; Xue, Y.; Chen, L.; Yang, J.; Peng, J.; Jin, Q. Prevalence of 10 human polyomaviruses in fecal samples from children with acute gastroenteritis: A case-control study. J. Clin. Microbiol. 2013, 51, 3107–3109. [Google Scholar] [CrossRef] [Green Version]
- Tsunoda, T.; Takagi, T. Estimating transcription factor bindability on DNA. Bioinformatics 1999, 15, 622–630. [Google Scholar] [CrossRef]
- Jackstadt, R.; Röh, S.; Neumann, J.; Jung, P.; Hoffmann, R.; Horst, D.; Berens, C.; Bornkamm, G.W.; Kirchner, T.; Menssen, A.; et al. AP4 is a mediator of epithelial-mesenchymal transition and metastasis in colorectal cancer. J. Exp. Med. 2013, 210, 1331–1350. [Google Scholar] [CrossRef] [Green Version]
- Uhlén, M.; Fagerberg, L.; Hallstrom, B.M.; Lindskog, C.; Oksvold, P.; Mardinoglu, A.; Sivertsson, Å.; Kampf, C.; Sjöstedt, E.; Asplund, A.; et al. Proteomics. Tissue-based map of the human proteome. Science 2015, 347, 1260419. [Google Scholar] [CrossRef]
- Csoma, E.; Lengyel, G.; Bányai, K.; Takács, P.; Ánosi, N.; Marton, S.; Mátyus, M.; Pászti, E.; Gergely, L.; Szűcs, A. Study of Karolinska Institutet and Washington University polyomaviruses in tonsil, adenoid, throat swab and middle ear fluid samples. Future Microbiol. 2018, 13, 1719–1730. [Google Scholar] [CrossRef] [PubMed]
- Moens, U.; Van Ghelue, M.; Ludvigsen, M.; Korup-Schulz, S.; Ehlers, B. Early and late promoters of BKPyV, MCPyV, TSPyV, and HPyV12 are among the strongest of all known human polyomaviruses in 10 different cell lines. J. Gen. Virol. 2015, 96, 2293–2303. [Google Scholar] [CrossRef] [PubMed]
- Sood, R.; Kamikubo, Y.; Liu, P. Role of RUNX1 in hematological malignancies. Blood 2017, 129, 2070–2082. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gosert, R.; Rinaldo, C.H.; Funk, G.A.; Egli, A.; Ramos, E.; Drachenberg, C.B.; Hirsch, H.H. Polyomavirus BK with rearranged noncoding control region emerge in vivo in renal transplant patients and increase viral replication and cytopathology. J. Exp. Med. 2008, 205, 841–852. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gosert, R.; Kardas, P.; Major, E.O.; Hirsch, H.H. Rearranged JC virus noncoding control regions found in progressive multifocal leukoencephalopathy patient samples increase virus early gene expression and replication rate. J. Virol. 2010, 84, 10448–10456. [Google Scholar] [CrossRef] [Green Version]
- Feng, H.; Kwun, H.J.; Liu, X.; Gjoerup, O.; Stolz, D.B.; Chang, Y.; Moore, P.S. Cellular and viral factors regulating Merkel cell polyomavirus replication. PLoS ONE 2011, 6, e22468. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kwun, H.J.; Guastafierro, A.; Shuda, M.; Meinke, G.; Bohm, A.; Moore, P.S.; Chang, Y. The minimum replication origin of merkel cell polyomavirus has a unique large T-antigen loading architecture and requires small T-antigen expression for optimal replication. J. Virol. 2009, 83, 12118–12128. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hashida, Y.; Higuchi, T.; Matsui, K.; Shibata, Y.; Nakajima, K.; Sano, S.; Daibata, M. Genetic Variability of the Noncoding Control Region of Cutaneous Merkel Cell Polyomavirus: Identification of Geographically Related Genotypes. J. Infect. Dis. 2018, 217, 1601–1611. [Google Scholar] [CrossRef] [Green Version]
- Delbue, S.; Franciotta, D.; Giannella, S.; Dolci, M.; Signorini, L.; Ticozzi, R.; D’Alessandro, S.; Campisciano, G.; Comar, M.; Ferrante, P.; et al. Human Polyomaviruses in the Cerebrospinal Fluid of Neurological Patients. Microorganisms 2019, 8, 16. [Google Scholar] [CrossRef] [Green Version]
- Prezioso, C.; Obregon, F.; Ambroselli, D.; Petrolo, S.; Checconi, P.; Rodio, D.M.; Coppola, L.; Nardi, A.; Vito, C.; Sarmati, L.; et al. Merkel Cell Polyomavirus (MCPyV) in the Context of Immunosuppression: Genetic Analysis of Noncoding Control Region (NCCR) Variability among a HIV-1-Positive Population. Viruses 2020, 12, 507. [Google Scholar] [CrossRef]
- White, M.K.; Safak, M.; Khalili, K. Regulation of gene expression in primate polyomaviruses. J. Virol. 2009, 83, 10846–10856. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ajuh, E.T.; Wu, Z.; Kraus, E.; Weissbach, F.H.; Bethge, T.; Gosert, R.; Fischer, N.; Hirsch, H.H. Novel Human Polyomavirus Noncoding Control Regions Differ in Bidirectional Gene Expression according to Host Cell, Large T-Antigen Expression, and Clinically Occurring Rearrangements. J. Virol. 2018, 92, e02231-17. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Prezioso, C.; Ciotti, M.; Obregon, F.; Ambroselli, D.; Rodio, D.M.; Cudillo, L.; Gaziev, J.; Mele, A.; Nardi, A.; Favalli, C.; et al. Polyomaviruses shedding in stool of patients with hematological disorders: Detection analysis and study of the non-coding control region’s genetic variability. Med. Microbiol. Immunol. 2019, 208, 845–854. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bialasiewicz, S.; Lambert, S.B.; Whiley, D.M.; Nissen, M.D.; Sloots, T.P. Merkel cell polyomavirus DNA in respiratory specimens from children and adults. Emerg. Infect. Dis. 2009, 15, 492–494. [Google Scholar] [CrossRef]
- Kantola, K.; Sadeghi, M.; Lahtinen, A.; Koskenvuo, M.; Aaltonen, L.M.; Möttönen, M.; Rahiala, J.; Saarinen-Pihkala, U.; Riikonen, P.; Jartti, T.; et al. Merkel cell polyomavirus DNA in tumor-free tonsillar tissues and upper respiratory tract samples: Implications for respiratory transmission and latency. J. Clin. Virol. 2009, 45, 292–295. [Google Scholar] [CrossRef]
- Babakir-Mina, M.; Ciccozzi, M.; Lo Presti, A.; Greco, F.; Perno, C.F.; Ciotti, M. Identification of Merkel cell polyomavirus in the lower respiratory tract of Italian patients. J. Med. Virol. 2010, 82, 505–509. [Google Scholar] [CrossRef]
- Abedi Kiasari, B.; Vallely, P.J.; Klapper, P.E. Merkel cell polyomavirus DNA in immunocompetent and immunocompromised patients with respiratory disease. J. Med. Virol. 2011, 83, 2220–2224. [Google Scholar] [CrossRef]
- Shikova, E.; Emin, D.; Alexandrova, D.; Shindov, M.; Kumanova, A.; Lekov, A.; Moens, U. Detection of Merkel Cell Polyomavirus in Respiratory Tract Specimens. Intervirology 2017, 60, 28–32. [Google Scholar] [CrossRef]
- Iaria, M.; Caccuri, F.; Apostoli, P.; Giagulli, C.; Pelucchi, F.; Padoan, R.F.; Caruso, A.; Fiorentini, S. Detection of KI WU and Merkel cell polyomavirus in respiratory tract of cystic fibrosis patients. Clin. Microbiol. Infect. 2015, 21, e609–e615. [Google Scholar] [CrossRef] [Green Version]
- Prezioso, C.; Di Lella, F.M.; Rodio, D.M.; Bitossi, C.; Trancassini, M.; Mele, A.; de Vito, C.; Antonelli, G.; Pietropaolo, V. Merkel Cell Polyomavirus DNA Detection in Respiratory Samples: Study of a Cohort of Patients Affected by Cystic Fibrosis. Viruses 2019, 11, 571. [Google Scholar] [CrossRef] [Green Version]
- Abdulsalam, I.; Rasheed, K.; Sveinbjørnsson, B.; Ehlers, B.; Moens, U. Promoter activity of Merkel cell Polyomavirus variants in human dermal fibroblasts and a Merkel cell carcinoma cell line. Virol. J. 2020, 17, 54. [Google Scholar] [CrossRef] [Green Version]
- Shuda, M.; Feng, H.; Kwun, H.J.; Rosen, S.T.; Gjoerup, O.; Moore, P.S.; Chang, Y. T antigen mutations are a human tumor-specific signature for Merkel cell polyomavirus. Proc. Natl. Acad. Sci. USA 2008, 105, 16272–16277. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hashida, Y.; Higuchi, T.; Matsuzaki, S.; Nakajima, K.; Sano, S.; Daibata, M. Prevalence and Genetic Variability of Human Polyomaviruses 6 and 7 in Healthy Skin Among Asymptomatic Individuals. J. Infect. Dis. 2018, 217, 483–493. [Google Scholar] [CrossRef] [PubMed]
- Ho, J.; Jedrych, J.J.; Feng, H.; Natalie, A.A.; Grandinetti, L.; Mirvish, E.; Crespo, M.M.; Yadav, D.; Fasanella, K.E.; Proksell, S.; et al. Human polyomavirus 7-associated pruritic rash and viremia in transplant recipients. J. Infect. Dis. 2015, 211, 1560–1565. [Google Scholar] [CrossRef] [Green Version]
- Nguyen, K.D.; Lee, E.E.; Yue, Y.; Stork, J.; Pock, L.; North, J.P.; Vandergriff, T.; Cockerell, C.; Hosler, G.A.; Pastrana, D.V.; et al. Human polyomavirus 6 and 7 are associated with pruritic and dyskeratotic dermatoses. J. Am. Acad. Derm. 2017, 76, 932–940.e933. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Canavan, T.N.; Baddley, J.W.; Pavlidakey, P.; Tallaj, J.A.; Elewski, B.E. Human polyomavirus-7-associated eruption successfully treated with acitretin. Am. J. Transpl. 2018, 18, 1278–1284. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Smith, S.D.B.; Erdag, G.; Cuda, J.D.; Rangwala, S.; Girardi, N.; Bibee, K.; Orens, J.B.; Prono, M.D.; Toptan, T.; Loss, M.J. Treatment of human polyomavirus-7-associated rash and pruritus with topical cidofovir in a lung transplant patient: Case report and literature review. Transpl. Infect. Dis. 2018, 20, e12793. [Google Scholar] [CrossRef]
- Rosenstein, R.K.; Pastrana, D.V.; Starrett, G.J.; Sapio, M.R.; Hill, N.T.; Jo, J.H.; Lee, C.R.; Iadarola, M.J.; Buck, C.B.; Kong, H.H.; et al. Host-Pathogen Interactions in Human Polyomavirus 7 (HPyV7)-associated Pruritic Skin Eruption. J. Investig. Derm. 2020. [Google Scholar] [CrossRef]
- Klufah, F.; Mobaraki, G.; Chteinberg, E.; Alharbi, R.A.; Winnepenninckx, V.; Speel, E.J.M.; Rennspiess, D.; Olde Damink, S.W.; Neumann, U.P.; Kurz, A.K.; et al. High Prevalence of Human Polyomavirus 7 in Cholangiocarcinomas and Adjacent Peritumoral Hepatocytes: Preliminary Findings. Microorganisms 2020, 8, 1125. [Google Scholar] [CrossRef]
- Schrama, D.; Groesser, L.; Ugurel, S.; Hafner, C.; Pastrana, D.V.; Buck, C.B.; Cerroni, L.; Theiler, A.; Becker, J.C. Presence of human polyomavirus 6 in mutation-specific BRAF inhibitor-induced epithelial proliferations. JAMA Dermatol. 2014, 150, 1180–1186. [Google Scholar] [CrossRef] [Green Version]
- Hampras, S.S.; Locke, F.L.; Chavez, J.C.; Patel, N.S.; Giuliano, A.R.; Miller, K.; Gheit, T.; Tommasino, M.; Rollison, D.E. Prevalence of cutaneous viral infections in incident cutaneous squamous cell carcinoma detected among chronic lymphocytic leukemia and hematopoietic stem cell transplant patients. Leuk. Lymphoma 2018, 59, 911–917. [Google Scholar] [CrossRef] [PubMed]
- Kamminga, S.; van der Meijden, E.; de Brouwer, C.; Feltkamp, M.; Zaaijer, H. Prevalence of DNA of fourteen human polyomaviruses determined in blood donors. Transfusion 2019, 59, 3689–3697. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hashida, Y.; Higuchi, T.; Tanaka, M.; Shibata, Y.; Nakajima, K.; Sano, S.; Daibata, M. Prevalence and Viral Loads of Cutaneous Human Polyomaviruses in the Skin of Patients With Chronic Inflammatory Skin Diseases. J. Infect. Dis. 2019, 219, 1564–1573. [Google Scholar] [CrossRef] [PubMed]
- Harrison, C.; Jiang, T.; Banerjee, P.; Meinke, G.; D’Abramo, C.M.; Schaffhausen, B.; Bohm, A. Polyomavirus large T antigen binds symmetrical repeats at the viral origin in an asymmetrical manner. J. Virol. 2013, 87, 13751–13759. [Google Scholar] [CrossRef] [Green Version]
- Toptan, T.; Yousem, S.A.; Ho, J.; Matsushima, Y.; Stabile, L.P.; Fernández-Figueras, M.T.; Bhargava, R.; Ryo, A.; Moore, P.S.; Chang, Y. Survey for human polyomaviruses in cancer. JCI Insight 2016, 1, e85562. [Google Scholar] [CrossRef] [Green Version]
- Kazem, S.; Lauber, C.; van der Meijden, E.; Kooijman, S.; Kravchenko, A.A.; Feltkamp, M.C.; Gorbalenya, A.E. Limited variation during circulation of a polyomavirus in the human population involves the COCO-VA toggling site of Middle and Alternative T-antigen(s). Virology 2016, 487, 129–140. [Google Scholar] [CrossRef] [Green Version]
- Sauvage, V.; Foulongne, V.; Cheval, J.; Ar Gouilh, M.; Pariente, K.; Dereure, O.; Manuguerra, J.C.; Richardson, J.; Lecuit, M.; Burguière, A.; et al. Human polyomavirus related to African green monkey lymphotropic polyomavirus. Emerg. Infect. Dis. 2011, 17, 1364–1370. [Google Scholar] [CrossRef]
- Lednicky, J.A.; Butel, J.S.; Luetke, M.C.; Loeb, J.C. Complete genomic sequence of a new Human polyomavirus 9 strain with an altered noncoding control region. Virus Genes. 2014, 49, 490–492. [Google Scholar] [CrossRef]
- Moens, U.; Song, X.; Van Ghelue, M.; Lednicky, J.A.; Ehlers, B. A Role of Sp1 Binding Motifs in Basal and Large T-Antigen-Induced Promoter Activities of Human Polyomavirus HPyV9 and Its Variant UF-1. Int. J. Mol. Sci. 2017, 18, 2414. [Google Scholar] [CrossRef] [Green Version]
- Siebrasse, E.A.; Reyes, A.; Lim, E.S.; Zhao, G.; Mkakosya, R.S.; Manary, M.J.; Gordon, J.I.; Wang, D. Identification of MW polyomavirus, a novel polyomavirus in human stool. J. Virol. 2012, 86, 10321–10326. [Google Scholar] [CrossRef] [Green Version]
- Rockett, R.J.; Sloots, T.P.; Bowes, S.; O’Neill, N.; Ye, S.; Robson, J.; Whiley, D.M.; Lambert, S.B.; Wang, D.; Nissen, M.D.; et al. Detection of novel polyomaviruses, TSPyV, HPyV6, HPyV7, HPyV9 and MWPyV in feces, urine, blood, respiratory swabs and cerebrospinal fluid. PLoS ONE 2013, 8, e62764. [Google Scholar] [CrossRef] [Green Version]
- Pastrana, D.V.; Fitzgerald, P.C.; Phan, G.Q.; Raiji, M.T.; Murphy, P.M.; McDermott, D.H.; Velez, D.; Bliskovsky, V.; McBride, A.A.; Buck, C.B. A divergent variant of the eleventh human polyomavirus species, saint louis polyomavirus. Genome Announc. 2013, 1, e00812-13. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Peng, J.; Li, K.; Zhang, C.; Jin, Q. MW polyomavirus and STL polyomavirus present in tonsillar tissues from children with chronic tonsillar disease. Clin. Microbiol. Infect. 2016, 22, e91–e97. [Google Scholar] [CrossRef] [Green Version]
- Liu, W.; Yang, R.; Payne, A.S.; Schowalter, R.M.; Spurgeon, M.E.; Lambert, P.F.; Xu, X.; Buck, C.B.; You, J. Identifying the Target Cells and Mechanisms of Merkel Cell Polyomavirus Infection. Cell Host Microbe 2016, 19, 775–787. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Pietropaolo, V.; Prezioso, C.; Moens, U. Merkel Cell Polyomavirus and Merkel Cell Carcinoma. Cancers 2020, 12, 1774. [Google Scholar] [CrossRef] [PubMed]
- Kazem, S.; van der Meijden, E.; Feltkamp, M.C. The trichodysplasia spinulosa-associated polyomavirus: Virological background and clinical implications. APMIS 2013, 121, 770–782. [Google Scholar] [CrossRef] [PubMed]
- Narayanan, D.; Rady, P.L.; Tyring, S.K. Recent developments in trichodysplasia spinulosa disease. Transpl. Infect. Dis. 2020, e13434. [Google Scholar] [CrossRef] [PubMed]
Virus | Original Source | Associated Disease | Reference |
---|---|---|---|
KIPyV | Nasopharyngeal aspirate | None | [7] |
WUPyV | Bronchoavelar lavage | None | [8] |
MCPyV | Merkel cell carcinoma | None | [9] |
HPyV6 | Healthy skin | Pruritic skin eruption in immunocompromised patients | [10] |
HPyV7 | Healthy skin | Pruritic skin eruption in immunocompromised patients | [10] |
TSPyV | Trichodysplasia spinulosa spicules | Trichodysplasia spinulosa | [11] |
HPyV9 | Serum from renal transplant recipient | None | [12] |
HPyV10 | Condyloma specimens from a patient with WHIM * syndrome | None | [13] |
STLPyV | Stool sample from a healthy 15-month-old child | None | [14] |
HPyV12 | Liver sample from patient with malignant disease | None | [15] |
NJPyV | Muscle biopsy from a pancreatic transplant patient | None | [16] |
LIPyV | Skin swab | None | [17] |
QPyV | Stool sample from 85-year old hospital patient | None | [18] |
HPyV | Sequence | Position | Length | Remarks |
---|---|---|---|---|
KIPyV | CGTGAAGCCAACTTCCTG-GGC CGTG-AGCCAGCTTCCTGCGGC | 251–271; 272–292 | 21 | Imperfect DR * |
WUPyV | GCCCTTTGTA ATGTTGTGACATCTCC | 319–328; 389–398 479–494, 548–563 | 10 16 | - |
MCPyV | CAGAGGCCTC AACTTTTTTTC | 147–156; 170–179 328–338; 370–380 | 10 11 | Palindrome |
HPyV6 | No repeats | - | - | |
HPyV7 | No repeats | - | - | - |
TSPyV | GAAATGAA | 34–41; 42–49 | 7 | DR |
HPyV9 | CTGTGGTAT | 275–283; 284–292 | 9 | DR |
HPyV10 | GCTATTGTTGGCAA | 168–181;182–195 | 14 | DR |
STLPyV | No repeats | - | - | - |
HPyV12 | GTTCC CAGGCAGACGGCCAAGTTCC | 203–207; 229–233 208–227; 228–248 | 5 20 | GTTCC is part of larger repeat DR separated by 1 nucleotide |
NJPyV | No repeats | - | - | - |
LIPyV | No repeats | - | - | - |
QPyV | No repeats | - | - | - |
Mutation | Frequency * | Mutation | Frequency | Mutation | Frequency |
---|---|---|---|---|---|
C8A | 1 | A132insAGGCGCTGCG | 3 | T248A | 1 |
T24A | 1 | T149C/A | 4 | G290A | 1 |
T28C | 3 | T154C | 1 | G291A | 1 |
T30A | 1 | A162T | 1 | T294C | 1 |
A33G | 1 | A163C | 1 | T297C | 2 |
C36T | 1 | A166G | 1 | T300C | 1 |
T41C | 1 | T180C/A | 10 | A305G | 1 |
C46T | 1 | A181C | 1 | C306A | 10 |
A57G | 1 | T183G/A | 10 | T336C | 1 |
T60C | 1 | G188A | 2 | ΔG352 | 1 |
C77T | 1 | T189C | 1 | A371G | 1 |
T78C | 1 | A196G | 1 | A381T | 1 |
C85T | 1 | C208T | 1 | T411C | 1 |
A99G | 1 | T217A | 1 | A415G | 1 |
A101T | 1 | G224A | 1 | T416C | 1 |
T111C | 2 | A231G | 1 | C418T | 1 |
G116A | 1 | A234G | 1 | C444T | 1 |
T121A | 1 | T235A | 1 | C455T | 1 |
G125A | 2 | T247C | 1 | G484A | 6 |
Transcription Factor | KIPyV | WUPyV | MCPyV | HPyV6 | HPyV7 | TSPyV | HPyV9 | HPyV10 | STLPyV | HPyV12 | NJPyV | LIPyV | QPyV |
---|---|---|---|---|---|---|---|---|---|---|---|---|---|
AML1 | 6 | 3 | 3 | 6 | 4 | 6 | 6 | 3 | 4 | 2 | 7 | 4 | 3 |
ARNT | 2 | 0 | 0 | 3 | 2 | 4 | 2 | 2 | 2 | 5 | 4 | 2 | 2 |
AP1 | 8 | 9 | 10 | 6 | 8 | 14 | 8 | 7 | 10 | 4 | 5 | 5 | 5 |
AP2 | 12 | 13 | 6 | 7 | 6 | 6 | 5 | 6 | 5 | 5 | 7 | 3 | 0 |
AP4 | 8 | 12 | 5 | 0 | 6 | 6 | 5 | 5 | 9 | 4 | 9 | 3 | 3 |
ATF/CREB | 7 | 11 | 6 | 4 | 8 | 14 | 5 | 6 | 10 | 2 | 5 | 3 | 8 |
CAAT | 7 | 7 | 3 | 5 | 5 | 7 | 8 | 9 | 4 | 3 | 6 | 4 | 5 |
C/EBP | 7 | 9 | 8 | 9 | 9 | 12 | 13 | 9 | 4 | 7 | 7 | 11 | 0 |
CDP | 2 | 2 | 0 | 1 | 1 | 1 | 2 | 4 | 3 | 3 | 2 | 1 | 1 |
E2F | 9 | 10 | 4 | 4 | 5 | 14 | 9 | 6 | 8 | 6 | 7 | 5 | 2 |
E47 | 7 | 8 | 1 | 2 | 5 | 3 | 5 | 4 | 4 | 2 | 6 | 2 | 2 |
ELK1 | 10 | 8 | 9 | 5 | 4 | 12 | 8 | 8 | 3 | 6 | 8 | 6 | 5 |
EVI1 | 3 | 6 | 4 | 3 | 4 | 9 | 7 | 3 | 4 | 4 | 5 | 5 | 5 |
GATA-1 | 7 | 12 | 9 | 8 | 6 | 16 | 15 | 9 | 6 | 6 | 7 | 10 | 8 |
GATA-2 | 6 | 8 | 5 | 3 | 5 | 13 | 8 | 6 | 4 | 8 | 3 | 5 | 7 |
GATA-3 | 5 | 0 | 2 | 1 | 5 | 8 | 6 | 1 | 0 | 0 | 1 | 4 | 3 |
GR | 2 | 0 | 0 | 1 | 2 | 3 | 0 | 2 | 1 | 3 | 0 | 1 | 3 |
HNF3 | 3 | 4 | 2 | 2 | 1 | 4 | 1 | 3 | 4 | 1 | 2 | 0 | 2 |
IRF | 5 | 3 | 6 | 4 | 4 | 2 | 3 | 4 | 0 | 2 | 4 | 3 | 3 |
MYB | 6 | 5 | 6 | 7 | 0 | 4 | 6 | 6 | 3 | 7 | 2 | 7 | 1 |
MYC/MAX | 5 | 7 | 1 | 2 | 2 | 6 | 3 | 2 | 2 | 3 | 4 | 1 | 1 |
MYOD | 9 | 9 | 3 | 3 | 5 | 7 | 8 | 6 | 8 | 8 | 5 | 6 | 2 |
NF1 | 5 | 5 | 3 | 1 | 1 | 4 | 1 | 6 | 4 | 3 | 4 | 2 | 1 |
NFκB | 2 | 3 | 5 | 2 | 1 | 5 | 7 | 5 | 0 | 1 | 1 | 1 | 1 |
NHLH1 | 2 | 2 | 2 | 1 | 1 | 1 | 0 | 0 | 1 | 0 | 1 | 1 | 0 |
OCT1 | 9 | 17 | 11 | 8 | 7 | 16 | 16 | 6 | 8 | 8 | 13 | 9 | 9 |
p53 | 7 | 8 | 5 | 4 | 3 | 8 | 9 | 5 | 1 | 11 | 10 | 5 | 3 |
PAX2 | 3 | 1 | 0 | 3 | 1 | 4 | 2 | 1 | 2 | 5 | 5 | 1 | 4 |
PAX5 | 7 | 4 | 5 | 2 | 3 | 3 | 8 | 1 | 5 | 2 | 3 | 1 | 3 |
PAX6 | 1 | 2 | 0 | 1 | 0 | 0 | 2 | 0 | 1 | 1 | 2 | 0 | 2 |
SOX5 | 3 | 7 | 4 | 2 | 4 | 8 | 2 | 5 | 7 | 2 | 5 | 4 | 4 |
RORα | 7 | 4 | 3 | 4 | 6 | 5 | 4 | 1 | 2 | 6 | 2 | 0 | 3 |
SP1 | 12 | 12 | 14 | 6 | 8 | 13 | 10 | 9 | 7 | 11 | 8 | 11 | 11 |
SREBP | 3 | 1 | 1 | 1 | 2 | 1 | 1 | 3 | 5 | 0 | 2 | 1 | 3 |
SRF | 3 | 5 | 1 | 4 | 2 | 7 | 5 | 3 | 0 | 3 | 3 | 1 | 5 |
STAT | 3 | 6 | 2 | 2 | 3 | 7 | 2 | 3 | 3 | 2 | 5 | 1 | 0 |
T3R | 6 | 6 | 1 | 3 | 1 | 1 | 3 | 2 | 3 | 2 | 3 | 0 | 4 |
TBP | 5 | 10 | 5 | 5 | 5 | 5 | 5 | 4 | 4 | 6 | 2 | 3 | 5 |
TST-1 | 3 | 5 | 4 | 2 | 0 | 4 | 2 | 2 | 1 | 0 | 1 | 2 | 1 |
USF | 12 | 12 | 3 | 6 | 7 | 13 | 7 | 8 | 5 | 4 | 8 | 2 | 7 |
YY1 | 3 | 3 | 4 | 3 | 6 | 6 | 5 | 1 | 1 | 3 | 2 | 2 | 3 |
Mutation | Frequency * | Mutation | Frequency | Mutation | Frequency |
---|---|---|---|---|---|
C28T | 1 | C245A | 1 | G316A | 1 |
C52G | 33 | C249A | 1 | G319A | 1 |
G54A | 114 | C251A | 18 | G326A | 2 |
T76C | 1 | G252T | 1 | T346G | 17 |
A94G | 15 | G253A | 1 | A347G | 1 |
G104C | 1 | C254A | 5 | C358G | 20 |
C105G | 15 | C263T | 1 | T365G | 1 |
G109C | 1 | C270T | 1 | A366G | 1 |
G139C | 2 | ins277A | 1 | A372G | 5 |
G145A | 3 | A278C | 1 | C422A | 1 |
G167C | 1 | A284C | 10 | G431A | 1 |
A188G | 1 | C285A | 10 | C523T | 1 |
T198C | 1 | T291C | 1 | C571T | 1 |
C202A | 1 | C293T | 1 | ||
C244G | 2 | G295A | 8 |
Mutation | Frequency * | Mutation | Frequency | Mutation | Frequency |
---|---|---|---|---|---|
T5G | 1 | G188A | 2 | T371insCAAT | 1 |
C6G | 1 | T210C | 1 | C372ins(T/A)(C)AAC | 19 |
C13T | 1 | G212insA | 2 | T373A/insCAAC/ΔT373 | 6 |
C26A | 1 | ΔA213/A213insA | 5 | T374C/insAA | 2 |
G32C | 3 | ΔA214 | 1 | T379insT/ΔT379 | 3 |
A38G | 1 | A234T | 3 | Δ381–387 | 3 |
G40A | 1 | A251C | 1 | C383insAA | 5 |
C51T | 1 | C272T | 1 | ΔC392 | 3 |
T52C | 1 | ΔG274 | 1 | C393T | 1 |
T86C | 1 | ΔG300 | 1 | ΔG396 | 1 |
T94C | 1 | G301A | 1 | ΔA397 | 1 |
T102A | 1 | ΔA304 | 1 | C400insT | 2 |
Δ105–112 | 2 | G309A | 1 | ΔT401 | 2 |
T108G | 1 | G311A | 1 | ΔT402 | 1 |
T123C | 1 | Δ316–323 | 2 | ΔT407 | 3 |
G143T/A | 3 | ΔA320 | 1 | T408A/ΔT408 | 14 |
C145G | 1 | Δ322–327 | 1 | ΔC409 | 1 |
T146C | 1 | A325T | 2 | T412A | 1 |
G152T | 2 | A326G/ ΔA326 | 3 | ΔT423–425 | 1 |
C158T | 1 | T349C | 1 | ΔA433 | 1 |
ΔT161 | 2 | ΔG352 | 40 | A435G | 17 |
C170T | 2 | A361G | 1 | C448A | 1 |
A173G | 1 | G363A | 22 | T449C/ΔT449 | 7 |
C176T | 2 | ΔT368 | 3 | ΔT456/Δ456–460 | 18 |
T178C | 1 | T369ins(T)(C)AAC(T)(C)/ ΔT369 | 14 | ΔT457 | 17 |
Mutation | Frequency * | Mutation | Frequency | Mutation | Frequency |
---|---|---|---|---|---|
T17C | 1 | Δ183–193 | 1 | T231insG | 1 |
C18T | 1 | A223C | 1 | C232insG | 1 |
G22A | 2 | A224T | 1 | C234insTGGGCAGGGCATTT | 1 |
C65T | 1 | A225G | 1 | C243T | 3 |
C78G | 2 | T228C | 1 | T287C | 3 |
A116G | 2 | T229A/insGGC | 1 | A356G | 1 |
Mutation | Frequency * | Mutation | Frequency | Mutation | Frequency |
---|---|---|---|---|---|
G99A/C | 10 | G161insTCA | 1 | ΔT205 | 10 |
A100T | 1 | G162C/insACAGGTATGAT | 2 | G228T | 10 |
ΔT149 | 1 | C164T | 5 | G230C/R | 7 |
ΔC150/Δ150–161 | 2 | ΔA180 | 5 | C279G/insTT | 6 |
C158G | 5 | ΔG181 | 5 | G315T | 11 |
T159(C)(A)/insA | 7 | G203A | 10 | ||
G160A | 9 | C204G/ΔC204 | 11 |
Mutation | Frequency * | Mutation | Frequency * | Mutation | Frequency * |
---|---|---|---|---|---|
G84C | 6 | Δ318–371 | 1 | C514G | 6 |
C103A | 1 | A356G | 20 | G516T | 6 |
C138insA | 6 | G358T | 6 | C538Y | 1 |
A173G | 6 | G359A/G359insA | 13 | T543insC | 6 |
C210T | 1 | A422T | 1 | G546C | 6 |
A224G | 1 | G428C | 13 | T552C | 6 |
Δ257–295 | 1 | C456G | 2 | C555G | 6 |
G297A | 5 | T496G |
Mutation | Frequency * | Mutation | Frequency | Mutation | Frequency |
---|---|---|---|---|---|
G21C | 1 | ΔA180 | 1 | G263A | 5 |
T22C | 1 | ΔG192 | 1 | A287C | 1 |
A24C | 1 | ΔA194 | 1 | G311A | 1 |
G28C/ΔG28 | 3 | A195G/ΔA195 | 4 | G338A | 1 |
G40A | 1 | G196C | 4 | G345A | 1 |
C53G | 5 | A198G/ΔA198 | 6 | C354A | 2 |
G57C | 1 | G201A/ΔG201 | 5 | C356G | 1 |
ΔC65 | 1 | ΔT203 | 1 | C363G | 1 |
C131G | 1 | ΔA204 | 1 | G372A | 1 |
T132insG | 1 | A208G | 1 | C389G | 1 |
A145G | 1 | A215T | 6 | A395C | 1 |
C146T | 1 | T222C | 1 | G396T | 3 |
G160A | 7 | G225A/C | 2 | A422 | 1 |
C166T | 5 | T256C/ΔT256 | 8 | C433A | 3 |
Δ171–181 | 1 | A259A | 1 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Moens, U.; Prezioso, C.; Pietropaolo, V. Genetic Diversity of the Noncoding Control Region of the Novel Human Polyomaviruses. Viruses 2020, 12, 1406. https://doi.org/10.3390/v12121406
Moens U, Prezioso C, Pietropaolo V. Genetic Diversity of the Noncoding Control Region of the Novel Human Polyomaviruses. Viruses. 2020; 12(12):1406. https://doi.org/10.3390/v12121406
Chicago/Turabian StyleMoens, Ugo, Carla Prezioso, and Valeria Pietropaolo. 2020. "Genetic Diversity of the Noncoding Control Region of the Novel Human Polyomaviruses" Viruses 12, no. 12: 1406. https://doi.org/10.3390/v12121406
APA StyleMoens, U., Prezioso, C., & Pietropaolo, V. (2020). Genetic Diversity of the Noncoding Control Region of the Novel Human Polyomaviruses. Viruses, 12(12), 1406. https://doi.org/10.3390/v12121406