Single-Cell Analysis Uncovers a Vast Diversity in Intracellular Viral Defective Interfering RNA Content Affecting the Large Cell-to-Cell Heterogeneity in Influenza A Virus Replication
Abstract
1. Introduction
2. Materials and Methods
2.1. Cells and Viruses
2.2. Isolation of Infected Single Cells
2.3. Plaque Assay
2.4. Single-Cell reverse transcription polymerase chain reaction (RT-PCR)
2.5. Quantification of Ribosomes
2.6. Cell Population-Based Infection and Analysis
2.7. Procedure for Single-Cell RNA sequencing (scRNA-Seq)
2.8. Data Processing and Quality Control
- --
- outFilterMultimapNmax 5
- --
- outFilterScoreMinOverLread 0.25
- --
- outFilterMatchNminOverLread 0.25
- --
- outSJfilterOverhangMin 10 10 10 10
- --
- outSJfilterCountUniqueMin 1 1 1 1
- --
- outSJfilterCountTotalMin 1 1 1 1
2.9. Analysis of Deletion Junctions
2.10. Data and Software Availability
3. Results
3.1. Single-Cell Analysis of influenza A virus (IAV)-Infected Cells Demonstrates A Large Cell-to-Cell Heterogeneity in Intracellular Defective Interfering (DI) Viral RNA (vRNA) Content
3.2. Infected Single Cells with a Low Progeny Virus Titer Show a High Load of Intracellular DI vRNAs
3.3. scRNA-Seq Reveals a Decrease of Host Cell mRNA Fraction and an Increase of Viral mRNA Fraction in High-Yield Cells
3.4. scRNA-Seq Analysis Reveals an Association of the DI mRNA Content and the Single-Cell Virus Yield
3.5. De Novo Generation of DI vRNAs Observed at the Single-Cell Level
3.6. Viral mRNA Level and DI mRNA Content Are Both Connected with the Single-Cell Virus Yield, Independently from One Another
4. Discussion
Supplementary Materials
Author Contributions
Funding
Conflicts of Interest
References
- Shaw, M.L.; Palese, P. Orthomyxoviridae. In Fields Virology; Fields, B.N., Knipe, D.M., Eds.; Wolters Kluwer: Philadelphia, PA, USA, 2013; Volume 1, pp. 1151–1185. [Google Scholar]
- Eisfeld, A.J.; Neumann, G.; Kawaoka, Y. At the centre: Influenza A virus ribonucleoproteins. Nat. Rev. Microbiol. 2015, 13, 28–41. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Compans, R.W.; Content, J.; Duesberg, P.H. Structure of the Ribonucleoprotein of Influenza Virus. J. Virol. 1972, 10, 795–800. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Noda, T.; Kawaoka, Y. Structure of influenza virus ribonucleoprotein complexes and their packaging into virions. Rev. Med. Virol. 2010, 20, 380–391. [Google Scholar] [CrossRef] [Scilit]
- Zheng, W.; Tao, Y.J. Structure and assembly of the influenza A virus ribonucleoprotein complex. FEBS Lett. 2013, 587, 1206–1214. [Google Scholar] [CrossRef] [Scilit]
- Fodor, E. The RNA polymerase of influenza a virus: Mechanisms of viral transcription and replication. Acta Virol. 2013, 57, 113–122. [Google Scholar] [CrossRef] [Scilit]
- Jorba, N.; Coloma, R.; Ortín, J. Genetic trans-Complementation Establishes a New Model for Influenza Virus RNA Transcription and Replication. PLoS Pathog. 2009, 5, e1000462. [Google Scholar] [CrossRef] [Scilit]
- Kupke, S.Y.; Riedel, D.; Frensing, T.; Zmora, P.; Reichl, U. A Novel Type of Influenza A Virus-Derived Defective Interfering Particle with Nucleotide Substitutions in Its Genome. J. Virol. 2019, 93. [Google Scholar] [CrossRef] [Scilit]
- Perrault, J. Origin and Replication of Defective Interfering Particles. Curr. Top. Microbiol. Immunol. 1981, 93, 151–207. [Google Scholar]
- Lazzarini, R.A.; Keene, J.D.; Schubert, M. The origins of defective interfering particles of the negative-strand RNA viruses. Cell 1981, 26, 145–154. [Google Scholar] [CrossRef] [Scilit]
- Nayak, D.P.; Chambers, T.M.; Akkina, R.K. Defective-Interfering (DI) RNAs of Influenza Viruses: Origin, Structure, Expression, and Interference. Curr. Top. Microbiol. Immunol. 1985, 114, 103–151. [Google Scholar]
- Jennings, P.A.; Finch, J.T.; Winter, G.; Robertson, J.S. Does the higher order structure of the influenza virus ribonucleoprotein guide sequence rearrangements in influenza viral RNA? Cell 1983, 34, 619–627. [Google Scholar] [CrossRef] [Scilit]
- Davis, A.R.; Nayak, D.P. Sequence relationships among defective interfering influenza viral RNAs. Proc. Natl. Acad. Sci. USA 1979, 76, 3092–3096. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Huang, A.S.; Baltimore, D. Defective Viral Particles and Viral Disease Processes. Nature 1970, 226, 325–327. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dimmock, N.J.; Easton, A.J. Defective Interfering Influenza Virus RNAs: Time to Reevaluate Their Clinical Potential as Broad-Spectrum Antivirals? J. Virol. 2014, 88, 5217–5227. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Marriott, A.C.; Dimmock, N.J. Defective interfering viruses and their potential as antiviral agents. Rev. Med. Virol. 2010, 20, 51–62. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Laske, T.; Heldt, F.S.; Hoffmann, H.; Frensing, T.; Reichl, U. Modeling the intracellular replication of influenza A virus in the presence of defective interfering RNAs. Virus Res. 2016, 213, 90–99. [Google Scholar] [CrossRef] [Scilit]
- Duhaut, S.; McCauley, J. Defective RNAs Inhibit the Assembly of Influenza Virus Genome Segments in a Segment-Specific Manner. Virology 1996, 216, 326–337. [Google Scholar] [CrossRef] [Scilit]
- Odagiri, T.; Tashiro, M. Segment-specific noncoding sequences of the influenza virus genome RNA are involved in the specific competition between defective interfering RNA and its progenitor RNA segment at the virion assembly step. J. Virol. 1997, 71, 2138–2145. [Google Scholar] [CrossRef] [Scilit]
- Dimmock, N.J.; Easton, A.J. Cloned Defective Interfering Influenza RNA and a Possible Pan-Specific Treatment of Respiratory Virus Diseases. Viruses 2015, 7, 3768–3788. [Google Scholar] [CrossRef] [Scilit]
- Notton, T.; Sardanyés, J.; Weinberger, A.D.; Weinberger, L.S. The case for transmissible antivirals to control population-wide infectious disease. Trends Biotechnol. 2014, 32, 400–405. [Google Scholar] [CrossRef] [Scilit]
- Rouzine, I.M.; Weinberger, L.S. Design requirements for interfering particles to maintain coadaptive stability with HIV-1. J. Virol. 2013, 87, 2081–2093. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhao, H.; To, K.K.W.; Chu, H.; Ding, Q.; Zhao, X.; Li, C.; Shuai, H.; Yuan, S.; Zhou, J.; Kok, K.-H.; et al. Dual-functional peptide with defective interfering genes effectively protects mice against avian and seasonal influenza. Nat. Commun. 2018, 9, 2358. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Frensing, T.; Pflugmacher, A.; Bachmann, M.; Peschel, B.; Reichl, U. Impact of defective interfering particles on virus replication and antiviral host response in cell culture-based influenza vaccine production. Appl. Microbiol. Biotechnol. 2014, 98, 8999–9008. [Google Scholar] [CrossRef] [Scilit]
- Frensing, T. Defective interfering viruses and their impact on vaccines and viral vectors. Biotechnol. J. 2015, 10, 681–689. [Google Scholar] [CrossRef] [Scilit]
- Dimmock, N.J.; Easton, A.J. Can defective interfering RNAs affect the live attenuated influenza vaccine? Lancet Infect Dis. 2017, 17, 1234–1235. [Google Scholar] [CrossRef] [Scilit]
- Singanayagam, A.; Zambon, M.; Lalvani, A.; Barclay, W. Urgent challenges in implementing live attenuated influenza vaccine. Lancet Infect Dis. 2018, 18, e25–e32. [Google Scholar] [CrossRef] [Scilit]
- Gould, P.S.; Easton, A.J.; Dimmock, N.J. Live Attenuated Influenza Vaccine contains Substantial and Unexpected Amounts of Defective Viral Genomic RNA. Viruses 2017, 9, 269. [Google Scholar] [CrossRef] [Scilit]
- Zhu, Y.; Yongky, A.; Yin, J. Growth of an RNA virus in single cells reveals a broad fitness distribution. Virology 2009, 385, 39–46. [Google Scholar] [CrossRef] [Scilit]
- Delbruck, M. The burst size distribution in the growth of bacterial viruses (bacteriophages). J. Bacteriol. 1945, 50, 131–135. [Google Scholar] [CrossRef] [Scilit]
- Schulte, M.B.; Andino, R. Single-Cell Analysis Uncovers Extensive Biological Noise in Poliovirus Replication. J. Virol. 2014, 88, 6205–6212. [Google Scholar] [CrossRef] [Scilit]
- Heldt, F.S.; Kupke, S.Y.; Dörl, S.; Reichl, U.; Frensing, T. Single-cell analysis and stochastic modelling unveil large cell-to-cell variability in influenza A virus infection. Nat. Commun. 2015, 6, 8938. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dulbecco, R.; Vogt, M. One-Step growth curve of western equine encephalomyelitis virus on chicken embryo cells grown in vitro and analysis of virus yields from single cells. J. Exp. Med. 1954, 99, 183–199. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Guo, F.; Li, S.; Caglar, M.U.; Mao, Z.; Liu, W.; Woodman, A.; Arnold, J.J.; Wilke, C.O.; Huang, T.J.; Cameron, C.E. Single-Cell Virology: On-Chip Investigation of Viral Infection Dynamics. Cell Rep. 2017, 21, 1692–1704. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Xin, X.; Wang, H.; Han, L.; Wang, M.; Fang, H.; Hao, Y.; Li, J.; Zhang, H.; Zheng, C.; Shen, C. Single-Cell Analysis of the Impact of Host Cell Heterogeneity on Infection with Foot-and-Mouth Disease Virus. J. Virol. 2018, 92, e00179-18. [Google Scholar] [CrossRef] [Scilit]
- Timm, A.C.; Warrick, J.W.; Yin, J. Quantitative profiling of innate immune activation by viral infection in single cells. Integr. Boil. 2017, 9, 782–791. [Google Scholar] [CrossRef] [Scilit]
- O’Neal, J.T.; Upadhyay, A.A.; Wolabaugh, A.; Patel, N.B.; Bosinger, S.E.; Suthar, M.S. West Nile Virus-Inclusive Single-Cell RNA Sequencing Reveals Heterogeneity in the Type I Interferon Response within Single Cells. J. Virol. 2019, 93, 93. [Google Scholar] [CrossRef] [Scilit]
- Russell, A.B.; Elshina, E.; Kowalsky, J.R.; Velthuis, A.J.W.T.; Bloom, J.D. Single-Cell Virus Sequencing of Influenza Infections That Trigger Innate Immunity. J. Virol. 2019, 93, e00500–e00519. [Google Scholar] [CrossRef] [Scilit]
- Wang, C.; Forst, C.V.; Chou, T.-W.; Geber, A.; Wang, M.; Hamou, W.; Smith, M.; Sebra, R.; Zhang, B.; Zhou, B.; et al. Cell-to-cell variation in defective virus expression and effects on host responses during influenza virus infection. BioRxiv 2018, 487785. [Google Scholar] [CrossRef] [Scilit]
- Russell, A.B.; Trapnell, C.; Bloom, J.D. Extreme heterogeneity of influenza virus infection in single cells. eLife 2018, 7, e32303. [Google Scholar] [CrossRef] [Scilit]
- De Paepe, M.; De Monte, S.; Robert, L.; Lindner, A.B.; Taddei, F. Emergence of Variability in Isogenic Escherichia coli Populations Infected by a Filamentous Virus. PLoS ONE 2010, 5, e11823. [Google Scholar] [CrossRef] [Scilit]
- Srivastava, R.; You, L.; Summers, J.; Yin, J. Stochastic vs. deterministic modeling of intracellular viral kinetics. J. Boil. 2002, 218, 309–321. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zanini, F.; Pu, S.-Y.; Bekerman, E.; Einav, S.; Quake, S.R. Single-cell transcriptional dynamics of flavivirus infection. eLife 2018, 7, e32942. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Steuerman, Y.; Cohen, M.; Peshes-Yaloz, N.; Valadarsky, L.; Cohn, O.; David, E.; Frishberg, A.; Mayo, L.; Bacharach, E.; Amit, I.; et al. Dissection of Influenza Infection In Vivo by Single-Cell RNA Sequencing. Cell Syst. 2018, 6, 679–691. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Genzel, Y.; Reichl, U. Vaccine production–state of the art and future needs in upstream processing. In Methods in Biotechnology: Animal Cell Biotechnology, 2nd ed.; Pörtner, R., Ed.; Humana Press Inc.: Totowa, NJ, USA, 2007; Volume 24, pp. 457–473. [Google Scholar]
- Hoffmann, E.; Stech, J.; Guan, Y.; Webster, R.G.; Perez, D.R. Universal primer set for the full-length amplification of all influenza A viruses. Arch. Virol. 2001, 146, 2275–2289. [Google Scholar] [CrossRef] [Scilit]
- Alberts, B. Lehrbuch der Molekularen Zellbiologie; Wiley: Hoboken, NJ, USA, 2012. [Google Scholar]
- Picelli, S.; Faridani, O.R.; Bjorklund, A.K.; Winberg, G.; Sagasser, S.; Sandberg, R. Full-length RNA-seq from single cells using Smart-seq2. Nat. Protoc. 2014, 9, 171–181. [Google Scholar] [CrossRef] [Scilit]
- Patro, R.; Duggal, G.; Love, M.I.; Irizarry, R.A.; Kingsford, C. Salmon provides fast and bias-aware quantification of transcript expression. Nat. Methods 2017, 14, 417–419. [Google Scholar] [CrossRef] [Scilit]
- Dobin, A.; Davis, C.A.; Schlesinger, F.; Drenkow, J.; Zaleski, C.; Jha, S.; Batut, P.; Chaisson, M.; Gingeras, T.R. STAR: ultrafast universal RNA-seq aligner. Bioinformatics 2013, 29, 15–21. [Google Scholar] [CrossRef] [Scilit]
- Reinius, B.; Mold, J.E.; Ramsköld, D.; Deng, Q.; Johnsson, P.; Michaelsson, J.; Frisén, J.; Sandberg, R. Analysis of allelic expression patterns in clonal somatic cells by single-cell RNA–seq. Nat. Genet. 2016, 48, 1430–1435. [Google Scholar] [CrossRef] [Scilit]
- Tirosh, I.; Izar, B.; Prakadan, S.M.; Wadsworth, M.H.; Treacy, D.; Trombetta, J.J.; Rotem, A.; Rodman, C.; Lian, C.; Murphy, G.; et al. Dissecting the multicellular ecosystem of metastatic melanoma by single-cell RNA-seq. Science 2016, 352, 189–196. [Google Scholar] [CrossRef] [Scilit]
- Llorens-Bobadilla, E.; Zhao, S.; Baser, A.; Saiz-Castro, G.; Zwadlo, K.; Martin-Villalba, A. Single-Cell Transcriptomics Reveals a Population of Dormant Neural Stem Cells that Become Activated upon Brain Injury. Cell Stem Cell 2015, 17, 329–340. [Google Scholar] [CrossRef] [Scilit]
- Boergeling, Y.; Rozhdestvensky, T.S.; Schmolke, M.; Resa-Infante, P.; Robeck, T.; Randau, G.; Wolff, T.; Gabriel, G.; Brosius, J.; Ludwig, S. Evidence for a Novel Mechanism of Influenza Virus-Induced Type I Interferon Expression by a Defective RNA-Encoded Protein. PLoS Pathog. 2015, 11, e1004924. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Penn, C.R.; Mahy, B.W. Novel polypeptides encoded by influenza virus subgenomic (DI type) virion RNAs. Virus Res. 1985, 3, 311–321. [Google Scholar] [CrossRef] [Scilit]
- Akkina, R.K.; Chambers, T.M.; Nayak, D.P. Expression of defective-interfering influenza virus-specific transcripts and polypeptides in infected cells. J. Virol. 1984, 51, 395–403. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Alnaji, F.G.; Holmes, J.R.; Rendon, G.; Vera, J.C.; Fields, C.J.; Martin, B.E.; Brooke, C.B.; Fields, C. Sequencing Framework for the Sensitive Detection and Precise Mapping of Defective Interfering Particle-Associated Deletions across Influenza A and B Viruses. J. Virol. 2019, 93, e00354-19. [Google Scholar] [CrossRef] [Scilit]
- Saira, K.; Lin, X.; DePasse, J.V.; Halpin, R.; Twaddle, A.; Stockwell, T.; Angus, B.; Cozzi-Lepri, A.; Delfino, M.; Dugan, V.; et al. Sequence Analysis of In Vivo Defective Interfering-Like RNA of Influenza A H1N1 Pandemic Virus. J. Virol. 2013, 87, 8064–8074. [Google Scholar] [CrossRef] [Scilit]
- Duhaut, S.D.; Dimmock, N.J. Defective segment 1 RNAs that interfere with production of infectious influenza A virus require at least 150 nucleotides of 5′ sequence: Evidence from a plasmid-driven system. J. Gen. Virol. 2002, 83, 403–411. [Google Scholar] [CrossRef] [Scilit]
- Sekellick, M.J.; Marcus, P.I. Viral interference by defective particles of vesicular stomatitis virus measured in individual cells. Virology 1980, 104, 247–252. [Google Scholar] [CrossRef] [Scilit]
- Akpinar, F.; Timm, A.; Yin, J. High-Throughput Single-Cell Kinetics of Virus Infections in the Presence of Defective Interfering Particles. J. Virol. 2016, 90, 1599–1612. [Google Scholar] [CrossRef] [Scilit]
- You, L.; Suthers, P.F.; Yin, J. Effects of Escherichia coli Physiology on Growth of Phage T7 In Vivo and In Silico. J. Bacteriol. 2002, 184, 1888–1894. [Google Scholar] [CrossRef] [Scilit]
- Cohen, E.M.; Kobiler, O. Gene Expression Correlates with the Number of Herpes Viral Genomes Initiating Infection in Single Cells. PLoS Pathog. 2016, 12, e1006082. [Google Scholar] [CrossRef] [Scilit]
- Murphy, T.W.; Zhang, Q.; Naler, L.B.; Ma, S.; Lu, C. Recent advances in the use of microfluidic technologies for single cell analysis. Analyst 2017, 143, 60–80. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wu, A.R.; Neff, N.F.; Kalisky, T.; Dalerba, P.; Treutlein, B.; Rothenberg, M.E.; Mburu, F.M.; Mantalas, G.L.; Sim, S.; Clarke, M.F.; et al. Quantitative assessment of single-cell RNA-sequencing methods. Nat. Methods 2014, 11, 41–46. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lee, M.-S.; Hu, A.Y.-C. A cell-based backup to speed up pandemic influenza vaccine production. Trends Microbiol. 2012, 20, 103–105. [Google Scholar] [CrossRef] [Scilit] [PubMed]






| Reaction | Target | Primer Name | Sequence (5′ -> 3′) |
|---|---|---|---|
| RT | All segments | Uni12 | AGCAAAAGCAGG |
| PCR | Segment 1 | S1 Uni for | AGCGAAAGCAGGTCAATTAT |
| S1 Uni rev | AGTAGAAACAAGGTCGTTTTTAAAC | ||
| Segment 2 | S2 Uni for | AGCGAAAGCAGGCAAACC | |
| S2 Uni rev | AGTAGGAACAAGGCATTTTTTCATG | ||
| Segment 3 | S3 Uni for | AGCGAAAGAAGGTACTGATCC | |
| S3 Uni rev | AGTAGAAACAAGGTACTTTTTTGGAC |
| Reaction | Target | Primer Name | Sequence (5′ -> 3′) |
|---|---|---|---|
| PCR | Segment 4 | S4 Uni for | AGCAAAAGCAGGGGAA |
| S4 Uni rev | AGTAGAAACAAGGGTGTTTT | ||
| Segment 5 | S5 Uni for | AGCAAAAGCAGGGTAGATAATC | |
| S5 Uni rev | AGTAGAAACAAGGGTATTTTTC | ||
| Segment 6 | S6 Uni for | AGCGAAAGCAGGGGTTTAAAATG | |
| S6 Uni rev | AGTAGAAACAAGGAGTTTTTTGAAC | ||
| Segment 7 | S7 Uni for | AGCGAAAGCAGGTAGATATTG | |
| S7 Uni rev | AGTAGAAACAAGGTAGTTTTTTAC | ||
| Segment 8 | S8 Uni for | AGAAAAAGCAGGGTGACAAA | |
| S8 Uni rev | AGTAGAAACAAGGGTGTTTT |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kupke, S.Y.; Ly, L.-H.; Börno, S.T.; Ruff, A.; Timmermann, B.; Vingron, M.; Haas, S.; Reichl, U. Single-Cell Analysis Uncovers a Vast Diversity in Intracellular Viral Defective Interfering RNA Content Affecting the Large Cell-to-Cell Heterogeneity in Influenza A Virus Replication. Viruses 2020, 12, 71. https://doi.org/10.3390/v12010071
Kupke SY, Ly L-H, Börno ST, Ruff A, Timmermann B, Vingron M, Haas S, Reichl U. Single-Cell Analysis Uncovers a Vast Diversity in Intracellular Viral Defective Interfering RNA Content Affecting the Large Cell-to-Cell Heterogeneity in Influenza A Virus Replication. Viruses. 2020; 12(1):71. https://doi.org/10.3390/v12010071
Chicago/Turabian StyleKupke, Sascha Young, Lam-Ha Ly, Stefan Thomas Börno, Alexander Ruff, Bernd Timmermann, Martin Vingron, Stefan Haas, and Udo Reichl. 2020. "Single-Cell Analysis Uncovers a Vast Diversity in Intracellular Viral Defective Interfering RNA Content Affecting the Large Cell-to-Cell Heterogeneity in Influenza A Virus Replication" Viruses 12, no. 1: 71. https://doi.org/10.3390/v12010071
APA StyleKupke, S. Y., Ly, L.-H., Börno, S. T., Ruff, A., Timmermann, B., Vingron, M., Haas, S., & Reichl, U. (2020). Single-Cell Analysis Uncovers a Vast Diversity in Intracellular Viral Defective Interfering RNA Content Affecting the Large Cell-to-Cell Heterogeneity in Influenza A Virus Replication. Viruses, 12(1), 71. https://doi.org/10.3390/v12010071

