1. Introduction
Porcine epidemic diarrhea (PED) is an acute, highly contagious enteric disease in pigs caused by porcine epidemic diarrhea virus (PEDV) [
1]. The characteristic clinical signs of PEDV infection are vomiting, watery diarrhea, dehydration, and weight loss [
2,
3]. Pigs of all ages are susceptible to PEDV infection, and neonatal piglets under 2 weeks of age have the highest mortality rates, reaching 100% [
2]. PEDV was initially reported in Europe in the early 1970s, and it has spread widely to multiple swine-producing countries [
4]. Since 2010, the emergence of highly virulent PEDV strains has decimated swine farms in China [
5]. These strains spread to the United States in 2013, wiping out more than 10% of the pig population of America in less than a year [
6,
7,
8]. Since then, these new high-virulence PEDV strains have repeatedly emerged in many swine-raising countries, leading to devastating economic losses to the world swine industry [
4,
9]. The severity of these highly virulent variants emphasizes the importance of developing an effective method to control their spread and infection.
PEDV is a member of the
Alpha-coronavirus genus, within the family
Coronaviridae in the order
Nidovirales [
3,
10]. PEDV possesses an ~28 kb single-stranded, positive-sense, RNA genome, which encodes seven open reading frames (ORF 1a/1b, and ORF 2-6) [
11]. Among them, the first gene ORFs 1a/1b encode large replicase polyproteins, which are processed to generate 16 nonstructural proteins (nsp1-nsp16) [
12]. ORF 2, –3, –4, –5, and –6 encode structural/accessory proteins, including spike (S) protein, nonstructural accessory protein, envelope (E) protein, membrane (M) protein, and nucleocapsid (N) protein, respectively [
13].
The S protein is a type I glycoprotein that plays a crucial role in virus attachment, entry, receptor binding, cell membrane fusion and induction of neutralizing antibodies [
14,
15]. The S protein can be cleaved into S1 (residues 1–789) and S2 subunits (residues 790–1386) by host protease [
16]. The S1 subunit contains the N-terminal domain (NTD, residues 1–233) that shows sialic acid binding activity and the C-terminal domain (CTD, residues 253–638) that attaches to the cell surface receptor (e.g., aminopeptidase N (APN)) [
17]. The S2 subunit mediates virus–cell membrane fusion [
16]. S protein is an excellent target for vaccine development for the induction of protective immunity against PEDV. Several studies have confirmed that antibodies, especially neutralizing antibodies stimulated by the vaccine expressing spike protein, are able to protect the host from PEDV infection [
18,
19]. Additionally, neutralizing antibodies against PEDV can be developed as candidates for passive protection. Lee et al. reported that egg yolk antibody (IgY) against S1 domain of spike protein efficiently protects neonatal piglets against PEDV, supporting the potential of antibody reagents as a prophylactic or therapeutic agent to protect piglets against PEDV infection [
20].
Genetically engineered recombinant antibody fragments are increasingly being used in medical diagnosis and therapy in many diseases. The single chain fragment variable (ScFv), also called single-chain antibody, is one of the most popular types of genetically engineered antibodies [
21,
22]. The scFv consists of a variable light chain (V
L) and heavy chain (V
H) that are connected by a short peptide linker [
23]. The advantages of scFv are its small size, low immunogenicity, high specificity, and ability to be genetically engineered. The scFv can be produced in bacterial expression systems for large-scale production. Although scFv is smaller than full-length IgG, it retains the complete antigen binding site [
24]. Several scFvs have been produced to control virus infection, including scFvs against chicken infectious bursal disease virus, scFvs targeting human influenza virus H5N1, and scFvs against the phosphoprotein of Newcastle disease virus [
25,
26,
27,
28]. Thus, scFv is considered a potential reagent for the prevention and treatment of viral disease.
At present, there have been no reports of the selection of porcine scFvs to target the porcine pathogen. In this study, we constructed a scFv phage display library using peripheral blood lymphocytes of piglets induced with PEDV. The scFvs against PEDV were selected, and their neutralization efficiencies were evaluated. We further confirmed that the mechanism of scFvs neutralization of PEDV occurred through binding to the viral spike protein. The immunoprophylactic and therapeutic properties of scFvs in neonatal piglets against PEDV infection were further explored. Our results provide a foundation for the development of scFv-based drugs for the prevention and treatment of PEDV infection.
2. Materials and Methods
2.1. Ethics Statement
Animal experiments were performed in accordance with the recommendations laid out in the Guidelines for the Use of Laboratory Animals provided by the Science and Technology Commission of Shanghai Municipality (STCSM). The protocol was approved by the ethics committee of Shanghai JiaoTong University, School of Agriculture and Biology (approval number: 201600853).
2.2. Cells, Viruses and Plasmids
The Vero E6 cell line (ATCC® CRL-1587TM) or HEK 293T cell line (ATCC® CRL-3216TM) was cultured in Dulbecco’s Modified Eagle’s Essential Medium (DMEM) (Invitrogen, Carlsbad, CA, USA) supplemented with 10% fetal bovine serum (FBS; Gibco, Grand Island, NY, USA) and 100 μg/mL penicillin/streptomycin (Invitrogen). All cells were cultured at 37 °C in a 5% CO2 incubator.
The intestinal porcine epithelial cell line J2 (IPEC-J2) (kindly provided by Prof. Jianxiong Xv) was maintained in DMEM/F12 medium supplemented with 10% FBS and incubated in an atmosphere of 5% CO2 at 37 °C.
The PEDV (SH2012-5, GenBank accession number: MG837011.1) were propagated in Vero E6 cells in the presence of 5 µg/mL tosyl phenylalanyl chloromethyl ketone (TPCK)-treated trypsin (Worthington, Lakewood, NJ, USA).
To construct PEDV S1 and S2 domain-expressing plasmids, the PEDV S1 domain was amplified with the upstream primer containing EcoR I (underlined): TTGAATTCATGAAGTCTTTAACCTACTTC and the downstream primer containing Xho I (underlined): TTCTCGAGTCATTTACAACGAGAGTTACCATT. The PEDV S2 domain was amplified with the upstream primer containing EcoR I (underlined): TTGAATTCATGAGTCAAGATTGCACCCAC and the downstream primer containing Xho I (underlined): TTCTCGAGTCACTGCACGTGGACCTTTTC. PCR products were inserted into pCDNA3.1 (+) (Thermo Scientific Inc., Waltham, MA, USA) to form pCDNA3.1-PEDV-S1 and pCDNA3.1-PEDV-S2, respectively. The recombinant plasmids were verified by sequencing and indirect immunofluorescence assay (IFA).
2.3. Virus Purification by Sucrose Gradient Centrifugation
Confluent Vero E6 cell cultures infected with PEDV were harvested when 90% of the cells showed a viral cytopathic effect. Virus particles in the suspensions were purified by sucrose density gradient centrifugation as previously described [
29]. The resulting band between the 40% and 60% sucrose solutions were collected with a syringe. After removing the sucrose, the presence of concentrated viral particles was determined by ELISA.
2.4. Molecular Cloning of scFv
A total of 20 PEDV serum-positive crossbreed (large white) pigs were purchased from a local breeding farm. Blood samples were collected from these pigs and used to isolate peripheral blood lymphocytes (PBLs). Total RNA was extracted from the PBLs using TRIzol reagent (Invitrogen) and used as template to synthesize full-length cDNA. The primers for the amplification of the heavy-chain variable regions (V
H) and light-chain variable regions (V
L) are listed in
Table 1. In the first step of the PCR, the V
H gene and V
L genes (including V
Lκ and V
Lλ) were amplified, respectively. In the second step of PCR, amplified V
L was added with a linker sequence to generate V
L-Linker. Finally, V
H and V
L-Linker were ligated together to form a full-length scFv by SOE-PCR.
2.5. Library Construction
The scFv PCR products were separated by electrophoresis and extracted from the gel using a commercial kit (Thermo Scientific Inc.). The purified fragments were inserted into the linearized pCANTAB5e vector (Biovector Inc., Beijing, China). The recombinant DNAs were transformed into Escherichia coli competent TG1 cells (Biovector) by electroporation (MicroPulser; Bio-Rad, Hercules, CA, USA) and grown on 2× YT-AG plates (100 µg/mL ampicillin and 2% glucose). The library size was calculated by counting the colonies of transformed bacteria. The recombinant phagemid transformed cells were then infected with M13KO7 helper phage to generate the rescued phage particles.
2.6. Biopanning
A 96-well ELISA plate was coated with 5 µg/mL purified PEDV particles at 4 °C overnight. After blocking with 5% non-fat milk in PBS, the rescued phages were added to each well. Unbound phages were removed by washing 10 times with PBST and 10 times with PBS. The PEDV-binding phages were eluted by the addition of 0.1 M glycine-HCl buffer (pH 2.2). Log phase-grown E. coli TG1 were infected with the eluted phages and then plated onto a 2× YT-AG plate. A total of four rounds of biopanning were performed.
2.7. Binding Affinity Analyzed by Phage ELISA
Phage ELISA was used to assess the phages that bound to PEDV. A 96-well plate was coated with 2 µg/mL of PEDV particles in 0.1 M NaHCO3 (pH 8.6), blocked with 5% nonfat milk, and then incubated with recombinant phage particles. After washing with PBST, 48 selected phages derived from the last round of biopanning were detected with HRP-conjugated anti-M13 monoclonal antibody (1:5000 dilution). The OD value at 450 nm was measured using a microplate reader (BioTek, Winooski, VT, USA).
2.8. Production of Soluble scFv
The scFv gene sequences of interest were subcloned into the pET-28(+) vector, and scFv expression was induced with 1.2 mM IPTG (Sigma-Aldrich, St. Louis, MO, USA). The bacterial cells were lysed by sonication and the scFv protein was purified using a Ni-NTA his-bind resin column (Merck, Madison, WI, USA) according to the manufacturer’s instructions. After washing the column two times with 20 mL of washing buffer (300 mM NaCl, 50 mM sodium phosphate buffer, 20 mM imidazole, pH 8.0), the scFv bound to the column was eluted with the elution buffer (300 mM NaCl, 50 mM sodium phosphate buffer, 100 mM imidazole, pH 8.0). The eluted scFv was assessed by 10% sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE). For subsequent experiments, the eluted scFv was further dialyzed in 1000 mL PBS at 4 °C for 48 h, changing the PBS every 12 h. The purified scFv was concentrated using centrifugal filters with a 10-kDa cutoff (Merck), quantified using the bicinchoninic acid assay kit (Thermo Scientific Inc.) and stored at 4 °C.
2.9. Cytotoxicity Assay
The cytotoxic activity of scFv on Vero E6 and IPEC-J2 cells was determined using the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay (Thermo Scientific Inc.). Briefly, approximately 2 × 104 cells/well were seeded in a 96-well cell culture plate and cultured overnight. The next morning, scFv at two-fold serial dilutions (3.125–200 μg/mL) or PBS alone was added to each well. The cells were incubated for 48 h. Then, MTT solution (0.2 mg/mL) was added to each well, and the plate was further incubated at 37 °C for 4 h. The supernatant was then removed, and the colored formazan crystal in each well was dissolved by addition of 100 µL of SDS-HCl solution (Sigma-Aldrich). The OD value at 570 nm was measured using a microplate reader (BioTek). The cell survival rate was calculated as the (OD570 of scFv treatment)/(OD570 of PBS treatment) × 100%.
2.10. Neutralization Test
To determine whether scFv against PEDV possessed neutralization activity, a plaque reduction neutralization (PRN) assay was performed [
30]. Briefly, purified scFv or combined cocktail (contains 2/3 mg/mL of each scFv) was adjusted to 2 mg/mL and filtered using a 0.22-µm membrane. Subsequently, scFv was serially diluted 2-fold and incubated with an equal volume of PEDV at a multiplicity of infection (MOI) of 0.01 for 1 h at 37 °C. Then, the scFv-virus mixture was inoculated onto a confluent monolayer of Vero E6 cells in 24-well plates and incubated at 37 °C for 1 h. A positive control (virus only, no scFv), a blank controls (no virus, no scFv) and a negative control (virus, non-related scFv) were also added to the well. The cells were overlaid with DMEM containing 1% low melting agarose (Sigma-Aldrich) and 5 µg/mL TPCK-treated trypsin. After 48–72 h of incubation, cells were fixed in 4% formaldehyde for 30 min and stained with 1% crystal violet solution for 20 min. The number of plaques was determined by manual counting and plaque reduction rate for each scFv was calculated using the formula: [1 − (average number of plaques for each dilution/average number of plaques in the positive control well)] × 100%. Neutralizing antibody titers were calculated as the reciprocal of the highest serum dilution that reduced the virus plaque count by 80% for scFv or combined cocktail. Each scFv or combined cocktail was tested in triplicate.
2.11. Indirect Immunofluorescence Assay (IFA)
Vero E6 cells or HEK 293T cells grown to 60% confluence on coverslips in six-well plates were transfected with pCDNA3.1-PEDV-S1/S2 or infected with PEDV at an MOI of 1. At 24 h post-infection or 24 h post-transfection, the cells were fixed in 4% paraformaldehyde, permeabilized with 0.5% Triton X-100 and blocked with 10% normal goat serum (Tiangen Biotech, Beijing, China) to block nonspecific binding sites. They were then incubated with 100 μL of purified scFv for 2 h. After three washes with PBS, anti-6 × His tag antibody (FITC) antibody (1:2000 dilution) (Abcam, Cambridge, MA, USA) was added. Images of the stained cells were visualized using a Nikon Eclipse 80i fluorescence microscope (Nikon, Sendai, Japan).
2.12. Epitope Analysis by Additive ELISA
To ascertain whether the scFvs recognized different epitopes on the PEDV antigen, an additive ELISA was performed to calculate the additivity index (AI). Briefly, 96-well plates were coated with PEDV antigen (10 μg/mL) and incubated overnight at 4 °C. 100 μg/mL of each scFv that was able to saturate the coated antigen was added alone or in combination. After incubation and washing, the bound scFvs were detected by the addition of HRP-conjugated anti-His mouse antibody (Yeasen, Shanghai, China). Normal mouse serum was used as a negative control. Competition for each scFv was determined by calculating the AI using the following equation: AI = [2A1+2/(A1 + A2) − 1] × 100%, where A1 and A2 represent the OD450 values for each of two scFvs tested, and A1+2 represents the OD450 value when the two scFvs are mixed. If the AI is above 50%, then the two scFvs recognize different antigenic epitope; if it is below 50%, then the two scFvs recognize the same antigenic epitope.
2.13. In Vitro Stability of scFv to Simulated Gastric Conditions
The stability of scFv to gastric conditions was evaluated using simulated gastric fluid (SGF). SGF contained 3.2 mg/mL pepsin (Sigma-Aldrich) in 0.03 M NaCl at pH 3 [
31]. Purified scFv was added into 200 μL of SGF or PBS (control) and incubated at 37 °C with shaking for 0–3 h. Antibody activity was defined as the ability of scFv binding to PEDV and was assessed by ELISA. The result was expressed as relative activity (%) using the following formula: (OD
450 value of scFv treated with SGF/OD
450 value of scFv treated with PBS) × 100%.
2.14. In Vitro Stability of scFv to Simulated Intestinal Conditions
The stability of scFv to intestinal conditions was evaluated using simulated intestinal fluid (SIF). SIF contained 10 mg/mL pancreatin (Sigma-Aldrich) in 0.05 M KH
2PO
4 at pH 6.8 [
31]. Purified scFv was added into SIF or PBS (control) and incubated at 37 °C with shaking for 0–4 h. The scFv activity was determined by ELISA. The result was expressed as relative activity (%) using the following formula: (OD
450 value of scFv treated with SIF/ OD
450 value of scFv treated with PBS) × 100%.
2.15. Immunohistochemistry
Two crossbred (large white) pigs were oral administrated with 50 mL of purified scFv using a flexible gavage feeding needle (Tianyuan Animal instrument Inc., Shandong, China). At 4 h post inoculation, pigs were humanely euthanized with 100% CO2. The section of jejunum was collected, fixed in 10% formalin for 24 h and immersed in 30% sucrose for 48 h. Tissue samples were then embedded in OCT compound (Sakura Finetek, Radnor, PA, USA) and sectioned at 10 µm thickness using a cryomicrotome (Leica CM1900; Wetzlar, Germany). Cryosectioned samples were transferred onto the polylysine pre-treated slides, stained with anti-His monoclonal antibody (Sigma-Aldrich) as primary antibody followed by FITC conjugated goat anti-mouse antibody as secondary antibody. The sections were omitted primary antibodies as negative control. The samples were visualized by a fluorescence microscopy (Nikon).
2.16. Animal Experiment
Crossbred (large white) piglets were obtained from PEDV seronegative pregnant sows at a local breeding farm after birth. The piglets were housed in separate sterile isolators and fed with commercial sterile milk and water. Experiment 1 (group 1 to 3) was assigned to measure the prophylactic efficiency of scFvs on the survival of piglets against PEDV challenge. Twelve 3-day-old piglets were randomly divided into three groups (
n = 4). The scFvs were added to the milk to adjust the final concentration to 100 µg/mL. At 3 days of age, group 1 was orally administered 50 mL of the scFvs-milk mixture five times per day using a flexible gavage feeding needle (Tianyuan Animal Instrument Inc.); group 2 and group 3 were orally administered the PBS-milk mixture five times per day. On the next day, groups 1 and 2 were orally inoculated with 3 mL of DMEM containing 5 log
10 PFU/piglet of PEDV. After the challenge exposure, groups 1 and 2 were orally administered the corresponding scFvs-milk or PBS-milk mixture for another two days. All animals were monitored for 10 days for the presence of clinical symptoms, including diarrhea, vomiting, anorexia and depression. The severity of clinical symptoms was evaluated. Fecal samples collected from the rectum using swabs were used to quantify viral shedding and evaluate the severity of diarrhea. The fecal consistency were scored as follows: 0, normal feces (no diarrhea); 1, pasty feces (mild diarrhea); 2, semiliquid feces (moderate diarrhea); and 3, liquid feces (severe diarrhea) [
32]. Experiment 2 (group 4 to 6) was assigned to measure the prophylactic efficiency of scFvs on the small intestine of piglets against PEDV challenge. Nine 3-day-old piglets were randomly divided into three groups (
n = 3). The treatment for piglets in groups 4 to 6 was the same as that for piglets in groups 1 to 3, respectively. At 5 days post challenge (dpc), piglets in groups 4 to 6 were humanely euthanized with 100% CO
2 and subjected to pathological and histological examinations. After necropsy, lesions in the small intestine were observed. Small intestinal tissues were collected from each piglet and fixed in 10% formalin. The fixed specimen was trimmed, processed, embedded in paraffin, rehydrated and stained with hematoxylin and eosin (H&E). The stained sections were observed by light microscopy (Olympus, Tokyo, Japan).
2.17. qPCR Analysis
The fecal samples were homogenized in PBS, frozen and thawed 3 times, and they were centrifuged at 8000×
g for 20 min. Total RNA was extracted from the supernatant, and cDNA was generated using a reverse transcription kit. The qPCR was performed in a 20-µL reaction volume containing 2 µL of template, 0.4 µL of forward (10 µM) and reverse primer (10 µM), 6.8 µL of H
2O, 0.4 µL of ROX reference dye and 10 µL of SYBR Green qPCR premix (Clontech, Mountain View, CA, USA). The qPCR reaction was carried on an ABI 7300 Real-Time PCR System (Applied Biosystems, Foster, CA, USA) under the following conditions: an initial reverse transcription at 58 °C for 30 min, followed by an initial denaturation at 95 °C for 5 min, 40 cycles of 95 °C for 30 s, and 60 °C for 1 min. The primer sequences are listed in
Table 1. The detection limit of the assay was determined by generating standard curves from serial 10-fold dilutions of known amounts of in vitro-transcribed RNA (1 × 10
12) for the qPCR. The standard curve for PEDV qPCR has a slope of −3.462, indicating that the amplification efficiency was 94.47%. The detection limit was calculated as 1000 RNA copies per mL. The viral genome copy numbers per mL were determined, and each sample was assessed in triplicate.
2.18. Field Application
The field experiment was carried out in pig farms having outbreaks of diarrhea in winter. Fecal/intestinal samples were collected from piglets with watery diarrhea. Viral RNA was extracted and used as a template for RT-PCR on PEDV, transmissible gastroenteritis virus (TGEV) or porcine deltacoronavirus (PDCoV) [
33,
34,
35]. Two farms that showed PEDV positive results were chosen for the application of scFvs. The scFvs were added to the milk to adjust the final concentration to 200 µg/mL. Piglets at two- to four-day-old that showed symptom of diarrhea were orally administrated with 40 mL of scFvs-milk three times per day. The other piglets inoculated with PBS-milk were served as negative control. The number of death and survival of piglets were recorded every day for five days. The mortality was calculated five days after first administration of scFvs.
2.19. Statistical Analysis
All the data were expressed as the means ± standard error of the mean (SEM). Data were compared for significance using a student’s t test or one-way ANOVA with the SAS 9.0 software package (SAS institute Inc., Campus Drive Cary, NC, USA). A p-value <0.05 was considered statistically significant.
4. Discussion
In 2010, new variants of PEDV that emerged in China had a high morbidity (90–100%) and mortality (70–100%) in suckling piglets. The emergent PEDV strains are genetically distinct from the classical vaccine CV777 strain [
13,
36]. They are characterized by deletions, insertions or amino acid substitutions in the S gene, compared to the CV777 strains [
4,
6,
37]. Even though many swine populations have been immunized with the classical vaccine CV777, it could only provide limited cross-neutralizing activity in swine populations against new variant strains, thus leading to immunity failure [
38]. The strain used in the present study was isolated from piglets showing typical PED clinical symptoms. It belongs to the genotype of new variant strains, representing epidemic and pandemic field strains in China. We used this strain as an antigen to select specific porcine scFvs that could neutralize virus infection, and the prophylactic efficiency of scFvs was also evaluated.
The traditional strategy to protect piglets from PEDV infection is to immunize pregnant sows with inactivated or attenuated vaccines [
39]. Neutralizing antibodies are produced in the colostrum or milk of sows, and newborn piglets are passively protected from PEDV when they suckle immune dams (lactogenic immunity) [
3,
40]. Although these vaccines are widely used and considered to be effective, not all sows develop solid lactogenic immunity due to the immunization route of the vaccine, and sucking pigs are still vulnerable to infection unless they obtain adequate maternal antibodies from the milk [
19,
41]. Additionally, this method does not provide protection to postweaned piglets. PEDV-specific antibodies are rapidly lost in postweaned piglets, and they become susceptible to PEDV. Moreover, amino acid sequence mutations in the new variant strains will cause immunization failure of commercial vaccines [
42]. Based on these aspects, feeding foreign antibodies (passive immunization) to piglets is more suitable than vaccination to prevent neonatal diarrheal diseases. Egg yolk immunoglobulin (IgY) from chickens immunized with PEDV antigen has been administered to piglets, and the results showed that IgY is able to reduce mortality in piglets after challenge exposures [
20]. Although IgY prepared from immunized chickens has the characteristics of high affinity, a large yield, and a simple isolation process, the production cost of high-quality IgY for large-scale applications still remains higher than that of commercial antibiotics or vaccine [
43]. Since IgY is of chicken origin, it might cause immunogenic side effects in the host.
In this study, scFvs was prepared from pigs immunized or infected with PEDV. Since the host immune system was stimulated by the specific pathogen in PEDV-induced pigs, the abundant and mature antibodies were biased against PEDV [
44]. After four rounds of biopanning, three scFvs with high affinity to PEDV were successfully screened. The predicted amino acid sequences of these two scFvs were aligned and analyzed. The results showed that the variation in the complementary determining regions (CDRs) were significantly greater than in the framework regions (FRs). The lengths of CDR3 in the V
L and V
H were not equal among the three scFvs, indicating the presence of amino acid insertions or deletions in these regions. Since CDRs contribute to the specificity of binding to a specific epitope, differences in the diversity of CDRs in the V
L and V
H domains may reflect the different binding epitopes of these scFvs.
The synergistic and/or additive effects of a cocktail of neutralizing antibodies that recognize different epitopes have been reported in numerous studies on different viruses [
45]. According to the “occupancy” model (multihit theory) of neutralization, procuring a sufficient antibody density on the surface of a viral pathogen is a crucial and pivotal factor in viral neutralization along with recognition of the neutralizing epitopes [
46]. This procedure may not be feasible in many cases where a single epitope is recognized, but it can be achieved when more than one epitope is recognized on the viral surface. In this study, we mixed three scFv in a cocktail to investigate whether the combination of these scFvs would have a better effect on the neutralization of viral infection compared with their use alone. The results showed that virus neutralization titer of a cocktail of scFvs was 3.125 μg/mL and neutralization titer of the individual scFv was 6.25 μg/mL or 12.5 μg/mL. Thus, a cocktail of three scFvs was used in the animal experiment.
Most monoclonal antibodies or scFvs that demonstrate a neutralization effect target viral surface glycoproteins owing to their important role in viral adherence to host cell receptors. We analyzed whether PZZ 21, PZZ 24 and PZZ 35 bind to PEDV spike protein to inhibit viral infection. The IFA assay and additive ELISA confirmed that all three scFvs reacted with different epitopes of S1 the domain but not the S2 domain. Previous reports have shown that the main neutralizing epitopes of S protein are located in the S1 domain [
47,
48], and two neutralizing domains have been identified in the S1 region, including NTD/S0 [
49], COE (aa 499–636) [
50], and S1D (aa 636–789) [
48]. The exact epitopes recognized by these scFvs need further elucidation by pepscan ELISAs. Previous studies have reported that the major genetic variations of PEDV are concentrated in the S1 portion of the S gene, especially in the N-terminus of the S1 gene [
51]. Even a single amino acid mutation in this region can change the structure of the spike protein, which may explain why current vaccine strains fail to protect piglets from new emerging variant strains [
52]. Our study has confirmed that these scFvs neutralize PEDV by targeting to the S1 domain. Whether these three scFvs also influence PEDV CV777 replication, or just specifically recognize unique epitope on the variant strain, this still need further study.
After confirming that scFvs could neutralize the PEDV infection in Vero E6 cells, we subsequently tested the prophylactic efficacy of scFvs in neonatal piglets. Piglets inoculated with a cocktail of scFvs survived after challenge with virulent PEDV, and piglets treated with PBS followed by PEDV infection showed 100% mortality, suggesting that scFvs provides effective passive immunity to viral infection. Piglets treated with scFvs showed no to moderate diarrhea, and the intestinal mucosa remained intact under histological examination, indicating the scFvs could block the virus from invading the small intestine. The effect of scFvs is slightly influenced by the low pH and enzymatic degradation in the gastrointestinal (GI) tract after oral administration. To solve these problems, biodegradable polymeric nanoparticulates such as chitosan and its derivatives that can protect proteins from degradation may be a prospective strategy for oral delivery [
53]. Previous studies have demonstrated the possibility of chitosan-based nanoparticle as carriers for the oral delivery of antimicrobial peptide [
54], bacteriophages [
55], antigens [
56] and small interfering RNAs (siRNAs) [
57]. Currently, we are focusing on the selection of suitable chitosan derivatives to protect scFvs from enzymatic degradation and modulate scFvs pharmacokinetics to improve their efficacy.
In summary, three scFvs specifically targeting PEDV were generated from porcine PBLs. These scFvs showed nontoxicity in vitro and could neutralize PEDV infection by binding to different epitopes of the spike protein. Animal experiments confirmed the protective efficiency of scFvs in piglets against PEDV challenge. Field application demonstrated that scFvs oral administration could reduce the mortality of piglets. To the best of our knowledge, this is the first report to examine the antiviral activity of porcine origin scFvs against PEDV. Our results provide a basis for the development of scFv-based drugs for the treatment and prevention of PEDV-induced diarrhea.