Identification of the Potential Virulence Factors and RNA Silencing Suppressors of Mulberry Mosaic Dwarf-Associated Geminivirus
Abstract
1. Introduction
2. Materials and Methods
2.1. Plant Materials
2.2. Generation of Plasmid Constructs
2.3. Agrobacterium-Mediated Virus Inoculation and Transient Gene Expression
2.4. RNA Extraction and Analysis
2.5. Protein Extraction and Western Blot Analysis
2.6. Laser-Scanning Confocal Microscopy
3. Results
3.1. Identification of Virulence Factors Encoded by MMDaV
3.2. Identification of Suppressors of Local RNA Silencing
3.3. MMDaV V2 Does Not Suppress Cell-to-Cell Movement of Silencing Signal
3.4. MMDaV V2 Inhibits Systemic Silencing of GFP
3.5. The Basic Motif Is Required for MMDaV V2 Subnuclear Foci Localization and PTGS Suppression
4. Discussion
Supplementary Materials
Author Contributions
Acknowledgments
Conflicts of Interest
References
- Calil, I.P.; Fontes, E.P.B. Plant immunity against viruses: Antiviral immune receptors in focus. Ann. Bot. 2017, 119, 711–723. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhao, J.H.; Hua, C.L.; Fang, Y.Y.; Guo, H.S. The dual edge of RNA silencing suppressors in the virus-host interactions. Curr. Opin. Virol. 2016, 17, 39–44. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pumplin, N.; Voinnet, O. RNA silencing suppression by plant pathogens: Defence, counter-defence and counter-counter-defence. Nat. Rev. Microbiol. 2013, 11, 745–760. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Alcaide-Loridan, C.; Jupin, I. Ubiquitin and plant viruses, let’s play together! Plant Physiol. 2012, 160, 72–82. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Leary, A.Y.; Sanguankiattichai, N.; Duggan, C.; Tumtas, Y.; Pandey, P.; Segretin, M.E.; Linares, J.S.; Savage, Z.D.; Yow, R.J.; Bozkurt, T.O. Modulation of plant autophagy during pathogen attack. J. Exp. Bot. 2018, 69, 1325–1333. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Csorba, T.; Kontra, L.; Burgyan, J. Viral silencing suppressors: Tools forged to fine-tune host-pathogen coexistence. Virology 2015, 479–480, 85–103. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Nakahara, K.S.; Masuta, C. Interaction between viral RNA silencing suppressors and host factors in plant immunity. Curr. Opin. Plant Biol. 2014, 20, 88–95. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Baulcombe, D.C.; Molnar, A. Crystal structure of p19--a universal suppressor of RNA silencing. Trends Biochem. Sci. 2004, 29, 279–281. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Vargason, J.M.; Szittya, G.; Burgyan, J.; Hall, T.M. Size selective recognition of siRNA by an RNA silencing suppressor. Cell 2003, 115, 799–811. [Google Scholar] [CrossRef] [Scilit]
- Ye, K.; Malinina, L.; Patel, D.J. Recognition of small interfering RNA by a viral suppressor of RNA silencing. Nature 2003, 426, 874–878. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Valli, A.A.; Gallo, A.; Rodamilans, B.; Lopez-Moya, J.J.; Garcia, J.A. The HCPro from the Potyviridae family: An enviable multitasking Helper Component that every virus would like to have. Mol. Plant Pathol. 2018, 19, 744–763. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kasschau, K.D.; Xie, Z.; Allen, E.; Llave, C.; Chapman, E.J.; Krizan, K.A.; Carrington, J.C. P1/HC-Pro, a viral suppressor of RNA silencing, interferes with Arabidopsis development and miRNA unction. Dev. Cell 2003, 4, 205–217. [Google Scholar] [CrossRef] [Scilit]
- Reed, J.C.; Kasschau, K.D.; Prokhnevsky, A.I.; Gopinath, K.; Pogue, G.P.; Carrington, J.C.; Dolja, V.V. Suppressor of RNA silencing encoded by Beet yellows virus. Virology 2003, 306, 203–209. [Google Scholar] [CrossRef] [Scilit]
- Baumberger, N.; Tsai, C.H.; Lie, M.; Havecker, E.; Baulcombe, D.C. The Polerovirus silencing suppressor P0 targets ARGONAUTE proteins for degradation. Curr. Biol. 2007, 17, 1609–1614. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bortolamiol, D.; Pazhouhandeh, M.; Marrocco, K.; Genschik, P.; Ziegler-Graff, V. The Polerovirus F box protein P0 targets ARGONAUTE1 to suppress RNA silencing. Curr. Biol. 2007, 17, 1615–1621. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, X.; Yuan, Y.R.; Pei, Y.; Lin, S.S.; Tuschl, T.; Patel, D.J.; Chua, N.H. Cucumber mosaic virus-encoded 2b suppressor inhibits Arabidopsis Argonaute1 cleavage activity to counter plant defense. Genes Dev. 2006, 20, 3255–3268. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Duan, C.G.; Fang, Y.Y.; Zhou, B.J.; Zhao, J.H.; Hou, W.N.; Zhu, H.; Ding, S.W.; Guo, H.S. Suppression of Arabidopsis ARGONAUTE1-mediated slicing, transgene-induced RNA silencing, and DNA methylation by distinct domains of the Cucumber mosaic virus 2b protein. Plant Cell 2012, 24, 259–274. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Deleris, A.; Gallego-Bartolome, J.; Bao, J.; Kasschau, K.D.; Carrington, J.C.; Voinnet, O. Hierarchical action and inhibition of plant Dicer-like proteins in antiviral defense. Science 2006, 313, 68–71. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Azevedo, J.; Garcia, D.; Pontier, D.; Ohnesorge, S.; Yu, A.; Garcia, S.; Braun, L.; Bergdoll, M.; Hakimi, M.A.; Lagrange, T.; et al. Argonaute quenching and global changes in Dicer homeostasis caused by a pathogen-encoded GW repeat protein. Genes Dev. 2010, 24, 904–915. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wu, Q.; Luo, Y.; Lu, R.; Lau, N.; Lai, E.C.; Li, W.X.; Ding, S.W. Virus discovery by deep sequencing and assembly of virus-derived small silencing RNAs. Proc. Natl. Acad. Sci. USA 2010, 107, 1606–1611. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, S.; Shen, P.; Li, M.; Tian, X.; Zhou, C.; Cao, M. Discovery of a novel geminivirus associated with camellia chlorotic dwarf disease. Arch. Virol. 2018, 163, 1709–1712. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Loconsole, G.; Saldarelli, P.; Doddapaneni, H.; Savino, V.; Martelli, G.P.; Saponari, M. Identification of a single-stranded DNA virus associated with citrus chlorotic dwarf disease, a new member in the family Geminiviridae. Virology 2012, 432, 162–172. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Al Rwahnih, M.; Dave, A.; Anderson, M.M.; Rowhani, A.; Uyemoto, J.K.; Sudarshana, M.R. Association of a DNA virus with grapevines affected by red blotch disease in California. Phytopathology 2013, 103, 1069–1076. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liang, P.; Navarro, B.; Zhang, Z.; Wang, H.; Lu, M.; Xiao, H.; Wu, Q.; Zhou, X.; Di Serio, F.; Li, S. Identification and characterization of a novel geminivirus with a monopartite genome infecting apple trees. J. Gen. Virol. 2015, 96, 2411–2420. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ma, Y.; Navarro, B.; Zhang, Z.; Lu, M.; Zhou, X.; Chi, S.; Di Serio, F.; Li, S. Identification and molecular characterization of a novel monopartite geminivirus associated with mulberry mosaic dwarf disease. J. Gen. Virol. 2015, 96, 2421–2434. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zerbini, F.M.; Briddon, R.W.; Idris, A.; Martin, D.P.; Moriones, E.; Navas-Castillo, J.; Rivera-Bustamante, R.; Roumagnac, P.; Varsani, A.; Ictv Report Consortium. ICTV Virus Taxonomy Profile: Geminiviridae. J. Gen. Virol. 2017, 98, 131–133. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hanley-Bowdoin, L.; Bejarano, E.R.; Robertson, D.; Mansoor, S. Geminiviruses: Masters at redirecting and reprogramming plant processes. Nat. Rev. Microbiol. 2013, 11, 777–788. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Raja, P.; Wolf, J.N.; Bisaro, D.M. RNA silencing directed against geminiviruses: Post-transcriptional and epigenetic components. Biochim. Biophys. Acta 2010, 1799, 337–351. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ruiz, M.T.; Voinnet, O.; Baulcombe, D.C. Initiation and maintenance of virus-induced gene silencing. Plant Cell 1998, 10, 937–946. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cai, X.Z.; Zhou, X.; Xu, Y.P.; Joosten, M.H.; de Wit, P.J. Cladosporium fulvum CfHNNI1 induces hypersensitive necrosis, defence gene expression and disease resistance in both host and nonhost plants. Plant Mol. Biol. 2007, 64, 89–101. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yang, X.; Guo, W.; Ma, X.; An, Q.; Zhou, X. Molecular characterization of tomato leaf curl China virus, infecting tomato plants in China, and functional analyses of its associated betasatellite. Appl. Environ. Microbiol. 2011, 77, 3092–3101. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hamilton, A.; Voinnet, O.; Chappell, L.; Baulcombe, D. Two classes of short interfering RNA in RNA silencing. EMBO J. 2002, 21, 4671–4679. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Xiong, R.; Wu, J.; Zhou, Y.; Zhou, X. Characterization and subcellular localization of an RNA silencing suppressor encoded by Rice stripe tenuivirus. Virology 2009, 387, 29–40. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Deng, M.; Bragg, J.N.; Ruzin, S.; Schichnes, D.; King, D.; Goodin, M.M.; Jackson, A.O. Role of the sonchus yellow net virus N protein in formation of nuclear viroplasms. J. Virol. 2007, 81, 5362–5374. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Johansen, L.K.; Carrington, J.C. Silencing on the spot. Induction and suppression of RNA silencing in the Agrobacterium-mediated transient expression system. Plant Physiol. 2001, 126, 930–938. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Himber, C.; Dunoyer, P.; Moissiard, G.; Ritzenthaler, C.; Voinnet, O. Transitivity-dependent and -independent cell-to-cell movement of RNA silencing. EMBO J. 2003, 22, 4523–4533. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cui, X.F.; Li, G.X.; Wang, D.W.; Hu, D.W.; Zhou, X.P. A begomovirus DNAβ-encoded protein binds DNA, functions as a suppressor of RNA silencing, and targets the cell nucleus. J. Virol. 2005, 79, 10764–10775. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Feng, M.; Zuo, D.; Jiang, X.; Li, S.; Chen, J.; Jiang, L.; Zhou, X.; Jiang, T. Identification of Strawberry vein banding virus encoded P6 as an RNA silencing suppressor. Virology 2018, 520, 103–110. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Perez-Canamas, M.; Hernandez, C. New insights into the nucleolar localization of a plant RNA virus-encoded protein that acts in both RNA packaging and RNA silencing suppression: Involvement of importins alpha and relevance for viral infection. Mol. Plant Microbe Interact. 2018. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sahu, P.P.; Sharma, N.; Puranik, S.; Muthamilarasan, M.; Prasad, M. Involvement of host regulatory pathways during geminivirus infection: A novel platform for generating durable resistance. Funct. Integr. Genomics 2014, 14, 47–58. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, F.; Huang, C.; Li, Z.; Zhou, X. Suppression of RNA silencing by a plant DNA virus satellite requires a host calmodulin-like protein to repress RDR6 expression. PLoS Pathog. 2014, 10, e1003921. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, J.; Dong, J.; Xu, Y.; Wu, J. V2 protein encoded by Tomato yellow leaf curl China virus is an RNA silencing suppressor. Virus Res. 2012, 163, 51–58. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Amin, I.; Hussain, K.; Akbergenov, R.; Yadav, J.S.; Qazi, J.; Mansoor, S.; Hohn, T.; Fauquet, C.M.; Briddon, R.W. Suppressors of RNA silencing encoded by the components of the cotton leaf curl begomovirus-betasatellite complex. Mol. Plant Microbe Interact. 2011, 24, 973–983. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sharma, P.; Ikegami, M. Tomato leaf curl Java virus V2 protein is a determinant of virulence, hypersensitive response and suppression of posttranscriptional gene silencing. Virology 2010, 396, 85–93. [Google Scholar] [CrossRef] [PubMed]
- Sharma, P.; Ikegami, M.; Kon, T. Identification of the virulence factors and suppressors of posttranscriptional gene silencing encoded by Ageratum yellow vein virus, a monopartite begomovirus. Virus Res. 2010, 149, 19–27. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zrachya, A.; Glick, E.; Levy, Y.; Arazi, T.; Citovsky, V.; Gafni, Y. Suppressor of RNA silencing encoded by Tomato yellow leaf curl virus-Israel. Virology 2007, 358, 159–165. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Glick, E.; Zrachya, A.; Levy, Y.; Mett, A.; Gidoni, D.; Belausov, E.; Citovsky, V.; Gafni, Y. Interaction with host SGS3 is required for suppression of RNA silencing by tomato yellow leaf curl virus V2 protein. Proc. Natl. Acad. Sci. USA 2008, 105, 157–161. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Luna, A.P.; Morilla, G.; Voinnet, O.; Bejarano, E.R. Functional analysis of gene-silencing suppressors from tomato yellow leaf curl disease viruses. Mol. Plant Microbe. Interact. 2012, 25, 1294–1306. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fukunaga, R.; Doudna, J.A. dsRNA with 5′ overhangs contributes to endogenous and antiviral RNA silencing pathways in plants. EMBO J. 2009, 28, 545–555. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Luna, A.P.; Rodriguez-Negrete, E.A.; Morilla, G.; Wang, L.; Lozano-Duran, R.; Castillo, A.G.; Bejarano, E.R. V2 from a curtovirus is a suppressor of post-transcriptional gene silencing. J. Gen. Virol. 2017, 98, 2607–2614. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Peragine, A.; Yoshikawa, M.; Wu, G.; Albrecht, H.L.; Poethig, R.S. SGS3 and SGS2/SDE1/RDR6 are required for juvenile development and the production of trans-acting siRNAs in Arabidopsis. Genes Dev. 2004, 18, 2368–2379. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Curaba, J.; Chen, X. Biochemical activities of Arabidopsis RNA-dependent RNA polymerase 6. J. Biol. Chem. 2008, 283, 3059–3066. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mourrain, P.; Beclin, C.; Elmayan, T.; Feuerbach, F.; Godon, C.; Morel, J.B.; Jouette, D.; Lacombe, A.M.; Nikic, S.; Picault, N.; et al. Arabidopsis SGS2 and SGS3 genes are required for posttranscriptional gene silencing and natural virus resistance. Cell 2000, 101, 533–542. [Google Scholar] [CrossRef] [Scilit]
- Haas, G.; Azevedo, J.; Moissiard, G.; Geldreich, A.; Himber, C.; Bureau, M.; Fukuhara, T.; Keller, M.; Voinnet, O. Nuclear import of CaMV P6 is required for infection and suppression of the RNA silencing factor DRB4. EMBO J. 2008, 27, 2102–2112. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gonzalez, I.; Martinez, L.; Rakitina, D.V.; Lewsey, M.G.; Atencio, F.A.; Llave, C.; Kalinina, N.O.; Carr, J.P.; Palukaitis, P.; Canto, T. Cucumber mosaic virus 2b protein subcellular targets and interactions: Their significance to RNA silencing suppressor activity. Mol. Plant Microbe Interact. 2010, 23, 294–303. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Du, Z.; Chen, A.; Chen, W.; Liao, Q.; Zhang, H.; Bao, Y.; Roossinck, M.J.; Carr, J.P. Nuclear-cytoplasmic partitioning of cucumber mosaic virus protein 2b determines the balance between its roles as a virulence determinant and an RNA-silencing suppressor. J. Virol. 2014, 88, 5228–5241. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Aguilar, E.; Almendral, D.; Allende, L.; Pacheco, R.; Chung, B.N.; Canto, T.; Tenllado, F. The P25 protein of potato virus X (PVX) is the main pathogenicity determinant responsible for systemic necrosis in PVX-associated synergisms. J. Virol. 2015, 89, 2090–2103. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Landeo-Rios, Y.; Navas-Castillo, J.; Moriones, E.; Canizares, M.C. The heterologous expression of the p22 RNA silencing suppressor of the Crinivirus tomato chlorosis virus from tobacco rattle virus and potato virus X enhances disease severity but does not complement suppressor-defective mutant viruses. Viruses 2017, 9, 358. [Google Scholar] [CrossRef] [Scilit] [PubMed]






| Primers | Sequence (5′–3′) |
|---|---|
| Primers used for the construction of recombinant PVX vector or pCHF3-based binary vectors | |
| V1/SmaI ClaI-F | CCCGGGATCGATatggtgattaccaggagctc |
| V1/SalI-R | GTCGACttattctgcgtcataaaaataaac |
| V2/BamHI ClaI-F | GGATCCATCGATatgtctttgtggagtaccaaattag |
| V2/SalI-R | GTCGACttaattccaaatgtgccacg |
| V3/BamHI ClaI-F | GGATCCATCGATatgagctataaatacccccctgc |
| V3/SalI-R | GTCGACctacggcactgagtaaggtg |
| V4/KpnI ClaI-F | GGTACCATCGATatgttttcaaggagaaaaaaag |
| V4/SalI-R | GTCGACctagtttattacatgtctgctag |
| V5/KpnI ClaI-F | GGTACCATCGATatgccggaagctctcgacgattg |
| V5/SalI-R | GTCGACctaatctcctctgcgtttctttaag |
| C1C2/BamHI ClaI-F | GGATCCATCGATatggcttcaagttctaacttcag |
| RepA/SalI-R | GTCGACctaaagatctggcccattgc |
| Rep/SalI-R | GTCGACttaatagaatttatcactagcagac |
| Primers used to generate V2 mutant | |
| V2dm61-76aa/F | gctgcagtaaatggtgattaccagg |
| V2dm61-76aa/R | gcactgagtaaggtggaccaagtgg |
© 2018 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Yang, X.; Ren, Y.; Sun, S.; Wang, D.; Zhang, F.; Li, D.; Li, S.; Zhou, X. Identification of the Potential Virulence Factors and RNA Silencing Suppressors of Mulberry Mosaic Dwarf-Associated Geminivirus. Viruses 2018, 10, 472. https://doi.org/10.3390/v10090472
Yang X, Ren Y, Sun S, Wang D, Zhang F, Li D, Li S, Zhou X. Identification of the Potential Virulence Factors and RNA Silencing Suppressors of Mulberry Mosaic Dwarf-Associated Geminivirus. Viruses. 2018; 10(9):472. https://doi.org/10.3390/v10090472
Chicago/Turabian StyleYang, Xiuling, Yanxiang Ren, Shaoshuang Sun, Dongxue Wang, Fanfan Zhang, Dawei Li, Shifang Li, and Xueping Zhou. 2018. "Identification of the Potential Virulence Factors and RNA Silencing Suppressors of Mulberry Mosaic Dwarf-Associated Geminivirus" Viruses 10, no. 9: 472. https://doi.org/10.3390/v10090472
APA StyleYang, X., Ren, Y., Sun, S., Wang, D., Zhang, F., Li, D., Li, S., & Zhou, X. (2018). Identification of the Potential Virulence Factors and RNA Silencing Suppressors of Mulberry Mosaic Dwarf-Associated Geminivirus. Viruses, 10(9), 472. https://doi.org/10.3390/v10090472

