High Risk Blueberry Viruses by Region in North America; Implications for Certification, Nurseries, and Fruit Production
Abstract
1. Introduction
2. Materials and Methods
2.1. Plant Material
2.2. Nucleic Acid Extractions
2.3. Detection by ELISA
2.4. Detection by PCR and RT-PCR
3. Results and Discussion
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Strik, B.C. Blueberry production trends in North America, past and future. In The Blueberries—For Growers, Gardeners, and Promoters; Childers, N.F., Lyrene, P.M., Eds.; Horticultural Publications: Gainesville, FL, USA, 2006. [Google Scholar]
- Retamales, J.B.; Hancock, J.F. Blueberries; CAB International: Cambridge, MA, USA, 2012; 323p. [Google Scholar]
- Food and Agriculture Organization of the United Nations (FAO). World Blueberry Production. 2018. Available online: http://www.fao.org/faostat/en/#data/QC/visualize (accessed on 8 May 2018).
- Brazelton, C. An Overview of Global Blueberry Production in 2016. 2017. Available online: http://www.producereport.com/article/overview-global-blueberry-production-2016 (accessed on 9 May 2018).
- USDA National Agricultural Statistics Service. U.S. Blueberry Production. 2018. Available online: https://www.nass.usda.gov/Statistics_by_Subject/index.php?sector=CROPS (accessed on 8 May 2018).
- Gergerich, R.C.; Welliver, R.; Gettys, S.; Osterbauer, N.K.; Kamenidou, S.; Martin, R.R.; Golino, D.; Eastwell, K.; Fuchs, M.; Vidalakis, G.; et al. Safeguarding fruit crops in the age of agricultural globalization. Plant Dis. 2015, 99, 176–187. [Google Scholar] [CrossRef] [Scilit]
- Martin, R.R.; Constable, F.; Tzanetakis, I.E. Quarantine regulations and the impact of modern detection methods. Annu. Rev. Phytopathol. 2016, 54, 189–205. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Polashock, J.J.; Caruso, F.L.; Averill, A.L.; Schilder, A.C. (Eds.) Compendium of Blueberry, Cranberry, and Lingonberry Diseases and Pests, 2nd ed.; APS Press: St. Paul, MN, USA, 2017; 231p. [Google Scholar]
- Polashock, J.J.; Hillman, B.I. Scorch. In Compendium of Blueberry, Cranberry, and Lingonberry Diseases and Pests, 2nd ed.; Polashock, J.J., Caruso, F.L., Averill, A.L., Schilder, A.C., Eds.; APS Press: St. Paul, MN, USA, 2017; pp. 70–72. [Google Scholar]
- Martin, R.R.; Tzanetakis, I.E. Mosaic. In Compendium of Blueberry, Cranberry, and Lingonberry Diseases and Pests, 2nd ed.; Polashock, J.J., Caruso, F.L., Averill, A.L., Schilder, A.C., Eds.; APS Press: St. Paul, MN, USA, 2017; p. 64. [Google Scholar]
- Tzanetakis, I.E.; Martin, R.R. Blueberry virus A. In Compendium of Blueberry, Cranberry, and Lingonberry Diseases and Pests, 2nd ed.; Polashock, J.J., Caruso, F.L., Averill, A.L., Schilder, A.C., Eds.; APS Press: St. Paul, MN, USA, 2017; p. 60. [Google Scholar]
- Isogai, M.; Muramatu, S.; Watanabe, M.; Yoshikawa, N. Complete nucleotide sequence and latency of a novel blueberry-infecting closterovirus. J. Gen. Plant Pathol. 2013, 79, 123–127. [Google Scholar] [CrossRef] [Scilit]
- Martin, R.R.; Polashock, J.J.; Tzanetakis, I.E. New and emerging viruses of blueberry and cranberry. Viruses 2012, 4, 2831–2852. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Spiegel, S.; Martin, R.R. Improved detection of potato leafroll virus in dormant potato tubers and microtubers by the polymerase chain reaction and ELISA. Ann. Appl. Biol. 1993, 122, 493–500. [Google Scholar] [CrossRef] [Scilit]
- Tzanetakis, I.E.; Postman, J.D.; Martin, R.R. Identification, detection and transmission of a new Vitivirus from Mentha. Arch. Virol. 2007, 152, 2027–2033. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Shands, A.C.; Crandall, S.G.; Miles, T.D. First report of the ability of Olpidium virulentus to vector Blueberry mosaic associated virus (BlMaV) on southern highbush blueberry. Plant Dis. 2017, 101, 1683. [Google Scholar] [CrossRef] [Scilit]
- Martin, R.R.; Bristow, P.R. A carlavirus associated with blueberry scorch disease. Phytopathology 1988, 78, 1636–1640. [Google Scholar] [CrossRef] [Scilit]
- Martin, R.R.; Zhou, J.; Tzanetakis, I.E. Blueberry latent virus: An amalgam of Partitiviridae and Totiviridae. Virus Res. 2011, 155, 175–180. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Diaz-Lara, A.; Martin, R.R. Blueberry fruit drop-associated virus: A new member of the family Caulimoviridae isolated from blueberry exhibiting fruit-drop symptoms. Plant Dis. 2016, 100, 2211–2214. [Google Scholar] [CrossRef] [Scilit]
- Thekke-Veetil, T.; Polashock, J.J.; Marn, M.V.; Plesko, I.M.; Schilder, A.C.; Keller, K.E.; Martin, R.R.; Tzanetakis, I.E. Population structure of blueberry mosaic associated virus: Evidence of genetic exchange in geographically distinct isolates. Virus Res. 2015, 201, 79–84. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Quito-Avila, D.F.; Brannen, P.M.; Cline, W.O.; Harmon, P.F.; Martin, R.R. Genetic characterization of Blueberry necrotic ring blotch virus, a novel RNA virus with unique genetic features. J. Gen. Virol. 2013, 94, 1426–1434. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Polashock, J.J.; Ehlenfeldt, M.K.; Crouch, J.A. Molecular detection and discrimination of blueberry red ringspot virus strains causing disease in cultivated blueberry and cranberry. Plant Dis. 2009, 93, 727–733. [Google Scholar] [CrossRef] [Scilit]
- Thekke-Veetil, T.; Ho, T.; Keller, K.E.; Martin, R.R.; Tzanetakis, I.E. A new ophiovirus is associated with blueberry mosaic disease. Virus Res. 2014, 189, 92–96. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Varney, E.H. Mosaic and shoestring, virus diseases of cultivated blueberry in New Jersey. Phytopathology 1957, 47, 307–309. [Google Scholar]
- Hutchinson, M.T.; Varney, T.H. Ringspot, a virus disease of cultivated blueberry. Plant Dis. Rep. 1954, 38, 260–263. [Google Scholar]
- Martin, R.R.; MacFarlane, S.; Sabanadzovic, S.; Quito, D.; Poudel, B.; Tzanetakis, I.E. Viruses and virus diseases of Rubus. Plant Dis. 2013, 97, 169–182. [Google Scholar] [CrossRef] [Scilit]
- Eck, P.; Childers, N.F. The blueberry industry. In Blueberry Culture; Eck, P., Childers, N.F., Eds.; Rutgers University Press: New Brunswick, NJ, USA, 1966; pp. 3–13. [Google Scholar]
- Childress, A.M.; Ramsdell, D.C. Bee-mediated transmission of blueberry leaf mottle virus via infected pollen in highbush blueberry. Phytopathology 1987, 77, 167–172. [Google Scholar] [CrossRef] [Scilit]
- Finn, C.E.; Mackey, T.A.; Postman, J.D.; Martin, R.R. Identifying blueberry germplasm that is slow to get Blueberry shock virus in the Pacific Northwest United States. Acta Hortic. 2017, 1180, 423–429. [Google Scholar] [CrossRef] [Scilit]
- Kim, K.S.; Ramsdell, D.C.; Gillett, J.M.; Fulton, J.P. Virions and ultrastructural changes associated with Blueberry Red Ringspot Disease. Phytopathology 1981, 71, 673–678. [Google Scholar] [CrossRef] [Scilit]
- MacDonald, S.G.; Martin, R.R.; Bristow, P.R. Characterization of an ilarvirus associated with a necrotic shock reaction in blueberry. Phytopathology 1991, 81, 201–214. [Google Scholar] [CrossRef] [Scilit]
- Food and Agriculture Organization of the United Nations (FAO). International Standards for Phytosanitary Measures, ISPM No. 31, Methodologies for Sampling of Consignments; Produced by the Secretariat of the International Plant Protection Convention; FAO: Rome, Italy, 2008; 19p. [Google Scholar]
- Poudyal, S.D.; Fraley, C.; Osterbauer, N.K. Surveying for virus-vectoring nematodes in container-grown blueberry plants in Oregon. Plant Health Prog. 2016, 17, 175–176. [Google Scholar]

| Virus | Primer Pair | Annealing Temp | Amplicon Size (Ref) 1 |
|---|---|---|---|
| BlLV | F: CTTATCAGAGCTTCTTCAGACTGG R: TCGTCACCCGCACATTTC | 55 | 391 [18] |
| BFDaV | F: GACAACAGCATCTACATCTCTGC R: GGTCGTTCTACCACGTTTCTG | 53 | 395 [19] |
| BlMaV | F: CCWGTATCAAGCATAGTYACAAG R: AAGAAGGTRGTGATTGAGA | 58 | 254 [20] |
| BNRBV | F: CCAGTTTGGAGGAATTGCAT R: GCGTTTCAGCACCACTAAC | 55 | 432 [21] |
| BRRV | F: ATCAGTCCCAGAAGAAAAGAAGTA R: TCCGAAAAATAGATAGTGTCAGC | 56 | 548 [22] |
| BVA | F: AACTCATGGTTAAGCGTGAG R: AGTCCTGAGACTTATCGAAC | 55 | 270 [12] |
| NADH (β) | AGTAGATGCTATCACACATACAAT GGACTCCTGACGTATACGAAGGATC (note DNA has intron and yields ~1100 bp band) | 55 | 721 [15] |
| Acronym 1 | Genus | Transmission | Laboratory Detection | California | Regional Occurrence | Positives # | |||
|---|---|---|---|---|---|---|---|---|---|
| Northwest | Southeast | Northeast | Midwest | ||||||
| BFDaV | ? | ? | RT-PCR??? | 0/148 | 64/1244 * | 0/221 | 0/555 | 0/411 | 64 |
| BlLV | Amalgavirus | pollen/seed ◊ | RT-PCR | 5/148 | 22/1244 | 15/221 | 48/555 | 2/411 | 92 |
| BLMoV | Nepovirus | nematodes? □◊ | ELISA | 0/148 | 0/1244 | 0/221 | 18/555 | 12/411 | 30 |
| BlMaV | Ophiovirus | Olpidium/? | RT-PCR | 9/148 | 18/1244 | 2/221 | 20/555 | 35/411 | 84 |
| BNRBV | Blunervirus | eriophyid mites? | RT-PCR | 0/148 | 0/1244 | 26/221 | 0/555 | 0/411 | 26 |
| BRRV | Soymovirus | ? | PCR | 0/148 | 0/1244 | 46/221 | 1/555 | 0/411 | 47 |
| BlScV | Carlavirus | aphids/non-persistent | ELISA/RT-PCR | 0/148 | 43/1244 | 0/221 | 70/555 | 1/411 | 114 |
| BlShV | Ilarvirus | pollen/seed ◊ | ELISA/RT-PCR | 8/148 | 558/1244 | 0/221 | 0/555 | 0/411 | 566 |
| BlSSV | Sobemovirus | aphids/non-persistent | ELISA | 0/148 | 0/1244 | 0/221 | 4/555 | 49/411 | 53 |
| BVA | Closterovirus | aphids/Semi-persistent? | RT-PCR | 0/148 | 0/1244 | 0/221 | 29/555 | 90/411 | 119 |
| PRMV | Nepovirus | nematodes/persistent □◊ | ELISA | 0/148 | 0/1244 | 0/221 | 2/555 | 6/411 | 8 |
| TRSV | Nepovirus | nematodes/persistent □◊ | ELISA | 0/148 | 0/1244 | 0/221 | 42/555 | 4/411 | 46 |
| ToRSV | Nepovirus | nematodes/persistent □◊ | ELISA | 0/148 | 5/1244 | 0/221 | 6/555 | 13/411 | 24 |
© 2018 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Martin, R.R.; Tzanetakis, I.E. High Risk Blueberry Viruses by Region in North America; Implications for Certification, Nurseries, and Fruit Production. Viruses 2018, 10, 342. https://doi.org/10.3390/v10070342
Martin RR, Tzanetakis IE. High Risk Blueberry Viruses by Region in North America; Implications for Certification, Nurseries, and Fruit Production. Viruses. 2018; 10(7):342. https://doi.org/10.3390/v10070342
Chicago/Turabian StyleMartin, Robert R., and Ioannis E. Tzanetakis. 2018. "High Risk Blueberry Viruses by Region in North America; Implications for Certification, Nurseries, and Fruit Production" Viruses 10, no. 7: 342. https://doi.org/10.3390/v10070342
APA StyleMartin, R. R., & Tzanetakis, I. E. (2018). High Risk Blueberry Viruses by Region in North America; Implications for Certification, Nurseries, and Fruit Production. Viruses, 10(7), 342. https://doi.org/10.3390/v10070342

