High Risk Blueberry Viruses by Region in North America; Implications for Certification, Nurseries, and Fruit Production
Abstract
:1. Introduction
2. Materials and Methods
2.1. Plant Material
2.2. Nucleic Acid Extractions
2.3. Detection by ELISA
2.4. Detection by PCR and RT-PCR
3. Results and Discussion
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Strik, B.C. Blueberry production trends in North America, past and future. In The Blueberries—For Growers, Gardeners, and Promoters; Childers, N.F., Lyrene, P.M., Eds.; Horticultural Publications: Gainesville, FL, USA, 2006. [Google Scholar]
- Retamales, J.B.; Hancock, J.F. Blueberries; CAB International: Cambridge, MA, USA, 2012; 323p. [Google Scholar]
- Food and Agriculture Organization of the United Nations (FAO). World Blueberry Production. 2018. Available online: http://www.fao.org/faostat/en/#data/QC/visualize (accessed on 8 May 2018).
- Brazelton, C. An Overview of Global Blueberry Production in 2016. 2017. Available online: http://www.producereport.com/article/overview-global-blueberry-production-2016 (accessed on 9 May 2018).
- USDA National Agricultural Statistics Service. U.S. Blueberry Production. 2018. Available online: https://www.nass.usda.gov/Statistics_by_Subject/index.php?sector=CROPS (accessed on 8 May 2018).
- Gergerich, R.C.; Welliver, R.; Gettys, S.; Osterbauer, N.K.; Kamenidou, S.; Martin, R.R.; Golino, D.; Eastwell, K.; Fuchs, M.; Vidalakis, G.; et al. Safeguarding fruit crops in the age of agricultural globalization. Plant Dis. 2015, 99, 176–187. [Google Scholar] [CrossRef]
- Martin, R.R.; Constable, F.; Tzanetakis, I.E. Quarantine regulations and the impact of modern detection methods. Annu. Rev. Phytopathol. 2016, 54, 189–205. [Google Scholar] [CrossRef] [PubMed]
- Polashock, J.J.; Caruso, F.L.; Averill, A.L.; Schilder, A.C. (Eds.) Compendium of Blueberry, Cranberry, and Lingonberry Diseases and Pests, 2nd ed.; APS Press: St. Paul, MN, USA, 2017; 231p. [Google Scholar]
- Polashock, J.J.; Hillman, B.I. Scorch. In Compendium of Blueberry, Cranberry, and Lingonberry Diseases and Pests, 2nd ed.; Polashock, J.J., Caruso, F.L., Averill, A.L., Schilder, A.C., Eds.; APS Press: St. Paul, MN, USA, 2017; pp. 70–72. [Google Scholar]
- Martin, R.R.; Tzanetakis, I.E. Mosaic. In Compendium of Blueberry, Cranberry, and Lingonberry Diseases and Pests, 2nd ed.; Polashock, J.J., Caruso, F.L., Averill, A.L., Schilder, A.C., Eds.; APS Press: St. Paul, MN, USA, 2017; p. 64. [Google Scholar]
- Tzanetakis, I.E.; Martin, R.R. Blueberry virus A. In Compendium of Blueberry, Cranberry, and Lingonberry Diseases and Pests, 2nd ed.; Polashock, J.J., Caruso, F.L., Averill, A.L., Schilder, A.C., Eds.; APS Press: St. Paul, MN, USA, 2017; p. 60. [Google Scholar]
- Isogai, M.; Muramatu, S.; Watanabe, M.; Yoshikawa, N. Complete nucleotide sequence and latency of a novel blueberry-infecting closterovirus. J. Gen. Plant Pathol. 2013, 79, 123–127. [Google Scholar] [CrossRef]
- Martin, R.R.; Polashock, J.J.; Tzanetakis, I.E. New and emerging viruses of blueberry and cranberry. Viruses 2012, 4, 2831–2852. [Google Scholar] [CrossRef] [PubMed]
- Spiegel, S.; Martin, R.R. Improved detection of potato leafroll virus in dormant potato tubers and microtubers by the polymerase chain reaction and ELISA. Ann. Appl. Biol. 1993, 122, 493–500. [Google Scholar] [CrossRef]
- Tzanetakis, I.E.; Postman, J.D.; Martin, R.R. Identification, detection and transmission of a new Vitivirus from Mentha. Arch. Virol. 2007, 152, 2027–2033. [Google Scholar] [CrossRef] [PubMed]
- Shands, A.C.; Crandall, S.G.; Miles, T.D. First report of the ability of Olpidium virulentus to vector Blueberry mosaic associated virus (BlMaV) on southern highbush blueberry. Plant Dis. 2017, 101, 1683. [Google Scholar] [CrossRef]
- Martin, R.R.; Bristow, P.R. A carlavirus associated with blueberry scorch disease. Phytopathology 1988, 78, 1636–1640. [Google Scholar] [CrossRef]
- Martin, R.R.; Zhou, J.; Tzanetakis, I.E. Blueberry latent virus: An amalgam of Partitiviridae and Totiviridae. Virus Res. 2011, 155, 175–180. [Google Scholar] [CrossRef] [PubMed]
- Diaz-Lara, A.; Martin, R.R. Blueberry fruit drop-associated virus: A new member of the family Caulimoviridae isolated from blueberry exhibiting fruit-drop symptoms. Plant Dis. 2016, 100, 2211–2214. [Google Scholar] [CrossRef]
- Thekke-Veetil, T.; Polashock, J.J.; Marn, M.V.; Plesko, I.M.; Schilder, A.C.; Keller, K.E.; Martin, R.R.; Tzanetakis, I.E. Population structure of blueberry mosaic associated virus: Evidence of genetic exchange in geographically distinct isolates. Virus Res. 2015, 201, 79–84. [Google Scholar] [CrossRef] [PubMed]
- Quito-Avila, D.F.; Brannen, P.M.; Cline, W.O.; Harmon, P.F.; Martin, R.R. Genetic characterization of Blueberry necrotic ring blotch virus, a novel RNA virus with unique genetic features. J. Gen. Virol. 2013, 94, 1426–1434. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Polashock, J.J.; Ehlenfeldt, M.K.; Crouch, J.A. Molecular detection and discrimination of blueberry red ringspot virus strains causing disease in cultivated blueberry and cranberry. Plant Dis. 2009, 93, 727–733. [Google Scholar] [CrossRef]
- Thekke-Veetil, T.; Ho, T.; Keller, K.E.; Martin, R.R.; Tzanetakis, I.E. A new ophiovirus is associated with blueberry mosaic disease. Virus Res. 2014, 189, 92–96. [Google Scholar] [CrossRef] [PubMed]
- Varney, E.H. Mosaic and shoestring, virus diseases of cultivated blueberry in New Jersey. Phytopathology 1957, 47, 307–309. [Google Scholar]
- Hutchinson, M.T.; Varney, T.H. Ringspot, a virus disease of cultivated blueberry. Plant Dis. Rep. 1954, 38, 260–263. [Google Scholar]
- Martin, R.R.; MacFarlane, S.; Sabanadzovic, S.; Quito, D.; Poudel, B.; Tzanetakis, I.E. Viruses and virus diseases of Rubus. Plant Dis. 2013, 97, 169–182. [Google Scholar] [CrossRef]
- Eck, P.; Childers, N.F. The blueberry industry. In Blueberry Culture; Eck, P., Childers, N.F., Eds.; Rutgers University Press: New Brunswick, NJ, USA, 1966; pp. 3–13. [Google Scholar]
- Childress, A.M.; Ramsdell, D.C. Bee-mediated transmission of blueberry leaf mottle virus via infected pollen in highbush blueberry. Phytopathology 1987, 77, 167–172. [Google Scholar] [CrossRef]
- Finn, C.E.; Mackey, T.A.; Postman, J.D.; Martin, R.R. Identifying blueberry germplasm that is slow to get Blueberry shock virus in the Pacific Northwest United States. Acta Hortic. 2017, 1180, 423–429. [Google Scholar] [CrossRef]
- Kim, K.S.; Ramsdell, D.C.; Gillett, J.M.; Fulton, J.P. Virions and ultrastructural changes associated with Blueberry Red Ringspot Disease. Phytopathology 1981, 71, 673–678. [Google Scholar] [CrossRef]
- MacDonald, S.G.; Martin, R.R.; Bristow, P.R. Characterization of an ilarvirus associated with a necrotic shock reaction in blueberry. Phytopathology 1991, 81, 201–214. [Google Scholar] [CrossRef]
- Food and Agriculture Organization of the United Nations (FAO). International Standards for Phytosanitary Measures, ISPM No. 31, Methodologies for Sampling of Consignments; Produced by the Secretariat of the International Plant Protection Convention; FAO: Rome, Italy, 2008; 19p. [Google Scholar]
- Poudyal, S.D.; Fraley, C.; Osterbauer, N.K. Surveying for virus-vectoring nematodes in container-grown blueberry plants in Oregon. Plant Health Prog. 2016, 17, 175–176. [Google Scholar]
Virus | Primer Pair | Annealing Temp | Amplicon Size (Ref) 1 |
---|---|---|---|
BlLV | F: CTTATCAGAGCTTCTTCAGACTGG R: TCGTCACCCGCACATTTC | 55 | 391 [18] |
BFDaV | F: GACAACAGCATCTACATCTCTGC R: GGTCGTTCTACCACGTTTCTG | 53 | 395 [19] |
BlMaV | F: CCWGTATCAAGCATAGTYACAAG R: AAGAAGGTRGTGATTGAGA | 58 | 254 [20] |
BNRBV | F: CCAGTTTGGAGGAATTGCAT R: GCGTTTCAGCACCACTAAC | 55 | 432 [21] |
BRRV | F: ATCAGTCCCAGAAGAAAAGAAGTA R: TCCGAAAAATAGATAGTGTCAGC | 56 | 548 [22] |
BVA | F: AACTCATGGTTAAGCGTGAG R: AGTCCTGAGACTTATCGAAC | 55 | 270 [12] |
NADH (β) | AGTAGATGCTATCACACATACAAT GGACTCCTGACGTATACGAAGGATC (note DNA has intron and yields ~1100 bp band) | 55 | 721 [15] |
Acronym 1 | Genus | Transmission | Laboratory Detection | California | Regional Occurrence | Positives # | |||
---|---|---|---|---|---|---|---|---|---|
Northwest | Southeast | Northeast | Midwest | ||||||
BFDaV | ? | ? | RT-PCR??? | 0/148 | 64/1244 * | 0/221 | 0/555 | 0/411 | 64 |
BlLV | Amalgavirus | pollen/seed ◊ | RT-PCR | 5/148 | 22/1244 | 15/221 | 48/555 | 2/411 | 92 |
BLMoV | Nepovirus | nematodes? □◊ | ELISA | 0/148 | 0/1244 | 0/221 | 18/555 | 12/411 | 30 |
BlMaV | Ophiovirus | Olpidium/? | RT-PCR | 9/148 | 18/1244 | 2/221 | 20/555 | 35/411 | 84 |
BNRBV | Blunervirus | eriophyid mites? | RT-PCR | 0/148 | 0/1244 | 26/221 | 0/555 | 0/411 | 26 |
BRRV | Soymovirus | ? | PCR | 0/148 | 0/1244 | 46/221 | 1/555 | 0/411 | 47 |
BlScV | Carlavirus | aphids/non-persistent | ELISA/RT-PCR | 0/148 | 43/1244 | 0/221 | 70/555 | 1/411 | 114 |
BlShV | Ilarvirus | pollen/seed ◊ | ELISA/RT-PCR | 8/148 | 558/1244 | 0/221 | 0/555 | 0/411 | 566 |
BlSSV | Sobemovirus | aphids/non-persistent | ELISA | 0/148 | 0/1244 | 0/221 | 4/555 | 49/411 | 53 |
BVA | Closterovirus | aphids/Semi-persistent? | RT-PCR | 0/148 | 0/1244 | 0/221 | 29/555 | 90/411 | 119 |
PRMV | Nepovirus | nematodes/persistent □◊ | ELISA | 0/148 | 0/1244 | 0/221 | 2/555 | 6/411 | 8 |
TRSV | Nepovirus | nematodes/persistent □◊ | ELISA | 0/148 | 0/1244 | 0/221 | 42/555 | 4/411 | 46 |
ToRSV | Nepovirus | nematodes/persistent □◊ | ELISA | 0/148 | 5/1244 | 0/221 | 6/555 | 13/411 | 24 |
© 2018 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Martin, R.R.; Tzanetakis, I.E. High Risk Blueberry Viruses by Region in North America; Implications for Certification, Nurseries, and Fruit Production. Viruses 2018, 10, 342. https://doi.org/10.3390/v10070342
Martin RR, Tzanetakis IE. High Risk Blueberry Viruses by Region in North America; Implications for Certification, Nurseries, and Fruit Production. Viruses. 2018; 10(7):342. https://doi.org/10.3390/v10070342
Chicago/Turabian StyleMartin, Robert R., and Ioannis E. Tzanetakis. 2018. "High Risk Blueberry Viruses by Region in North America; Implications for Certification, Nurseries, and Fruit Production" Viruses 10, no. 7: 342. https://doi.org/10.3390/v10070342