Next Article in Journal
Molecular and Clinical Characterization of Chikungunya Virus Infections in Southeast Mexico
Next Article in Special Issue
Two Novel Hypovirulence-Associated Mycoviruses in the Phytopathogenic Fungus Botrytis cinerea: Molecular Characterization and Suppression of Infection Cushion Formation
Previous Article in Journal
A VP26-mNeonGreen Capsid Fusion HSV-2 Mutant Reactivates from Viral Latency in the Guinea Pig Genital Model with Normal Kinetics
Previous Article in Special Issue
Mycoviruses as Triggers and Targets of RNA Silencing in White Mold Fungus Sclerotinia sclerotiorum
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Communication

Multiplex Detection of Aspergillus fumigatus Mycoviruses

by
Selin Özkan-Kotiloğlu
1,2,* and
Robert H. A. Coutts
2,3
1
Department of Molecular Biology and Genetics, Ahi Evran University, Kırşehir 40100, Turkey
2
Department of Life Sciences, Faculty of Natural Sciences, Imperial College London, London SW7 2AZ, UK
3
Department of Biological and Environmental Sciences, University of Hertfordshire, Hatfield AL10 9AB, UK
*
Author to whom correspondence should be addressed.
Viruses 2018, 10(5), 247; https://doi.org/10.3390/v10050247
Submission received: 5 April 2018 / Revised: 5 May 2018 / Accepted: 6 May 2018 / Published: 8 May 2018
(This article belongs to the Special Issue Mycoviruses)

Abstract

:
Mycoviruses are viruses that naturally infect and replicate in fungi. They are widespread in all major fungal groups including plant and animal pathogenic fungi. Several dsRNA mycoviruses have been reported in Aspergillus fumigatus. Multiplex polymerase chain reaction (PCR) amplification is a version of PCR that enables amplification of different targets simultaneously. This technique has been widely used for detection and differentiation of viruses especially plant viruses such as those which infect tobacco, potato and garlic. For rapid detection, multiplex RT-PCR was developed to screen new isolates for the presence of A. fumigatus mycoviruses. Aspergillus fumigatus chrysovirus (AfuCV), Aspergillus fumigatus partitivirus (AfuPV-1), and Aspergillus fumigatus tetramycovirus-1 (AfuTmV-1) dsRNAs were amplified in separate reactions using a mixture of multiplex primer pairs. It was demonstrated that in the presence of a single infection, primer pair mixtures only amplify the corresponding single virus infection. Mixed infections using dual or triple combinations of dsRNA viruses were also amplified simultaneously using multiplex RT-PCR. Up until now, methods for the rapid detection of Aspergillus mycoviruses have been restricted to small scale dsRNA extraction approaches which are laborious and for large numbers of samples not as sensitive as RT-PCR. The multiplex RT-PCR assay developed here will be useful for studies on determining the incidence of A. fumigatus mycoviruses. This is the first report on multiplex detection of A. fumigatus mycoviruses.

1. Introduction

Aspergillus is a genus in the phylum Ascomycota, kingdom Fungi. Aspergillus species (spp.) are universal and ubiquitous in nature, and are usually found as saprophytes in soil, decaying vegetation, seed and grains [1]. They are important both medically and commercially. Aspergillus fumigatus is an important pathogen with the capability of infecting humans, invading lungs and leading to opportunistic infections in immunocompromised hosts along with the allergic reactions in healthy individuals [1,2].
Mycoviruses were first reported in Aspergillus foetidus and Aspergillus niger [3]. Research on dsRNA elements showed that various Aspergillus spp. were infected by mycoviruses [4] (Varga et al., 1998). Previously, research on 61 isolates of A. fumigatus showed that none of the strains contained dsRNA elements [4]. However, after screening more than 360 A. fumigatus isolates from environmental and clinical sources for the presence of dsRNA elements, three different dsRNA profiles were reported with a 6.6% incidence in the UK isolates [5]. Recently, different dsRNA mycoviruses have been reported in A. fumigatus with an 18.6% incidence in Holland [6]. Those previous studies reporting variable mycovirus incidence in A. fumigatus have employed common nucleic acid extraction methods [4,5,6]. The impacts of the viruses on the host were also investigated in A. fumigatus using murine and Galleria mellonella models and those viruses are known to affect host virulence [7,8].
Multiplex detection technologies where simultaneous detection of multiple viruses in a single assay can be achieved, enables a reduction in cost, time and labor as compared to other detection methods [9]. Various methods such as enzyme-linked immunoabsorbant assay (ELISA), real-time polymerase chain reaction (RT-PCR), loop-mediated isothermal amplification (LAMP), Luminex bead arrays and next generation sequencing (NGS) have all been used for virus detection [9,10,11,12]. Multiplex PCR is a version of PCR, which facilitates amplification of several different target sequences simultaneously. In this technique, more than one pair of primers is used to amplify different targets in one reaction. Multiplex PCR is a useful tool to detect various viruses infecting the same sample [10,13]. It is called multiplex reverse transcription PCR (RT-PCR) when the starting material is RNA instead of DNA. This technique has been widely used for the detection and differentiation of the viruses especially plant viruses such as tobacco, potato and garlic viruses [10,13,14,15,16].
The main aim of this study was to optimize a rapid detection method for three characterized A. fumigatus mycoviruses namely Aspergillus fumigatus chrysovirus (AfuCV) [17], Aspergillus fumigatus partitivirus (AfuPV-1) [18], and Aspergillus fumigatus tetramycovirus-1 (AfuTmV-1) [19], which have been reviewed recently by Kotta-Loizou and Coutts [20]. For rapid detection, multiplex PCR was developed to screen new isolates in terms of presence of A. fumigatus mycoviruses.

2. Materials and Methods

2.1. Fungal Growth Conditions and Mycoviruses

A. fumigatus strains used in this study were isolates A56, A88 and Af293 for Aspergillus fumigatus chrysovirus (AfuCV), Aspergillus fumigatus partitivirus-1 (AfuPV-1) and Aspergillus fumigatus tetramycovirus-1 (AfuTmV-1), respectively [5]. All A. fumigatus strains were cultured from glycerol stocks on Aspergillus complete medium (ACM) agar at 37 °C for 3–4 days and spores were harvested in order to inoculate ACM broth which was incubated at 37 °C with shaking at 130 rpm. After 5 days, mycelia were harvested using sterile Miracloth (Merck Millipore, MA, USA), rapidly frozen in liquid N2 and kept at −80 °C until processing. A. fumigatus isolates were selected from the ones screened previously by Bhatti et al., 2012 [5].

2.2. Primer Design

Sequence-specific oligonucleotide primers were designed for amplification of conserved areas within the RdRP genes of AfuCV, AfuPV-1 and AfuTmV-1. The RdRP gene sequences of each mycovirus were obtained from the National Center for Biotechnology Information (NCBI). Specificity of the primers was checked by BLAST analysis of mycoviral genomes and the A. fumigatus genome. In order to facilitate correct multiplex PCR amplification, all primers were designed with similar annealing temperatures. The sequences of the oligonucleotide primers used are shown in Table 1.

2.3. RNA Extraction and Reverse Transcription

In order to perform multiplex PCR for mycovirus-infected A. fumigatus isolates, total fungal RNA was extracted using the RNeasy Plant Mini kit (Qiagen, Hilden, Germany) from 100 mg of grounded mycelium, quantified by using NanoDrop 2000C spectrophotometer (Thermo Fischer, Waltham, MA, USA) and cDNA was synthesized using Superscript-III first-strand synthesis system (Invitrogen, Carlsbad, CA, USA) according to the manufacturers’ protocol as follows; 5 µg of RNA, 10 mM of dNTP mix and 250 ng of random primers along with 6.5 µL of DEPC-treated water were incubated at 65 °C for 5 min and snap cooled on ice for at least 2 min. Then 4 µL of 5× first strand buffer, 0.1 M DTT, 40 U of RNasin RNase inhibitor (Promega, Madison, WI, USA) and 200 U of Superscript-III reverse transcriptase were added to the reaction after a brief centrifugation. The 20 µL reaction mixture was then subjected to the following cycling regime of incubation at 25 °C, 50 °C and 70 °C for 5 min, 1 h and 15 min, respectively in a DNA Engine DYAD thermocycler. In an attempt to confirm if there was direct amplification from DNA or not, cDNA synthesis was performed without the reverse transcriptase enzyme. Additionally, viral dsRNAs were extracted using LiCl extraction as described previously [21] and used as a positive control in order to check the efficiency of the kit at extracting viral dsRNAs.

2.4. Specificity and Sensitivity Testing of Single PCR and Multiplex PCR

Single PCR amplification was performed prior to multiplex PCR in order to check the primers and amplicon sizes. A no template control was included along with the specificity tests consisting of (i) a mixture of the three primer pairs and cDNA template from each virus, and (ii) a mixture of the three primer pairs and the mixture of three viruses (2 ng from each mycovirus). The PCR master mix contained 10 µL of 5× GoTaq Buffer (Promega, Fitchburg, WI, USA), 1 µL of 100 mM dNTP mix (Promega), 3 µL of forward primer mixture (10 µM of each primer), 3 µL of reverse primer mixture (10 µM of each primer), 2 U of GoTaq polymerase (Promega) and 5 ng DNA or cDNA template in 50 µL reaction.
Multiplex PCR was performed using a program consisting of an initial activation at 95 °C for 3 min followed by 32 cycles of 3 steps including 95 °C for 30 s, 62 °C for 45 s and 72 °C for 30 s and a final extension at 72 °C for 3 min. The resulting PCR amplicons were analyzed by electrophoresis in 2% agarose gel containing ethidium bromide as before [20].

3. Results

3.1. The Efficiency of the RNA Extraction Method

The multiplex RT-PCR amplification assay was used to detect known and characterized A. fumigatus mycoviruses, namely AfuCV, AfuPV-1 and AfuTmV-1. The effect of the dsRNA extraction method on the efficiency of PCR was tested using LiCl extraction and the RNeasy Plant Mini kit (Qiagen). It was found that both gave the same amplicon with similar efficiency (Figure 1). We demonstrated that targets of interest can be amplified with the same efficiency from viral dsRNAs obtained using different procedures such as virus purification or an RNA extraction kit.

3.2. Specificity and Sensitivity of the Multiplex PCR

After establishing the dsRNA extraction method, primers were examined in terms of specificity under multiplex conditions. AfuCV, AfuPV-1 and AfuTmV-1 dsRNAs were amplified in separate reactions using a mixture of multiplex primer pairs. It was determined that in the presence of single infection, mixtures of primer pairs only amplify the virus corresponding single infection (Figure 2). The specificity of the mixture of three primer pairs used in the present study was tested and shown in Figure 2. As positive controls oligonucleotide primer pairs were used for RT-PCR amplification of amplicons 592, 497 and 328 bp in size from respectively AfuCV, AfuPV-1 and AfuTmV-1. No cross-reaction with non-targets was identified.
Mixed infections using dual or triple combinations of dsRNA viruses were also amplified simultaneously using multiplex RT-PCR (Figure 3). Combinations of AfuCV and AfuPV-1, AfuCV and AfuTmV-1, AfuPV-1 and AfuTmV-1 and AfuCV, AfuPV and AfuTmV-1 were used as template and multiplex RT-PCR was performed using all three primer pairs. In all cases, amplicons were only generated from their respective mycovirus template RNAs.
The efficiency of the multiplex PCR amplification assay was also tested using a naturally mixed infected A. fumigatus isolate A80 [5], which was naturally infected with a combination of AfuCV and AfuTmV-1 (Figure 4). Extracted RNA, as described above, was used as template for single PCRs including AfuCV, AfuPV-1 and AfuTmV-1 primers separately first. It was found that A80 gave amplicons of the correct sizes when AfuCV and AfuTmV-1 primer sets were used. However, as anticipated the A80 isolate did not give any amplicon when the AfuPV-1 primer set was used. When the multiplex PCR was conducted with all three primer sets the A80 isolate only gave amplicons with primers specific for AfuCV and AfuTmV-1. However, the amplicon generated from AfuTmV-1 was small in quantity as compared to that generated from AfuCV suggesting the former was present in lesser amounts in the mixedly infected A80 isolate (Figure 4, lane 4).
In addition, all positive amplicons from multiplex PCR were sequenced in order to confirm the specificity of PCR products. The sequences were blasted to the deposited GenBank sequences to confirm the specificity of the PCR amplified DNA fragments. Sequences of amplified products were identical to the RdRP gene sequences of respectively AfuCV, AfuPV-1 and AfuTmV-1.

4. Discussion

It is essential to develop a rapid and reliable method to detect A. fumigatus mycoviruses. This study developed a multiplex PCR assay for rapid detection of three A. fumigatus mycoviruses (AfuCV, AfuPV-1 and AfuTmV-1) using specific primers for each mycovirus.
There are various studies on Aspergillus mycoviruses, especially ones infecting the medically important human pathogen A. fumigatus. In these studies, variable mycovirus incidence was reported in different A. fumigatus populations using common nucleic acid extraction methods [4,5,6]. Recently, a simple and rapid method has been developed to purify viral dsRNA from plant and fungal tissues using cellulose powder [22]. There is no study reported on rapid detection of Aspergillus mycoviruses except those using small-scale dsRNA extraction approaches [23]. Even though viruses can be detected with the small-scale dsRNA extraction method, it can be laborious where large numbers of samples are to be screened and when the virus is in low titre and sensitivity is a problem. Conversely, multiplex RT-PCR amplification provides sensitivity and specificity in diagnosis of virus infection along with the other advantages such as being easy to perform, rapid and cost-efficient [10]. Recently, a number of novel techniques to detect mycoviruses, record their incidence and characterize them have been developed. These include RT-LAMP [12] and next generation sequencing-mediated virus detection and characterization [24,25], and it is conceivable that such techniques could be combined with multiplex-PCR technology in virus detection and characterization in the future.
Additionally, the method of RNA extraction is of great importance as is one of the factors determining the efficiency of multiplex PCR. The method developed in this study uses the RNA template obtained using a rapid kit extraction method which also makes the procedure quicker and reproducible.
To our knowledge, this is the first study reporting multiplex RT-PCR optimized for mycoviruses. However, it is only applicable to characterized viruses that have a known genomic sequence. It is also possible that novel mycoviruses in A. fumigatus can be missed as this method has only been developed based on sequence information of known A. fumigatus mycoviruses. In order to overcome this problem, a primer pair could be designed based on the conserved sequence (if there is any) of known A. fumigatus mycoviruses assuming that the undiscovered A. fumigatus mycoviruses also have this conserved sequence. This primer pair could be added to the multiplex PCR in order not to miss any potential novel mycoviruses. Since it is known that all viruses, especially those with RNA as their genome, evolve and mutate, it is entirely feasible that the multiplex PCR amplification protocol as described might have limited application in the future. However, we have been careful in our design of oligonucleotides used in the protocol such that they are in conserved regions of the genomes, mutations to which are likely lethal for virus replication. Multiple detection by deep-sequencing is also a very useful approach to screen and furthermore elucidate the viromes [25,26]. In conclusion, a novel multiplex RT-PCR assay which is rapid, reliable and cost-effective was developed to detect AfuCV, AfuPV-1 and AfuTmV-1 infection of A. fumigatus isolates. The multiplex RT-PCR assay developed here would be useful for the studies on determining the incidence of known A. fumigatus mycoviruses and to establish a system for a comprehensive survey of them. Moreover, it could be useful to detect mycovirus infection rapidly in order to design treatment to fungal infection as mycoviruses can alter fungal pathogenicity.

Author Contributions

S.Ö.-K. and R.H.A.C. conceived and designed the experiments; S.Ö.-K. performed the experiments; S.Ö.-K. and R.H.A.C. analyzed the data; S.Ö-K. and R.H.A.C. wrote the paper.

Acknowledgments

We thank Catherine Townsend for working on this project during her summer placement. Robert Coutts wishes to acknowledge the support of the Leverhulme Trust through a Leverhulme Emeritus Research Fellowship. Selin Özkan thanks the Turkish Government Higher Education program for supporting her PhD investigations.

Conflicts of Interest

The authors declare no conflict of interest. The founding sponsors had no role in the design of the study; in the collection, analyses, or interpretation of data; in the writing of the manuscript, and in the decision to publish the results.

References

  1. Pitt, J.I. The current role of Aspergillus and Penicillium in human and animal health. J. Med. Vet. Mycol. 1994, 32 (Suppl. 1), 17–32. [Google Scholar] [CrossRef] [PubMed]
  2. Latge, J.P. Aspergillus fumigatus and aspergillosis. Clin. Microbiol. Rev. 1999, 12, 310–350. [Google Scholar] [PubMed]
  3. Banks, G.T.; Buck, K.W.; Chain, E.B.; Darbyshire, J.E.; Himmelweit, F.; Ratti, G.; Sharpe, T.J.; Planterose, D.N. Antiviral activity of double stranded RNA from a virus isolated from Aspergillus foetidus. Nature 1970, 227, 505–507. [Google Scholar] [CrossRef] [PubMed]
  4. Varga, J.; Rinyu, E.; Kevei, E.; Toth, B.; Kozakiewicz, Z. Double-stranded RNA mycoviruses in species of Aspergillus sections Circumdati and Fumigati. Can. J. Microbiol. 1998, 44, 569–574. [Google Scholar] [CrossRef] [PubMed]
  5. Bhatti, M.F.; Jamal, A.; Bignell, E.M.; Petrou, M.A.; Coutts, R.H.A. Incidence of dsRNA mycoviruses in a collection of Aspergillus fumigatus isolates. Mycopathologia 2012, 174, 323–326. [Google Scholar] [CrossRef] [PubMed]
  6. Refos, J.M.; Vonk, A.G.; Eadie, K.; Lo-Ten-Foe, J.R.; Verbrugh, H.A.; van Diepeningen, A.D.; van de Sande, W.W. Double-stranded RNA mycovirus infection of Aspergillus fumigatus is not dependent on the genetic make-up of the host. PLoS ONE 2013, 8, e77381. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  7. Bhatti, M.F.; Jamal, A.; Petrou, M.A.; Cairns, T.C.; Bignell, E.M.; Coutts, R.H. The effects of dsRNA mycoviruses on growth and murine virulence of Aspergillus fumigatus. Fungal Genet. Biol. 2011, 48, 1071–1075. [Google Scholar] [CrossRef] [PubMed]
  8. Özkan, S.; Coutts, R.H. Aspergillus fumigatus mycovirus causes mild hypervirulent effect on pathogenicity when tested on Galleria mellonella. Fungal Genet. Biol. 2015, 76, 20–26. [Google Scholar] [CrossRef] [PubMed]
  9. Boonham, N.; Kreuze, J.; Winter, S.; van der Vlugt, R.; Bergervoet, J.; Tomlinson, J.; Mumford, R. Methods in virus diagnostics: From ELISA to next generation sequencing. Virus Res. 2014, 186, 20–31. [Google Scholar] [CrossRef] [PubMed]
  10. Dai, J.; Cheng, J.; Huang, T.; Zheng, X.; Wu, Y. A multiplex reverse transcription PCR assay for simultaneous detection of five tobacco viruses in tobacco plants. J. Virol. Methods 2012, 183, 57–62. [Google Scholar] [CrossRef] [PubMed]
  11. Uehara-Ichiki, T.; Shiba, T.; Matsukura, K.; Ueno, T.; Hirae, M.; Sasaya, T. Detection and diagnosis of rice-infecting viruses. Front. Microbiol. 2013, 4, 289. [Google Scholar] [CrossRef] [PubMed]
  12. Komatsu, K.; Urayama, S.; Katoh, Y.; Fuji, S.; Hase, S.; Fukuhara, T.; Arie, T.; Teraoka, T.; Moriyama, H. Detection of Magnaporthe oryzae chrysovirus 1 in Japan and establishment of a rapid, sensitive and direct diagnostic method based on reverse transcription look-mediated isothermal amplification. Arch. Virol. 2016, 161, 317–326. [Google Scholar] [CrossRef] [PubMed]
  13. Meunier, A.; Schmit, J.-F.; Stas, A.; Kutluk, N.; Bragard, C. Multiplex reverse transcription-PCR for simultaneous detection of Beet necrotic yellow vein virus, Beet soilborne virus, and Beet virus Q and their vector Polymyxa betae KESKIN on sugar beet. Appl. Environ. Microbiol. 2003, 69, 2356–2360. [Google Scholar] [CrossRef] [PubMed]
  14. Lorenzen, J.H.; Piche, L.M.; Gudmestad, N.C.; Meacham, T.; Shiel, P. A multiplex PCR assay to characterize Potato virus Y isolates and identify strain mixtures. Plant Dis. 2006, 90, 935–940. [Google Scholar] [CrossRef]
  15. Kumar, S.; Udaya Shankar, A.C.; Nayaka, S.C.; Lund, O.S.; Prakash, H.S. Detection of Tobacco mosaic virus and Tomato mosaic virus in pepper and tomato by multiplex RT-PCR. Lett. Appl. Microbiol. 2011, 53, 359–363. [Google Scholar] [CrossRef] [PubMed]
  16. Majumder, S.; Baranwal, V.K. Simultaneous detection of four garlic viruses by multiplex reverse transcription PCR and their distribution in Indian garlic accessions. J. Virol. Methods 2014, 202, 34–38. [Google Scholar] [CrossRef] [PubMed]
  17. Jamal, A.; Bignell, E.M.; Coutts, R.H.A. Complete nucleotide sequences of four dsRNAs associated with a new chrysovirus infecting Aspergillus fumigatus. Virus Res. 2010, 153, 64–70. [Google Scholar] [CrossRef] [PubMed]
  18. Bhatti, M.F.; Bignell, E.M.; Coutts, R.H.A. Complete nucleotide sequences of two dsRNAs associated with a new partitivirus infecting Aspergillus fumigatus. Arch. Virol. 2011, 156, 1677–1680. [Google Scholar] [CrossRef] [PubMed]
  19. Kanhayuwa, L.; Kotta-Loizou, I.; Özkan, S.; Gunning, A.P.; Coutts, R.H.A. A novel mycovirus from Aspergillus fumigatus contains four unique dsRNAs as its genome and is infectious as dsRNA. Proc. Natl. Acad. Sci. USA 2015, 112, 9100–9105. [Google Scholar] [CrossRef] [PubMed]
  20. Kotta-Loizou, I.; Coutts, R.H.A. Mycoviruses in Aspergilli: A Comprehensive Review. Front. Microbiol. 2017, 8, 1699. [Google Scholar] [CrossRef] [PubMed]
  21. Diaz-Ruiz, J.R.; Kaper, J.M. Isolation of viral double-stranded RNAs using a LiCl fractionation procedure. Prep. Biochem. 1978, 8, 1–17. [Google Scholar] [CrossRef] [PubMed]
  22. Okada, R.; Kiyota, E.; Moriyama, H.; Fukuhara, T.; Natsuaki, T. A simple and rapid method to purify viral dsRNA from plant and fungal tissue. J. Gen. Plant Pathol. 2015, 81, 103–107. [Google Scholar] [CrossRef]
  23. Coenen, A.; Kevei, F.; Hoekstra, R.F. Factors affecting the spread of double-stranded RNA viruses in Aspergillus nidulans. Genet. Res. 1997, 69, 1–10. [Google Scholar] [CrossRef] [PubMed]
  24. Marzano, S.L.; Nelson, B.D.; Ajayi-Oyetunde, O.; Bradley, C.A.; Hughes, T.J.; Hartman, G.L.; Eastburn, D.M.; Domier, L.L. Identification of diverse mycoviruses through metatranscriptomics characterization of the viromes of five major fungal plant pathogens. J. Virol. 2016, 90, 6846–6863. [Google Scholar] [CrossRef] [PubMed]
  25. Nerva, L.; Ciuffo, M.; Vallino, M.; Margaria, P.; Varese, G.C.; Gnavi, G.; Turina, M. Multiple approaches for the detection and characterization of viral and plasmid symbionts from a collection of marine fungi. Virus Res. 2016, 219, 22–38. [Google Scholar] [CrossRef] [PubMed]
  26. Osaki, H.; Sasaki, A.; Nomiyama, K.; Tomioka, K. Multiple virus infection in a single strain of Fusarium poae shown by deep sequencing. Virus Genes 2016, 52, 835–847. [Google Scholar] [CrossRef] [PubMed]
Figure 1. Conventional PCR to check amplicon size prior to multiplex PCR. Amplicon sizes were checked on two percent agarose gel prior to performing multiplex PCR for A. fumigatus dsRNA mycoviruses. AfuCV, AfuPV-1 and AfuTmV-1 dsRNAs were extracted using LiCl extraction (Lanes 2, 4 and 6, respectively) and RNeasy Plant Mini kit (Lanes 3, 5 and 7, respectively) and used as templates for amplification with AfuCV, AfuPV-1 and AfuTmV-1 primers (2–3, 4–5, 6–7, respectively). Hyperladder-I was used as a marker to estimate the size of the amplicons (Lane 1).
Figure 1. Conventional PCR to check amplicon size prior to multiplex PCR. Amplicon sizes were checked on two percent agarose gel prior to performing multiplex PCR for A. fumigatus dsRNA mycoviruses. AfuCV, AfuPV-1 and AfuTmV-1 dsRNAs were extracted using LiCl extraction (Lanes 2, 4 and 6, respectively) and RNeasy Plant Mini kit (Lanes 3, 5 and 7, respectively) and used as templates for amplification with AfuCV, AfuPV-1 and AfuTmV-1 primers (2–3, 4–5, 6–7, respectively). Hyperladder-I was used as a marker to estimate the size of the amplicons (Lane 1).
Viruses 10 00247 g001
Figure 2. Specificity testing of multiplex RT-PCR with a mixture of three primer pairs. Multiplex RT-PCR was performed using the mixture of three primer pairs in a reaction including single template. Lanes 1, 2, 3 indicate the amplicons from AfuCV, AfuPV-1 and AfuTmV-1 templates in the presence of mixed primers, respectively. Hyperladder-I was used as a marker to estimate the size of the amplicons (Lane M).
Figure 2. Specificity testing of multiplex RT-PCR with a mixture of three primer pairs. Multiplex RT-PCR was performed using the mixture of three primer pairs in a reaction including single template. Lanes 1, 2, 3 indicate the amplicons from AfuCV, AfuPV-1 and AfuTmV-1 templates in the presence of mixed primers, respectively. Hyperladder-I was used as a marker to estimate the size of the amplicons (Lane M).
Viruses 10 00247 g002
Figure 3. Simultaneous detection of A. fumigatus mycoviruses using multiplex RT-PCR. Mixed dsRNA combinations were used to perform multiplex RT-PCR. In lanes 1, 2 and 3, combinations of AfuCV and AfuPV-1, AfuCV and AfuTmV-1 and AfuPV-1 and AfuTmV-1, were used as template, respectively. In lane 4, dsRNAs belonging to three A. fumigatus mycoviruses were mixed and multiplex RT-PCR was performed using all three primer pairs. Hyperladder-I was used as a marker to estimate the size of the amplicon (Lane M).
Figure 3. Simultaneous detection of A. fumigatus mycoviruses using multiplex RT-PCR. Mixed dsRNA combinations were used to perform multiplex RT-PCR. In lanes 1, 2 and 3, combinations of AfuCV and AfuPV-1, AfuCV and AfuTmV-1 and AfuPV-1 and AfuTmV-1, were used as template, respectively. In lane 4, dsRNAs belonging to three A. fumigatus mycoviruses were mixed and multiplex RT-PCR was performed using all three primer pairs. Hyperladder-I was used as a marker to estimate the size of the amplicon (Lane M).
Viruses 10 00247 g003
Figure 4. Simultaneous detection of mycoviruses in an A. fumigatus isolate (A80) which was infected naturally by a mixture of AfuCV and AfuTmV-1. In lanes 1, 2 and 3, amplicons were produced using AfuCV, AfuPV-1 or AfuTmV-1 primers, respectively. In lane 4, RNA isolated from the mixedly infected A80 isolate was used as template and multiplex RT-PCR was performed using all three primer pairs. Lane 5 showed the negative template control. Hyperladder-I was used as a marker to estimate the size of the amplicon (Lane M).
Figure 4. Simultaneous detection of mycoviruses in an A. fumigatus isolate (A80) which was infected naturally by a mixture of AfuCV and AfuTmV-1. In lanes 1, 2 and 3, amplicons were produced using AfuCV, AfuPV-1 or AfuTmV-1 primers, respectively. In lane 4, RNA isolated from the mixedly infected A80 isolate was used as template and multiplex RT-PCR was performed using all three primer pairs. Lane 5 showed the negative template control. Hyperladder-I was used as a marker to estimate the size of the amplicon (Lane M).
Viruses 10 00247 g004
Table 1. Oligonucleotide primers used for multiplex polymerase chain reaction (PCR) to detect virus infection in A. fumigatus. AfuCV: Aspergillus fumigatus chrysovirus; AfuPV-1: Aspergillus fumigatus partitivirus-1; AfuTmV-1: Aspergillus fumigatus tetramycovirus-1.
Table 1. Oligonucleotide primers used for multiplex polymerase chain reaction (PCR) to detect virus infection in A. fumigatus. AfuCV: Aspergillus fumigatus chrysovirus; AfuPV-1: Aspergillus fumigatus partitivirus-1; AfuTmV-1: Aspergillus fumigatus tetramycovirus-1.
VirusPrimer IDSequence 5′→3′Tm (°C) Amplicon Size and Positions in GenomesGenBank No
AfuCVMCV1F
MCV1R
TCGACACAGAAGGCGATATG
CGCCGTTGATAAAAGTCCAT
63.8
63.6
592 bp
(1114–1705)
FN178512.1
AfuPV-1MPV1F
MPV1R
TCAGCTGGAGCCACCTTTAT
CTCCACTTCTGAGCATCACG
63.7
63.7
497 bp
(546–1042)
FN376847.3
AfuTmV-1MTmV1F
MTmV1R
AACCAGGACGTCGTTTCCTTCG
AACAGTGTATTGAGGGTGTC
64.7
63.3
328 bp
(953–1280)
HG975302

Share and Cite

MDPI and ACS Style

Özkan-Kotiloğlu, S.; Coutts, R.H.A. Multiplex Detection of Aspergillus fumigatus Mycoviruses. Viruses 2018, 10, 247. https://doi.org/10.3390/v10050247

AMA Style

Özkan-Kotiloğlu S, Coutts RHA. Multiplex Detection of Aspergillus fumigatus Mycoviruses. Viruses. 2018; 10(5):247. https://doi.org/10.3390/v10050247

Chicago/Turabian Style

Özkan-Kotiloğlu, Selin, and Robert H. A. Coutts. 2018. "Multiplex Detection of Aspergillus fumigatus Mycoviruses" Viruses 10, no. 5: 247. https://doi.org/10.3390/v10050247

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop