Multiplex Detection of Aspergillus fumigatus Mycoviruses
Abstract
:1. Introduction
2. Materials and Methods
2.1. Fungal Growth Conditions and Mycoviruses
2.2. Primer Design
2.3. RNA Extraction and Reverse Transcription
2.4. Specificity and Sensitivity Testing of Single PCR and Multiplex PCR
3. Results
3.1. The Efficiency of the RNA Extraction Method
3.2. Specificity and Sensitivity of the Multiplex PCR
4. Discussion
Author Contributions
Acknowledgments
Conflicts of Interest
References
- Pitt, J.I. The current role of Aspergillus and Penicillium in human and animal health. J. Med. Vet. Mycol. 1994, 32 (Suppl. 1), 17–32. [Google Scholar] [CrossRef] [PubMed]
- Latge, J.P. Aspergillus fumigatus and aspergillosis. Clin. Microbiol. Rev. 1999, 12, 310–350. [Google Scholar] [PubMed]
- Banks, G.T.; Buck, K.W.; Chain, E.B.; Darbyshire, J.E.; Himmelweit, F.; Ratti, G.; Sharpe, T.J.; Planterose, D.N. Antiviral activity of double stranded RNA from a virus isolated from Aspergillus foetidus. Nature 1970, 227, 505–507. [Google Scholar] [CrossRef] [PubMed]
- Varga, J.; Rinyu, E.; Kevei, E.; Toth, B.; Kozakiewicz, Z. Double-stranded RNA mycoviruses in species of Aspergillus sections Circumdati and Fumigati. Can. J. Microbiol. 1998, 44, 569–574. [Google Scholar] [CrossRef] [PubMed]
- Bhatti, M.F.; Jamal, A.; Bignell, E.M.; Petrou, M.A.; Coutts, R.H.A. Incidence of dsRNA mycoviruses in a collection of Aspergillus fumigatus isolates. Mycopathologia 2012, 174, 323–326. [Google Scholar] [CrossRef] [PubMed]
- Refos, J.M.; Vonk, A.G.; Eadie, K.; Lo-Ten-Foe, J.R.; Verbrugh, H.A.; van Diepeningen, A.D.; van de Sande, W.W. Double-stranded RNA mycovirus infection of Aspergillus fumigatus is not dependent on the genetic make-up of the host. PLoS ONE 2013, 8, e77381. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bhatti, M.F.; Jamal, A.; Petrou, M.A.; Cairns, T.C.; Bignell, E.M.; Coutts, R.H. The effects of dsRNA mycoviruses on growth and murine virulence of Aspergillus fumigatus. Fungal Genet. Biol. 2011, 48, 1071–1075. [Google Scholar] [CrossRef] [PubMed]
- Özkan, S.; Coutts, R.H. Aspergillus fumigatus mycovirus causes mild hypervirulent effect on pathogenicity when tested on Galleria mellonella. Fungal Genet. Biol. 2015, 76, 20–26. [Google Scholar] [CrossRef] [PubMed]
- Boonham, N.; Kreuze, J.; Winter, S.; van der Vlugt, R.; Bergervoet, J.; Tomlinson, J.; Mumford, R. Methods in virus diagnostics: From ELISA to next generation sequencing. Virus Res. 2014, 186, 20–31. [Google Scholar] [CrossRef] [PubMed]
- Dai, J.; Cheng, J.; Huang, T.; Zheng, X.; Wu, Y. A multiplex reverse transcription PCR assay for simultaneous detection of five tobacco viruses in tobacco plants. J. Virol. Methods 2012, 183, 57–62. [Google Scholar] [CrossRef] [PubMed]
- Uehara-Ichiki, T.; Shiba, T.; Matsukura, K.; Ueno, T.; Hirae, M.; Sasaya, T. Detection and diagnosis of rice-infecting viruses. Front. Microbiol. 2013, 4, 289. [Google Scholar] [CrossRef] [PubMed]
- Komatsu, K.; Urayama, S.; Katoh, Y.; Fuji, S.; Hase, S.; Fukuhara, T.; Arie, T.; Teraoka, T.; Moriyama, H. Detection of Magnaporthe oryzae chrysovirus 1 in Japan and establishment of a rapid, sensitive and direct diagnostic method based on reverse transcription look-mediated isothermal amplification. Arch. Virol. 2016, 161, 317–326. [Google Scholar] [CrossRef] [PubMed]
- Meunier, A.; Schmit, J.-F.; Stas, A.; Kutluk, N.; Bragard, C. Multiplex reverse transcription-PCR for simultaneous detection of Beet necrotic yellow vein virus, Beet soilborne virus, and Beet virus Q and their vector Polymyxa betae KESKIN on sugar beet. Appl. Environ. Microbiol. 2003, 69, 2356–2360. [Google Scholar] [CrossRef] [PubMed]
- Lorenzen, J.H.; Piche, L.M.; Gudmestad, N.C.; Meacham, T.; Shiel, P. A multiplex PCR assay to characterize Potato virus Y isolates and identify strain mixtures. Plant Dis. 2006, 90, 935–940. [Google Scholar] [CrossRef]
- Kumar, S.; Udaya Shankar, A.C.; Nayaka, S.C.; Lund, O.S.; Prakash, H.S. Detection of Tobacco mosaic virus and Tomato mosaic virus in pepper and tomato by multiplex RT-PCR. Lett. Appl. Microbiol. 2011, 53, 359–363. [Google Scholar] [CrossRef] [PubMed]
- Majumder, S.; Baranwal, V.K. Simultaneous detection of four garlic viruses by multiplex reverse transcription PCR and their distribution in Indian garlic accessions. J. Virol. Methods 2014, 202, 34–38. [Google Scholar] [CrossRef] [PubMed]
- Jamal, A.; Bignell, E.M.; Coutts, R.H.A. Complete nucleotide sequences of four dsRNAs associated with a new chrysovirus infecting Aspergillus fumigatus. Virus Res. 2010, 153, 64–70. [Google Scholar] [CrossRef] [PubMed]
- Bhatti, M.F.; Bignell, E.M.; Coutts, R.H.A. Complete nucleotide sequences of two dsRNAs associated with a new partitivirus infecting Aspergillus fumigatus. Arch. Virol. 2011, 156, 1677–1680. [Google Scholar] [CrossRef] [PubMed]
- Kanhayuwa, L.; Kotta-Loizou, I.; Özkan, S.; Gunning, A.P.; Coutts, R.H.A. A novel mycovirus from Aspergillus fumigatus contains four unique dsRNAs as its genome and is infectious as dsRNA. Proc. Natl. Acad. Sci. USA 2015, 112, 9100–9105. [Google Scholar] [CrossRef] [PubMed]
- Kotta-Loizou, I.; Coutts, R.H.A. Mycoviruses in Aspergilli: A Comprehensive Review. Front. Microbiol. 2017, 8, 1699. [Google Scholar] [CrossRef] [PubMed]
- Diaz-Ruiz, J.R.; Kaper, J.M. Isolation of viral double-stranded RNAs using a LiCl fractionation procedure. Prep. Biochem. 1978, 8, 1–17. [Google Scholar] [CrossRef] [PubMed]
- Okada, R.; Kiyota, E.; Moriyama, H.; Fukuhara, T.; Natsuaki, T. A simple and rapid method to purify viral dsRNA from plant and fungal tissue. J. Gen. Plant Pathol. 2015, 81, 103–107. [Google Scholar] [CrossRef]
- Coenen, A.; Kevei, F.; Hoekstra, R.F. Factors affecting the spread of double-stranded RNA viruses in Aspergillus nidulans. Genet. Res. 1997, 69, 1–10. [Google Scholar] [CrossRef] [PubMed]
- Marzano, S.L.; Nelson, B.D.; Ajayi-Oyetunde, O.; Bradley, C.A.; Hughes, T.J.; Hartman, G.L.; Eastburn, D.M.; Domier, L.L. Identification of diverse mycoviruses through metatranscriptomics characterization of the viromes of five major fungal plant pathogens. J. Virol. 2016, 90, 6846–6863. [Google Scholar] [CrossRef] [PubMed]
- Nerva, L.; Ciuffo, M.; Vallino, M.; Margaria, P.; Varese, G.C.; Gnavi, G.; Turina, M. Multiple approaches for the detection and characterization of viral and plasmid symbionts from a collection of marine fungi. Virus Res. 2016, 219, 22–38. [Google Scholar] [CrossRef] [PubMed]
- Osaki, H.; Sasaki, A.; Nomiyama, K.; Tomioka, K. Multiple virus infection in a single strain of Fusarium poae shown by deep sequencing. Virus Genes 2016, 52, 835–847. [Google Scholar] [CrossRef] [PubMed]
Virus | Primer ID | Sequence 5′→3′ | Tm (°C) | Amplicon Size and Positions in Genomes | GenBank No |
---|---|---|---|---|---|
AfuCV | MCV1F MCV1R | TCGACACAGAAGGCGATATG CGCCGTTGATAAAAGTCCAT | 63.8 63.6 | 592 bp (1114–1705) | FN178512.1 |
AfuPV-1 | MPV1F MPV1R | TCAGCTGGAGCCACCTTTAT CTCCACTTCTGAGCATCACG | 63.7 63.7 | 497 bp (546–1042) | FN376847.3 |
AfuTmV-1 | MTmV1F MTmV1R | AACCAGGACGTCGTTTCCTTCG AACAGTGTATTGAGGGTGTC | 64.7 63.3 | 328 bp (953–1280) | HG975302 |
© 2018 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Özkan-Kotiloğlu, S.; Coutts, R.H.A. Multiplex Detection of Aspergillus fumigatus Mycoviruses. Viruses 2018, 10, 247. https://doi.org/10.3390/v10050247
Özkan-Kotiloğlu S, Coutts RHA. Multiplex Detection of Aspergillus fumigatus Mycoviruses. Viruses. 2018; 10(5):247. https://doi.org/10.3390/v10050247
Chicago/Turabian StyleÖzkan-Kotiloğlu, Selin, and Robert H. A. Coutts. 2018. "Multiplex Detection of Aspergillus fumigatus Mycoviruses" Viruses 10, no. 5: 247. https://doi.org/10.3390/v10050247