Characterization of an N-Terminal Non-Core Domain of RAG1 Gene Disrupted Syrian Hamster Model Generated by CRISPR Cas9
Abstract
1. Introduction
2. Materials and Methods
2.1. Animals
2.2. Ethics Statement
2.3. Embryo Manipulation and Genotyping of Pups Produced from Injected Embryos
2.4. Western Blotting
2.5. Histology and Immunohistochemistry
2.6. Flow Cytometry
2.7. Reverse Transcriptase Quantitative PCR (RT-qPCR)
2.8. In Vivo Infection of HAdV-C6 in Wild Type and RAG1-86nt Syrian Hamsters
2.9. Determining the Anti-Ad6 Neutralizing Antibody (NAb) Titers in the Serum
2.10. Statistical Analysis
3. Results
3.1. Genetic Targeting of the Non-Core Domain of Hamster RAG1 Protein
3.2. The 86-nt Deletion Abolishes the Expression of Full-Length RAG1 Protein
3.3. Off-Target Effect Analysis
3.4. RAG1-86nt Hamsters Are Atrophic in Lymphoid Organs
3.5. Naïve RAG1-86nt Hamsters Have Severely Reduced Size of T and B Lymphocyte Compartments
3.6. RAG1-86nt Hamsters Develop a Partial Adaptive Immune Response after Intranasal Infection with HAdV-C6
4. Discussion
Author Contributions
Acknowledgments
Conflicts of Interest
References
- Hiom, K.; Gellert, M. A stable RAG1-RAG2-DNA complex that is active in V(D)J cleavage. Cell 1997, 88, 65–72. [Google Scholar] [CrossRef] [Scilit]
- Agrawal, A.; Schatz, D.G. RAG1 and RAG2 form a stable postcleavage synaptic complex with DNA containing signal ends in V(D)J recombination. Cell 1997, 89, 43–53. [Google Scholar] [CrossRef] [Scilit]
- Villa, A.; Santagata, S.; Bozzi, F.; Giliani, S.; Frattini, A.; Imberti, L.; Gatta, L.B.; Ochs, H.D.; Schwarz, K.; Notarangelo, L.D.; et al. Partial V(D)J recombination activity leads to omenn syndrome. Cell 1998, 93, 885–896. [Google Scholar] [CrossRef] [Scilit]
- Yannoutsos, N.; Wilson, P.; Yu, W.; Chen, H.T.; Nussenzweig, A.; Petrie, H.; Nussenzweig, M.C. The role of recombination activating gene (RAG) reinduction in thymocyte development in vivo. J. Exp. Med. 2001, 194, 471–480. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Menoret, S.; Fontaniere, S.; Jantz, D.; Tesson, L.; Thinard, R.; Remy, S.; Usal, C.; Ouisse, L.H.; Fraichard, A.; Anegon, I. Generation of RAG1-knockout immunodeficient rats and mice using engineered meganucleases. FASEB J. 2013, 27, 703–711. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Haake, D.A. Hamster model of leptospirosis. Curr. Protoc. Microbiol. 2006, 12. [Google Scholar] [CrossRef] [Scilit]
- Safronetz, D.; Ebihara, H.; Feldmann, H.; Hooper, J.W. The syrian hamster model of hantavirus pulmonary syndrome. Antivir. Res. 2012, 95, 282–292. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yan, Q.; Zhang, Q.; Yang, H.; Zou, Q.; Tang, C.; Fan, N.; Lai, L. Generation of multi-gene knockout rabbits using the Cas9/gRNA system. Cell Regen. 2014, 3, 12. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Huang, J.; Guo, X.; Fan, N.; Song, J.; Zhao, B.; Ouyang, Z.; Liu, Z.; Zhao, Y.; Yan, Q.; Yi, X.; et al. RAG1/2 knockout pigs with severe combined immunodeficiency. J. Immunol. 2014, 193, 1496–1503. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Suzuki, S.; Iwamoto, M.; Hashimoto, M.; Suzuki, M.; Nakai, M.; Fuchimoto, D.; Sembon, S.; Eguchi-Ogawa, T.; Uenishi, H.; Onishi, A. Generation and characterization of RAG2 knockout pigs as animal model for severe combined immunodeficiency. Vet. Immunol. Immunopathol. 2016, 178, 37–49. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kwan, A.; Abraham, R.S.; Currier, R.; Brower, A.; Andruszewski, K.; Abbott, J.K.; Baker, M.; Ballow, M.; Bartoshesky, L.E.; Bonilla, F.A.; et al. Newborn screening for severe combined immunodeficiency in 11 screening programs in the united states. JAMA 2014, 312, 729–738. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fan, Z.; Li, W.; Lee, S.R.; Meng, Q.; Shi, B.; Bunch, T.D.; White, K.L.; Kong, I.K.; Wang, Z. Efficient gene targeting in golden syrian hamsters by the CRISPR/Cas9 system. PLoS ONE 2014, 9, e109755. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, R.; Miao, J.; Fan, Z.; Song, S.; Kong, I.K.; Wang, Y.; Wang, Z. Production of genetically engineered golden syrian hamsters by pronuclear injection of the CRISPR/Cas9 complex. J. Vis. Exp. 2018. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Toth, K.; Spencer, J.F.; Ying, B.; Tollefson, A.E.; Wold, W.S.M. HAdV-C6 is a more relevant challenge virus than HAdV-C5 for testing antiviral drugs with the immunosuppressed syrian hamster model. Viruses 2017, 9, 147. [Google Scholar] [CrossRef] [Scilit]
- Toth, K.; Lee, S.R.; Ying, B.; Spencer, J.F.; Tollefson, A.E.; Sagartz, J.E.; Kong, I.K.; Wang, Z.; Wold, W.S. STAT2 knockout syrian hamsters support enhanced replication and pathogenicity of human adenovirus, revealing an important role of type I interferon response in viral control. PLoS Pathog. 2015, 11, e1005084. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Santagata, S.; Gomez, C.A.; Sobacchi, C.; Bozzi, F.; Abinun, M.; Pasic, S.; Cortes, P.; Vezzoni, P.; Villa, A. N-terminal RAG1 frameshift mutations in omenn’s syndrome: Internal methionine usage leads to partial V(D)J recombination activity and reveals a fundamental role in vivo for the n-terminal domains. Proc. Natl. Acad. Sci. USA 2000, 97, 14572–14577. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mali, P.; Yang, L.; Esvelt, K.M.; Aach, J.; Guell, M.; DiCarlo, J.E.; Norville, J.E.; Church, G.M. Rna-guided human genome engineering via Cas9. Science 2013, 339, 823–826. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bhatti, Z.; Dhamoon, A. Fatal adenovirus infection in an immunocompetent host. Am. J. Emerg. Med. 2017, 35, 1034. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jones, J.M.; Simkus, C. The roles of the RAG1 and rag2 “non-core” regions in V(D)J recombination and lymphocyte development. Arch. Immunol. Ther. Exp. 2009, 57, 105–116. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cho, S.A.; Park, J.H.; Seok, S.H.; Juhn, J.H.; Kim, S.J.; Ji, H.J.; Choo, Y.S.; Park, J.H. Effect of granulocyte macrophage-colony stimulating factor (GM-CSF) on 5-FU-induced ulcerative mucositis in hamster buccal pouches. Exp. Toxicol. Pathol. 2006, 57, 321–328. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, P.; Li, X.; Wang, J.; Gao, D.; Li, Y.; Li, H.; Chu, Y.; Zhang, Z.; Liu, H.; Jiang, G.; et al. Re-designing interleukin-12 to enhance its safety and potential as an anti-tumor immunotherapeutic agent. Nat. Commun. 2017, 8, 1395. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gowen, B.B.; Westover, J.B.; Miao, J.; Van Wettere, A.J.; Rigas, J.D.; Hickerson, B.T.; Jung, K.H.; Li, R.; Conrad, B.L.; Nielson, S.; et al. Modeling severe fever with thrombocytopenia syndrome virus infection in golden syrian hamsters: Importance of STAT2 in preventing disease and effective treatment with favipiravir. J. Virol. 2017, 91, e01942-16. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Siddharthan, V.; Van Wettere, A.J.; Li, R.; Miao, J.; Wang, Z.; Morrey, J.D.; Julander, J.G. Zika virus infection of adult and fetal STAT2 knock-out hamsters. Virology 2017, 507, 89–95. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zimu Deng, H.L.; Xiaolong, L. RAG1-mediated ubiquitylation of histone H3 is required for chromosomal V(D)J recombination. Cell Res. 2015, 2, 181–192. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tollefson, A.E.; Ying, B.; Spencer, J.F.; Sagartz, J.E.; Wold, W.S.M.; Toth, K. Pathology in permissive syrian hamsters after infection with species c human adenovirus (HAdV-C) is the result of virus replication: HAdV-C6 replicates more and causes more pathology than HAdV-C5. J. Virol. 2017, 91, e00284-17. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Khiong, K.M.M.; Kitabayashi, C.; Ueda, N.; Sawa, S.; Sakamoto, A.; Kotzin, B.L.; Rozzo, S.J.; Ishihara, K.; Verella-Garcia, M.; Kappler, J.; et al. Homeostatically proliferating CD4+ T cells are involved in the pathogenesis of an omenn syndrome murine model. J. Clin. Investig. 2007, 117, 1270–1281. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Marrella, V.P.P.; Casati, A.; Rucci, F.; Frascoli, L.; Gougeon, M.L.; Lemercier, B.; Bosticardo, M.; Ravanini, M.; Battaglia, M.; Roncarolo, M.G.; et al. A hypomorphic R229Q Rag2 mouse mutant recapitulates human omenn syndrome. J. Clin. Investig. 2007, 117, 1260–1269. [Google Scholar] [CrossRef] [Scilit] [PubMed]








| Category | Name | Sequence (5′-3′) | Note |
|---|---|---|---|
| For designated target | GH RAG1-F | AGACAAAGCAATTCACCAAG | For sgRNA/Cas9-RAG1 |
| GH RAG1-R | ATCGGAGAATGCAGATTCTG | For sgRNA/Cas9-RAG1 | |
| For potential off-site targets | OT1F | GGTTGACCTCTGGCCTAGAC | |
| OT1R | CCTGTGCTTTGTTGGTTGTG | ||
| OT2F | CCTATCCGCATTGTCCCATC | ||
| OT2R | ATGGGGCTAATCTGGCGCAG | ||
| For RT-qPCR | CD4-F | CATCGTAACCCAGAACCAGAAA | |
| CD4-R | CCCTCGTATAGACTGTGGTAGAT | ||
| CD8β-F | CCAGAATCCAGAACCACTCACA | ||
| CD8β-R | CGGTCCAAGAAGGGTACAAGAA | ||
| CD3ʏ-F | GAGCACAATCAGTCCCTACAA | ||
| CD3ʏ-R | CTTTGCTCCTTGACACCAATAAG | ||
| CD22-F | CTGCAAGAGGTCTTCCTGTATC | ||
| CD22-R | GAAGACTCGATCCTGGTGTTATT | ||
| IgM Receptor-F | ACCTCAGTTCAGCAAGCAATC | ||
| IgM Receptor-R | CCTTGGTTCTCTCTCCCATACT | ||
| CD94-F | CTCATCTCTAGTGTGCTTGGTG | ||
| CD94-R | ATGGGACATGTTCTTTCAGGAG | ||
| Klrg1-F | GAGGAATGGTAGCCACTGTTT | ||
| Klrg1-R | TGTAAGGAGATGTGAGCCTTTG | ||
| CD68-F | CCTGTCTCTCTCGTTTCCTTATG | ||
| CD68-R | GTGGGAAGGACACGTTGTATT | ||
| RPL18-F | GTTTATGAGTCGCACTAACCG | ||
| RPL18-R | TGTTCTCTCGGCCAGGAA |
| No. Inject Zygotes | No. Survived | No. Embryos (Pups) | No. Litters (Recipients) | No. Positive Pups (%) |
|---|---|---|---|---|
| 119 | 103 | 87 (21) | 3 (3) | 6 (28.6) |
| Off-Targets Sequence (5′-3′) | PAM | Off-Target Score | Sequence ID | Location of Sites | |
|---|---|---|---|---|---|
| OT1 | GGTTTTAGGGATCGATGTCA | AAG | 0.7 | NW_004801621.1 | 2321825 to 2321847 |
| OT2 | GGTTTTAAGGATGGATGTGA | AGG | 0.7 | NW_004801607.1 | 1888496 to 18885018 |
© 2018 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Miao, J.; Ying, B.; Li, R.; Tollefson, A.E.; Spencer, J.F.; Wold, W.S.M.; Song, S.-H.; Kong, I.-K.; Toth, K.; Wang, Y.; et al. Characterization of an N-Terminal Non-Core Domain of RAG1 Gene Disrupted Syrian Hamster Model Generated by CRISPR Cas9. Viruses 2018, 10, 243. https://doi.org/10.3390/v10050243
Miao J, Ying B, Li R, Tollefson AE, Spencer JF, Wold WSM, Song S-H, Kong I-K, Toth K, Wang Y, et al. Characterization of an N-Terminal Non-Core Domain of RAG1 Gene Disrupted Syrian Hamster Model Generated by CRISPR Cas9. Viruses. 2018; 10(5):243. https://doi.org/10.3390/v10050243
Chicago/Turabian StyleMiao, Jinxin, Baoling Ying, Rong Li, Ann E. Tollefson, Jacqueline F. Spencer, William S. M. Wold, Seok-Hwan Song, Il-Keun Kong, Karoly Toth, Yaohe Wang, and et al. 2018. "Characterization of an N-Terminal Non-Core Domain of RAG1 Gene Disrupted Syrian Hamster Model Generated by CRISPR Cas9" Viruses 10, no. 5: 243. https://doi.org/10.3390/v10050243
APA StyleMiao, J., Ying, B., Li, R., Tollefson, A. E., Spencer, J. F., Wold, W. S. M., Song, S.-H., Kong, I.-K., Toth, K., Wang, Y., & Wang, Z. (2018). Characterization of an N-Terminal Non-Core Domain of RAG1 Gene Disrupted Syrian Hamster Model Generated by CRISPR Cas9. Viruses, 10(5), 243. https://doi.org/10.3390/v10050243

