Detailed Characterization of Early HIV-1 Replication Dynamics in Primary Human Macrophages
Abstract
:1. Introduction
2. Materials and Methods
2.1. Cell Culture
2.2. Plasmids
2.3. Antisera and Reagents
2.4. Virus Production and Characterization
2.5. Virus Infection and Transduction, Click-Labeling, and Immunostaining
2.6. Infectivity Assays and Time-of-Addition Experiments
2.7. Detection of HIV-1 RT Products with ddPCR
2.8. Flow Cytometry
2.9. SDS-PAGE and Western Blot
2.10. Microscopy
2.11. Image Analysis
3. Results
3.1. Early HIV-1 Replication Is Slow in Primary Macrophages
3.2. Visualization of HIV-1 RTC/PIC Revealed Timeframe of Nuclear Translocation
3.3. Type and Time of Cell Entry Does Not Affect Replication Kinetics in Macrophages
3.4. Low Availability of dNTPs Restricts HIV-1 Replication in MDMs
4. Discussion
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Stevenson, M. HIV-1 pathogenesis. Nat. Med. 2003, 9, 853–860. [Google Scholar] [CrossRef] [PubMed]
- Gartner, S.; Markovits, P.; Markovitz, D.M.; Kaplan, M.H.; Gallo, R.C.; Popovic, M. The role of mononuclear phagocytes in HTLV-III/LAV infection. Science 1986, 233, 215–219. [Google Scholar] [CrossRef] [PubMed]
- Wiley, C.A.; Schrier, R.D.; Nelson, J.A.; Lampert, P.W.; Oldstone, M.B. Cellular localization of human immunodeficiency virus infection within the brains of acquired immune deficiency syndrome patients. Proc. Natl. Acad. Sci. USA 1986, 83, 7089–7093. [Google Scholar] [CrossRef] [PubMed]
- Weinberg, J.B.; Matthews, T.J.; Cullen, B.R.; Malim, M.H. Productive human immunodeficiency virus type 1 (HIV-1) infection of nonproliferating human monocytes. J. Exp. Med. 1991, 174, 1477–1482. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Igarashi, T.; Brown, C.R.; Endo, Y.; Buckler-White, A.; Plishka, R.; Bischofberger, N.; Hirsch, V.; Martin, M.A. Macrophage are the principal reservoir and sustain high virus loads in rhesus macaques after the depletion of CD4+ T cells by a highly pathogenic simian immunodeficiency virus/HIV type 1 chimera (SHIV): Implications for HIV-1 infections of humans. Proc. Natl. Acad. Sci. USA 2001, 98, 658–663. [Google Scholar] [CrossRef] [PubMed]
- Srivastava, K.K.; Fernandez-Larsson, R.; Zinkus, D.M.; Robinson, H.L. Human immunodeficiency virus type 1 NL4-3 replication in four T-cell lines: Rate and efficiency of entry, a major determinant of permissiveness. J. Virol. 1991, 65, 3900–3902. [Google Scholar] [PubMed]
- Fernandez-Larsson, R.; Srivastava, K.K.; Lu, S.; Robinson, H.L. Replication of patient isolates of human immunodeficiency virus type 1 in T cells: A spectrum of rates and efficiencies of entry. Proc. Natl. Acad. Sci. USA 1992, 89, 2223–2226. [Google Scholar] [CrossRef] [PubMed]
- Murray, J.M.; Kelleher, A.D.; Cooper, D.A. Timing of the components of the HIV life cycle in productively infected CD4+ T cells in a population of HIV-infected individuals. J. Virol. 2011, 85, 10798–10805. [Google Scholar] [CrossRef] [PubMed]
- Holmes, M.; Zhang, F.; Bieniasz, P.D. Single-Cell and Single-Cycle Analysis of HIV-1 Replication. PLoS Pathog. 2015, 11, e1004961. [Google Scholar] [CrossRef] [PubMed]
- Tomaras, G.D.; Lacey, S.F.; McDanal, C.B.; Ferrari, G.; Weinhold, K.J.; Greenberg, M.L. CD8+ T cell-mediated suppressive activity inhibits HIV-1 after virus entry with kinetics indicating effects on virus gene expression. Proc. Natl. Acad. Sci. USA 2000, 97, 3503–3508. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Collman, R.; Hassan, N.F.; Walker, R.; Godfrey, B.; Cutilli, J.; Hastings, J.C.; Friedman, H.; Douglas, S.D.; Nathanson, N. Infection of monocyte-derived macrophages with human immunodeficiency virus type 1 (HIV-1). Monocyte-tropic and lymphocyte-tropic strains of HIV-1 show distinctive patterns of replication in a panel of cell types. J. Exp. Med. 1989, 170, 1149–1163. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Rich, E.A.; Chen, I.S.; Zack, J.A.; Leonard, M.L.; O’Brien, W.A. Increased susceptibility of differentiated mononuclear phagocytes to productive infection with human immunodeficiency virus-1 (HIV-1). J. Clin. Investig. 1992, 89, 176–183. [Google Scholar] [CrossRef] [PubMed]
- Fouchier, R.A.; Brouwer, M.; Kootstra, N.A.; Huisman, H.G.; Schuitemaker, H. HIV-1 macrophage tropism is determined at multiple levels of the viral replication cycle. J. Clin. Investig. 1994, 94, 1806–1814. [Google Scholar] [CrossRef] [PubMed]
- Koyanagi, Y.; O’Brien, W.A.; Zhao, J.Q.; Golde, D.W.; Gasson, J.C.; Chen, I.S. Cytokines alter production of HIV-1 from primary mononuclear phagocytes. Science 1988, 241, 1673–1675. [Google Scholar] [CrossRef] [PubMed]
- Cassol, E.; Cassetta, L.; Rizzi, C.; Alfano, M.; Poli, G. M1 and M2a polarization of human monocyte-derived macrophages inhibits HIV-1 replication by distinct mechanisms. J. Immunol. 2009, 182, 6237–6246. [Google Scholar] [CrossRef] [PubMed]
- Munis, J.R.; Kornbluth, R.S.; Guatelli, J.C.; Richman, D.D. Ordered appearance of human immunodeficiency virus type 1 nucleic acids following high multiplicity infection of macrophages. J. Gen. Virol. 1992, 73 Pt 8, 1899–1906. [Google Scholar] [CrossRef] [Green Version]
- Collin, M.; Gordon, S. The kinetics of human immunodeficiency virus reverse transcription are slower in primary human macrophages than in a lymphoid cell line. Virology 1994, 200, 114–120. [Google Scholar] [CrossRef] [PubMed]
- Stultz, R.D.; Cenker, J.J.; McDonald, D. Imaging HIV-1 Genomic DNA from Entry through Productive Infection. J. Virol. 2017, 91, e00034-17. [Google Scholar] [CrossRef] [PubMed]
- O’Brien, W.A.; Namazi, A.; Kalhor, H.; Mao, S.H.; Zack, J.A.; Chen, I.S. Kinetics of human immunodeficiency virus type 1 reverse transcription in blood mononuclear phagocytes are slowed by limitations of nucleotide precursors. J. Virol. 1994, 68, 1258–1263. [Google Scholar] [PubMed]
- Meyerhans, A.; Vartanian, J.P.; Hultgren, C.; Plikat, U.; Karlsson, A.; Wang, L.; Eriksson, S.; Wain-Hobson, S. Restriction and enhancement of human immunodeficiency virus type 1 replication by modulation of intracellular deoxynucleoside triphosphate pools. J. Virol. 1994, 68, 535–540. [Google Scholar] [PubMed]
- Diamond, T.L.; Roshal, M.; Jamburuthugoda, V.K.; Reynolds, H.M.; Merriam, A.R.; Lee, K.Y.; Balakrishnan, M.; Bambara, R.A.; Planelles, V.; Dewhurst, S.; et al. Macrophage tropism of HIV-1 depends on efficient cellular dNTP utilization by reverse transcriptase. J. Biol. Chem. 2004, 279, 51545–51553. [Google Scholar] [CrossRef] [PubMed]
- Goldstone, D.C.; Ennis-Adeniran, V.; Hedden, J.J.; Groom, H.C.; Rice, G.I.; Christodoulou, E.; Walker, P.A.; Kelly, G.; Haire, L.F.; Yap, M.W.; et al. HIV-1 restriction factor SAMHD1 is a deoxynucleoside triphosphate triphosphohydrolase. Nature 2011, 480, 379–382. [Google Scholar] [CrossRef] [PubMed]
- Laguette, N.; Sobhian, B.; Casartelli, N.; Ringeard, M.; Chable-Bessia, C.; Segeral, E.; Yatim, A.; Emiliani, S.; Schwartz, O.; Benkirane, M. SAMHD1 is the dendritic- and myeloid-cell-specific HIV-1 restriction factor counteracted by Vpx. Nature 2011, 474, 654–657. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hollenbaugh, J.A.; Tao, S.; Lenzi, G.M.; Ryu, S.; Kim, D.H.; Diaz-Griffero, F.; Schinazi, R.F.; Kim, B. dNTP pool modulation dynamics by SAMHD1 protein in monocyte-derived macrophages. Retrovirology 2014, 11, 63. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lahouassa, H.; Daddacha, W.; Hofmann, H.; Ayinde, D.; Logue, E.C.; Dragin, L.; Bloch, N.; Maudet, C.; Bertrand, M.; Gramberg, T.; et al. SAMHD1 restricts the replication of human immunodeficiency virus type 1 by depleting the intracellular pool of deoxynucleoside triphosphates. Nat. Immunol. 2012, 13, 223–228. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Franchini, G.; Gurgo, C.; Guo, H.G.; Gallo, R.C.; Collalti, E.; Fargnoli, K.A.; Hall, L.F.; Wong-Staal, F.; Reitz, M.S., Jr. Sequence of simian immunodeficiency virus and its relationship to the human immunodeficiency viruses. Nature 1987, 328, 539–543. [Google Scholar] [CrossRef] [PubMed]
- Guyader, M.; Emerman, M.; Sonigo, P.; Clavel, F.; Montagnier, L.; Alizon, M. Genome organization and transactivation of the human immunodeficiency virus type 2. Nature 1987, 326, 662–669. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Goujon, C.; Arfi, V.; Pertel, T.; Luban, J.; Lienard, J.; Rigal, D.; Darlix, J.L.; Cimarelli, A. Characterization of Simian Immunodeficiency Virus SIVSM/Human Immunodeficiency Virus Type 2 Vpx Function in Human Myeloid Cells. J. Virol. 2008, 82, 12335–12345. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hrecka, K.; Hao, C.; Gierszewska, M.; Swanson, S.K.; Kesik-Brodacka, M.; Srivastava, S.; Florens, L.; Washburn, M.P.; Skowronski, J. Vpx relieves inhibition of HIV-1 infection of macrophages mediated by the SAMHD1 protein. Nature 2011, 474, 658–661. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hofmann, H.; Logue, E.C.; Bloch, N.; Daddacha, W.; Polsky, S.B.; Schultz, M.L.; Kim, B.; Landau, N.R. The Vpx Lentiviral Accessory Protein Targets SAMHD1 for Degradation in the Nucleus. J. Virol. 2012, 86, 12552–12560. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Triques, K.; Stevenson, M. Characterization of restrictions to human immunodeficiency virus type 1 infection of monocytes. J. Virol. 2004, 78, 5523–5527. [Google Scholar] [CrossRef] [PubMed]
- Kim, B.; Nguyen, L.A.; Daddacha, W.; Hollenbaugh, J.A. Tight interplay among SAMHD1 protein level, cellular dNTP levels, and HIV-1 proviral DNA synthesis kinetics in human primary monocyte-derived macrophages. J. Biol. Chem. 2012, 287, 21570–21574. [Google Scholar] [CrossRef] [PubMed]
- Pear, W.S.; Nolan, G.P.; Scott, M.L.; Baltimore, D. Production of high-titer helper-free retroviruses by transient transfection. Proc. Natl. Acad. Sci. USA 1993, 90, 8392–8396. [Google Scholar] [CrossRef] [PubMed]
- Wei, X.; Decker, J.M.; Liu, H.; Zhang, Z.; Arani, R.B.; Kilby, J.M.; Saag, M.S.; Wu, X.; Shaw, G.M.; Kappes, J.C. Emergence of resistant human immunodeficiency virus type 1 in patients receiving fusion inhibitor (T-20) monotherapy. Antimicrob. Agents Chemother. 2002, 46, 1896–1905. [Google Scholar] [CrossRef] [PubMed]
- Adachi, A.; Gendelman, H.E.; Koenig, S.; Folks, T.; Willey, R.; Rabson, A.; Martin, M.A. Production of acquired immunodeficiency syndrome-associated retrovirus in human and nonhuman cells transfected with an infectious molecular clone. J. Virol. 1986, 59, 284–291. [Google Scholar] [PubMed]
- Schnell, G.; Joseph, S.; Spudich, S.; Price, R.W.; Swanstrom, R. HIV-1 replication in the central nervous system occurs in two distinct cell types. PLoS Pathog. 2011, 7, e1002286. [Google Scholar] [CrossRef] [PubMed]
- Albanese, A.; Arosio, D.; Terreni, M.; Cereseto, A. HIV-1 pre-integration complexes selectively target decondensed chromatin in the nuclear periphery. PLoS ONE 2008, 3, e2413. [Google Scholar] [CrossRef] [PubMed]
- Pertel, T.; Reinhard, C.; Luban, J. Vpx rescues HIV-1 transduction of dendritic cells from the antiviral state established by type 1 interferon. Retrovirology 2011, 8, 49. [Google Scholar] [CrossRef] [PubMed]
- Sunseri, N.; O’Brien, M.; Bhardwaj, N.; Landau, N.R. Human Immunodeficiency Virus Type 1 Modified To Package Simian Immunodeficiency Virus Vpx Efficiently Infects Macrophages and Dendritic Cells. J. Virol. 2011, 85, 6263–6274. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Pizzato, M.; Erlwein, O.; Bonsall, D.; Kaye, S.; Muir, D.; McClure, M.O. A one-step SYBR Green I-based product-enhanced reverse transcriptase assay for the quantitation of retroviruses in cell culture supernatants. J. Virol. Methods 2009, 156, 1–7. [Google Scholar] [CrossRef] [PubMed]
- Moron-Lopez, S.; Puertas, M.C.; Galvez, C.; Navarro, J.; Carrasco, A.; Esteve, M.; Manye, J.; Crespo, M.; Salgado, M.; Martinez-Picado, J. Sensitive quantification of the HIV-1 reservoir in gut-associated lymphoid tissue. PLoS ONE 2017, 12, e0175899. [Google Scholar] [CrossRef] [PubMed]
- Hindson, B.J.; Ness, K.D.; Masquelier, D.A.; Belgrader, P.; Heredia, N.J.; Makarewicz, A.J.; Bright, I.J.; Lucero, M.Y.; Hiddessen, A.L.; Legler, T.C.; et al. High-throughput droplet digital PCR system for absolute quantitation of DNA copy number. Anal. Chem. 2011, 83, 8604–8610. [Google Scholar] [CrossRef] [PubMed]
- Liszewski, M.K.; Yu, J.J.; O’Doherty, U. Detecting HIV-1 integration by repetitive-sampling Alu-gag PCR. Methods 2009, 47, 254–260. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Palmer, S.; Wiegand, A.P.; Maldarelli, F.; Bazmi, H.; Mican, J.M.; Polis, M.; Dewar, R.L.; Planta, A.; Liu, S.; Metcalf, J.A.; et al. New real-time reverse transcriptase-initiated PCR assay with single-copy sensitivity for human immunodeficiency virus type 1 RNA in plasma. J. Clin. Microbiol. 2003, 41, 4531–4536. [Google Scholar] [CrossRef] [PubMed]
- Puertas, M.C.; Gomez-Mora, E.; Santos, J.R.; Molto, J.; Urrea, V.; Moron-Lopez, S.; Hernandez-Rodriguez, A.; Marfil, S.; Martinez-Bonet, M.; Matas, L.; et al. Impact of intensification with raltegravir on HIV-1-infected individuals receiving monotherapy with boosted PIs. J. Antimicrob. Chemother. 2018. [Google Scholar] [CrossRef] [PubMed]
- Borner, K.; Hermle, J.; Sommer, C.; Brown, N.P.; Knapp, B.; Glass, B.; Kunkel, J.; Torralba, G.; Reymann, J.; Beil, N.; et al. From experimental setup to bioinformatics: An RNAi screening platform to identify host factors involved in HIV-1 replication. Biotechnol. J. 2010, 5, 39–49. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Martinez, F.O.; Sica, A.; Mantovani, A.; Locati, M. Macrophage activation and polarization. Front. Biosci. 2008, 13, 453–461. [Google Scholar] [CrossRef] [PubMed]
- Barros, M.H.; Hauck, F.; Dreyer, J.H.; Kempkes, B.; Niedobitek, G. Macrophage polarisation: An immunohistochemical approach for identifying M1 and M2 macrophages. PLoS ONE 2013, 8, e80908. [Google Scholar] [CrossRef] [PubMed]
- Gobeil, L.A.; Lodge, R.; Tremblay, M.J. Differential HIV-1 endocytosis and susceptibility to virus infection in human macrophages correlate with cell activation status. J. Virol. 2012, 86, 10399–10407. [Google Scholar] [CrossRef] [PubMed]
- Peng, K.; Muranyi, W.; Glass, B.; Laketa, V.; Yant, S.R.; Tsai, L.; Cihlar, T.; Muller, B.; Krausslich, H.G. Quantitative microscopy of functional HIV post-entry complexes reveals association of replication with the viral capsid. eLife 2014, 3, e04114. [Google Scholar] [CrossRef] [PubMed]
- Saito, A.; Ferhadian, D.; Sowd, G.A.; Serrao, E.; Shi, J.; Halambage, U.D.; Teng, S.; Soto, J.; Siddiqui, M.A.; Engelman, A.N.; et al. Roles of Capsid-Interacting Host Factors in Multimodal Inhibition of HIV-1 by PF74. J. Virol. 2016, 90, 5808–5823. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Shi, J.; Zhou, J.; Shah, V.B.; Aiken, C.; Whitby, K. Small-molecule inhibition of human immunodeficiency virus type 1 infection by virus capsid destabilization. J. Virol. 2011, 85, 542–549. [Google Scholar] [CrossRef] [PubMed]
- Sharkey, M.E.; Teo, I.; Greenough, T.; Sharova, N.; Luzuriaga, K.; Sullivan, J.L.; Bucy, R.P.; Kostrikis, L.G.; Haase, A.; Veryard, C.; et al. Persistence of episomal HIV-1 infection intermediates in patients on highly active anti-retroviral therapy. Nat. Med. 2000, 6, 76–81. [Google Scholar] [CrossRef] [PubMed]
- Burdick, R.C.; Delviks-Frankenberry, K.A.; Chen, J.; Janaka, S.K.; Sastri, J.; Hu, W.S.; Pathak, V.K. Dynamics and regulation of nuclear import and nuclear movements of HIV-1 complexes. PLoS Pathog. 2017, 13, e1006570. [Google Scholar] [CrossRef] [PubMed]
- Francis, A.C.; Melikyan, G.B. Single HIV-1 Imaging Reveals Progression of Infection through CA-Dependent Steps of Docking at the Nuclear Pore, Uncoating, and Nuclear Transport. Cell Host Microbe 2018, 23, 536–548. [Google Scholar] [CrossRef] [PubMed]
- Schroers, R.; Sinha, I.; Segall, H.; Schmidt-Wolf, I.G.; Rooney, C.M.; Brenner, M.K.; Sutton, R.E.; Chen, S.Y. Transduction of human PBMC-derived dendritic cells and macrophages by an HIV-1-based lentiviral vector system. Mol. Ther. 2000, 1, 171–179. [Google Scholar] [CrossRef] [PubMed]
- Neil, S.; Martin, F.; Ikeda, Y.; Collins, M. Postentry restriction to human immunodeficiency virus-based vector transduction in human monocytes. J. Virol. 2001, 75, 5448–5456. [Google Scholar] [CrossRef] [PubMed]
- Matlin, K.S.; Reggio, H.; Helenius, A.; Simons, K. Pathway of vesicular stomatitis virus entry leading to infection. J. Mol. Biol. 1982, 156, 609–631. [Google Scholar] [CrossRef]
- Aiken, C. Pseudotyping human immunodeficiency virus type 1 (HIV-1) by the glycoprotein of vesicular stomatitis virus targets HIV-1 entry to an endocytic pathway and suppresses both the requirement for Nef and the sensitivity to cyclosporin A. J. Virol. 1997, 71, 5871–5877. [Google Scholar] [PubMed]
- Amie, S.M.; Noble, E.; Kim, B. Intracellular Nucleotide Levels and the Control of Retroviral Infections. Virology 2013, 436, 247–254. [Google Scholar] [CrossRef] [PubMed]
- Ahn, J.; Hao, C.; Yan, J.; DeLucia, M.; Mehrens, J.; Wang, C.; Gronenborn, A.M.; Skowronski, J. HIV/simian immunodeficiency virus (SIV) accessory virulence factor Vpx loads the host cell restriction factor SAMHD1 onto the E3 ubiquitin ligase complex CRL4DCAF1. J. Biol. Chem. 2012, 287, 12550–12558. [Google Scholar] [CrossRef] [PubMed]
- Chin, C.R.; Perreira, J.M.; Savidis, G.; Portmann, J.M.; Aker, A.M.; Feeley, E.M.; Smith, M.C.; Brass, A.L. Direct Visualization of HIV-1 Replication Intermediates Shows that Capsid and CPSF6 Modulate HIV-1 Intra-nuclear Invasion and Integration. Cell Rep. 2015, 13, 1717–1731. [Google Scholar] [CrossRef] [PubMed]
- Herold, N.; Anders-Osswein, M.; Glass, B.; Eckhardt, M.; Muller, B.; Krausslich, H.G. HIV-1 entry in SupT1-R5, CEM-ss, and primary CD4+ T cells occurs at the plasma membrane and does not require endocytosis. J. Virol. 2014, 88, 13956–13970. [Google Scholar] [CrossRef] [PubMed]
- Miyauchi, K.; Kim, Y.; Latinovic, O.; Morozov, V.; Melikyan, G.B. HIV Enters Cells via Endocytosis and Dynamin-Dependent Fusion with Endosomes. Cell 2009, 137, 433–444. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Marechal, V.; Prevost, M.C.; Petit, C.; Perret, E.; Heard, J.M.; Schwartz, O. Human immunodeficiency virus type 1 entry into macrophages mediated by macropinocytosis. J. Virol. 2001, 75, 11166–11177. [Google Scholar] [CrossRef] [PubMed]
- Bol, S.M.; van Remmerden, Y.; Sietzema, J.G.; Kootstra, N.A.; Schuitemaker, H.; van’t Wout, A.B. Donor variation in in vitro HIV-1 susceptibility of monocyte-derived macrophages. Virology 2009, 390, 205–211. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zennou, V.; Petit, C.; Guetard, D.; Nerhbass, U.; Montagnier, L.; Charneau, P. HIV-1 genome nuclear import is mediated by a central DNA flap. Cell 2000, 101, 173–185. [Google Scholar] [CrossRef]
- Arhel, N.; Munier, S.; Souque, P.; Mollier, K.; Charneau, P. Nuclear import defect of human immunodeficiency virus type 1 DNA flap mutants is not dependent on the viral strain or target cell type. J. Virol. 2006, 80, 10262–10269. [Google Scholar] [CrossRef] [PubMed]
- Goujon, C.; Jarrosson-Wuilleme, L.; Bernaud, J.; Rigal, D.; Darlix, J.L.; Cimarelli, A. With a little help from a friend: Increasing HIV transduction of monocyte-derived dendritic cells with virion-like particles of SIV(MAC). Gene Ther. 2006, 13, 991–994. [Google Scholar] [CrossRef] [PubMed]
- Butler, S.L.; Hansen, M.S.; Bushman, F.D. A quantitative assay for HIV DNA integration in vivo. Nat. Med. 2001, 7, 631–634. [Google Scholar] [CrossRef] [PubMed]
Target | Sequence (5′–3′) | Reference |
---|---|---|
5′-LTR Fw | TTAAGCCTCAATAAAGCTTGCC | [43] |
5′-LTR Rv | GTTCGGGCGCCACTGCTAG | |
5′-LTR Probe | FAM–CCAGAGTCACACAACAGACGGGCA–BHQ1 | |
Gag Fw | CATGTTTTCAGCATTATCAGAAGGA | [44] |
Gag Rv | TGCTTGATGTCCCCCCACT | |
Gag Probe | HEX—CCACCCCACAAGATTTAAACACCATGCTAA–BHQ1 | |
2-LTR Fw | CTAACTAGGGAACCCACTGCT | [45] |
2-LTR Rv | GTAGTTCTGCCAATCAGGGAA | |
2-LTR Probe | FAM—AGCCTCAATAAAGCTTGCCTTGAGTGC–BHQ1 | |
RPP30 Fw | GATTTGGACCTGCGAGCG | [42] |
RPP30 Rv | GCGGCTGTCTCCACAAGT | |
RPP30 Probe | FAM–CTGACCTGAAGGCTCT–BHQ1 |
© 2018 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Bejarano, D.A.; Puertas, M.C.; Börner, K.; Martinez-Picado, J.; Müller, B.; Kräusslich, H.-G. Detailed Characterization of Early HIV-1 Replication Dynamics in Primary Human Macrophages. Viruses 2018, 10, 620. https://doi.org/10.3390/v10110620
Bejarano DA, Puertas MC, Börner K, Martinez-Picado J, Müller B, Kräusslich H-G. Detailed Characterization of Early HIV-1 Replication Dynamics in Primary Human Macrophages. Viruses. 2018; 10(11):620. https://doi.org/10.3390/v10110620
Chicago/Turabian StyleBejarano, David Alejandro, Maria C. Puertas, Kathleen Börner, Javier Martinez-Picado, Barbara Müller, and Hans-Georg Kräusslich. 2018. "Detailed Characterization of Early HIV-1 Replication Dynamics in Primary Human Macrophages" Viruses 10, no. 11: 620. https://doi.org/10.3390/v10110620