Next Article in Journal
Characterization of Shoot Growth and Carbon Accumulation in Moso Bamboo Based on Different Stand Densities
Previous Article in Journal
LHRF-YOLO: A Lightweight Model with Hybrid Receptive Field for Forest Fire Detection
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Forests
Volume 16
Issue 7
10.3390/f16071096
forests-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Responses of Different Soil Microbial Communities to the Addition of Nitrogen into the Soil of Larix gmelinii var. principis-rupprechtii (Mayr) Pilg. Plantations

by
Yanlong Jia
1,2,*,†,
Ziyi Wang
2,†,
Hongna Cui
2,
Liu Yang
2,3,
Jinping Lu
4,
Jiaojiao Ma
4,
Zhongqi Xu
2 and
Honglin He
1
1
Key Laboratory of Ecosystem Network Observation and Modeling, Institute of Geographic Sciences and Natural Resources Research, Chinese Academy of Sciences, Beijing 100101, China
2
College of Forestry, Hebei Agricultural University, Baoding 071001, China
3
Shijiazhuang Information Engineering Vocational College, Shijiazhuang 050035, China
4
Mulanweichang National Forestry Administration of Hebei Province, Chengde 068450, China
*
Author to whom correspondence should be addressed.
†
These authors contributed equally to this work.
Forests 2025, 16(7), 1096; https://doi.org/10.3390/f16071096
Submission received: 31 May 2025 / Revised: 25 June 2025 / Accepted: 1 July 2025 / Published: 2 July 2025
(This article belongs to the Section Forest Ecology and Management)
Browse Figures
Versions Notes

Abstract

The increasing rate of atmospheric nitrogen (N) deposition caused by human activities is a global concern. A rise in N deposition can alter the soil microbial community, as demonstrated by most long-term N addition experiments. Nevertheless, it remains unknown how short-term N addition influences the early succession of the soil microbial community in forests. In this study, the responses of the soil microbial community to multi-level and short-term (one-year) N addition in the soil of Larix gmelinii var. principis-rupprechtii (Mayr) Pilg. plantations in the Yanshan Mountains were explored. We used high-throughput sequencing technology to analyze the 16S rRNA of bacteria, the ITS gene of fungi, and the nifH functional gene of N-fixing bacteria. The results revealed a decrease in N-fixing functional gene abundance (such as nifH) and a slight rise in fungal and bacterial copy number due to N addition. N addition influenced the N-fixing bacterial community but had no influence on the fungal and bacterial communities in general. It drastically decreased the diversity of N-fixing microbial communities while having little impact on the diversity of fungi and bacteria. The NO3−-N concentration exhibited a negative connection with the Shannon–Wiener index of the N-fixing microbial community when it exceeded a specific limit. Actinomycetes and N-fixing bacteria were significantly negatively correlated. The changes in soil NO3−-N concentration and abundance of actinomycetes were the main reasons for the decrease in N-fixing microbial community diversity. The results of this study set the groundwork for exploring the initial succession mechanisms of soil microorganisms after N addition. This study offers a scientific theoretical basis for precise management of plantations under N deposition.

1. Introduction

Extensive use and exploitation of fossil fuels and the growth of stock raising have increased atmospheric nitrogen (N) deposition and the release of various reactive N compounds into the environment in recent years [1]. Between 1860 and 1995, global N deposition increased by 3–5 times and is predicted to reach 200 Tg N yr−1 by 2050 [2]. China experiences the highest N deposition globally. According to studies, China’s total N deposition increased initially before stabilizing between 1980 and 2010 and then declined between 2010 and 2020. Despite this, the country’s total N deposition remains extremely high, reaching 13 Tg N yr−1, particularly in the North China Plain [3,4]. Modest N deposition can boost plant yields, as microbial growth and plant proliferation depend on soil N content [5,6]. For example, the right amount of N deposition increased the diameter at breast height growth by 20%–30% [7]. Nevertheless, excessive N input can adversely impact ecosystems, causing nutrient loss and soil acidification, water pollution and eutrophication, changes in the stoichiometric chemistry of ecosystem elements, a reduction in biodiversity and species composition, lower productivity, and weaker stability [1,8].
Most studies exploring the influence of N deposition on forest ecosystems have concentrated on the various aspects of forest plants affected by N deposition, including the aboveground morphological index, root system, photosynthetic physiology, biomass allocation, and stoichiometric ratio [9]. N deposition usually results in a decline in plant diversity; for example, N deposition decreased the frequency of K. cristata, A. tenuissimum, and A. scoparia (p < 0.05) [10,11,12]. Soil microorganisms are crucial for energy and material cycling in forests, thereby serving as the most active component of forest soils [13]. These microorganisms can be affected by N deposition in a variety of ways. As technology has advanced, researchers have increasingly studied soil microorganisms. Studies have found that N addition immediately raises the accessible N content in soil, which alters the soil nutrients and affects the composition of soil microbial communities [14]. In certain forest ecosystems, for instance, N deposition lowered the fungal biomass and changed the composition of fungal communities. For example, N addition reduced fungal biomass by an average of 19.2% [15,16]. Furthermore, when environmental N deposition was low, fungal richness and biomass rose when N fertilizer was added. However, as N fertilizer application increased, fungal biomass and richness dropped under high environmental N deposition [17]. In earlier research, N addition to the soil resulted in a higher relative abundance (RA) of eutrophic groups and lower abundance of oligotrophic groups [18,19,20]. The catabolic potential of the microbial community was also obviously influenced by the degree of N addition [21]. Nevertheless, the impacts of short-term N addition on soil microorganisms and the underlying potential causes remain unknown, as the majority of studies on simulated N deposition, or N addition experiments, have focused on the influence of long-term fertilization on the composition and structure of soil microbial communities. To fully comprehend the influence of N deposition on the soil ecosystem, it is essential to explore microbial communities’ responses and response mechanisms to short-term N deposition while considering the impact on them of long-term N deposition.
Through multi-gradient N addition field control experiments, quantitative polymerase chain reaction (qPCR), and high-throughput sequencing (HTS), we studied the impacts of short-term (one-year) N deposition on the diversity, abundance, and composition of soil fungal and bacterial communities in Larix gmelinii var. principis-rupprechtii (Mayr) Pilg. plantations, a typical forest ecosystem in the northern area of the Yanshan Mountains. This study aimed to: (1) investigate the succession of soil microorganisms during the initial stages of N deposition; and (2) determine the mechanism of soil microbial succession during the initial stages of N deposition. Since different microorganisms respond differently to N, we postulated that N-sensitive microbial communities (such as N-fixing microorganisms) would initiate the process of community succession first, with little impact on the soil fungal and bacterial communities in the initial stages of N deposition. This study aims to offer a scientific foundation for exploring the initial succession mechanisms of soil microorganisms in response to N fertilization. The results from this study will be useful in realizing the early response of the soil microbial community to N deposition in forests.

2. Materials and Methods

2.1. Study Sites

The study site was situated in the Mengluan branch of the Mulanweichang state-owned forest farm in the northern Yanshan Mountains in Weichang County, Chengde City, Hebei Province (41°35′ N, 116°32′ E, 750–1850 m above sea level). Here, N addition experiments were conducted, simulating warm temperate forest soils. The area has a continental monsoon climate. Its annual average temperature is 3.3 °C. Annual precipitation ranges from 300 to 560 mm. The main vegetation type is Larix gmelinii var. principis-rupprechtii (Mayr) Pilg. Over 70% of the annual precipitation occurs between July and August. In addition, the area has brown loam soil with pH~6.0, which is typical of forests.

2.2. Experimental Design

In July 2018, 28 randomly arranged 20 m × 20 m sample plots, spaced 10 m apart, were set along the hillside contour line. To prevent human and animal interference, every plot was walled. The plot types were all 30-year-old Larix gmelinii var. principis-rupprechtii (Mayr) Pilg. plantations, with an average density of 1490 trees ha−1, an average diameter at breast height of 12.44 cm, an average tree height of 9.15 m, and an average crown width of 1.54 m. Prior to fertilizing the soil, we collected soil samples from the surface layer (0–10 cm) at each plot using the five-point sample method. The pH, total nitrogen (TN), total phosphorus (TP), soil organic carbon (SOC), available phosphorus (AP), NO3−-N, and NH4+-N contents of the soil were assessed. There was no discernible difference in the soil nutrients among the sample plots, and the soil was suitable for N addition experiments. This region’s annual atmospheric wet N-deposition flow is 5.03 kg N ha−1 year−1, with 88% of deposition occurring during the growing season of May to September, as measured by the rain gauge method [5]. According to the background N deposition data of this region, 7 levels of N addition were set up in this experiment, with each level having 4 replicates. The seven levels of N addition were 0 (N0), 5 (N5), 10 (N10), 20 (N20), 40 (N40), 80 (N80), and 160 (N160) kg N ha−1 yr−1. Soil fertilization began in August 2019 by spraying urea, and the N addition plan will last for 20 years. Urea was dissolved in 40 L of water and uniformly applied to the soil surface of the plots. Throughout the growing season, fertilization was split up each month. The plots with 0 kg N ha−1 yr−1 addition were used as controls. To avoid differences caused by water input, the control plots were sprayed with an equal volume of plain water.

2.3. Field Sampling

In August 2020, we collected soil samples using the five-point sampling method. In addition to one from the center, four samples were taken from the diagonal points of each sample plot, which were equally spaced from the central sampling point. After removing the litter, the 5 soil cores (5 cm diameter, 10 cm deep) were collected along an S-shaped pattern, and these were thoroughly mixed into one sample. An incubator containing ice cubes was used to transfer soil samples from the experimental site to the laboratory. After mixing the soil samples and removing the stones, litter, and fine roots, a 2 mm sieve was used to separate the soil into two halves. One part of the sample was stored in a thermostat at 4 °C for soil physical and chemical analysis. For example, soil nitrates (NO3−) and ammonia (NH4+) contents were analyzed using an automatic analysis system (SEAL Analytical GmbH, Norderstedt, Germany). The rest of the sample was kept in a refrigerator at −80 °C for DNA extraction.

2.4. Soil Property Analysis

Soil pH was detected using the conductance method. The SOC was analyzed by a total organic carbon analyzer. TN was measured using the Automatic Kjeldahl nitrogen meter. TP was detected using the NaOH melting-molybdenum-antimony resistance colorimetric method. The total potassium (TK) was detected with the NaOH melting-flame photometer method. AP was analyzed using the NaHCO3− molybdenum-antimony resistance colorimetric method. The available potassium (AK) was measured using the ammonium acetate-flame photometer method. NH4+-N was detected using the KCl extraction–distillation method. NO3−-N was analyzed using the 0.5 g CaSO4·2H2O and 250 mL water extraction–distillation method [22,23].

2.5. DNA Extraction and qPCR Amplification

First, 0.5 g of fresh soil was weighed, and DNA was then extracted from it using the Soil DNA Kit (D5635-02, Omega Bio-Tek, Norcross, GA, USA), following the kit operating instructions. After extraction, the molecular size of the DNA was determined using 0.8% agarose gel electrophoresis. Subsequently, the DNA concentration was quantified using a Nanodrop NC2000 UV spectrophotometer (Thermo Scientific, Waltham, MA, USA). After a quality check, DNA samples were stored at −80 °C for later use. The primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) were used to amplify the fungal ITS1 region of DNA using PCR. On the other hand, primers 338F (ACTCCTACGGGAGGCAGCA) and 806R (GGACTACHVGGGTWTCTAAT) were used to amplify the V3–V4 region of bacterial 16S rRNA. Similarly, N-fixing bacterial genes (nifH) were amplified through PCR using primers nifH-F (TGCGAYCCSAARGCBGACTC) and nifH-R (ATSGCCATCATYTCRCCGGA). Real-time fluorescence quantitative PCR (PCR, EDC-810, Beijing) was used for measuring the concentration of DNA. Subsequently, the Illumina MiSeq platform was used to sequence the PCR products. The original sequence data obtained were subjected to quality control, splicing, and clustering into operational taxonomic units (OTUs) at 97% similarity. In terms of species annotation, the taxonomical information for fungi and bacteria was annotated using the Unite database (http://unite.ut.ee/index.php, accessed on 30 May 2025) and the Silva database (http://www.arb-silva.de, accessed on 30 May 2025), respectively.

2.6. Data Analysis

SPSS software (Version 27.0, IBM, Armonk, NY, USA) was used to test the differences in soil physicochemical property gene copy number, α diversity (Shannon–Wiener index, observed species index, Pielou index, Chao1 index, and Simpson index), and richness of microbial species after different N addition treatments by one-way analysis of variance and Duncan’s post hoc test. No corrections for multiple comparisons were applied. The relationships between N addition dose, gene copy number, and diversity index were tested by linear regression, and the relationship between N addition and gene copy number and diversity index was plotted with Origin software (Version 2024). Origin software (Version 2024) was used to analyze and plot the effects of soil nutrients on bacteria, fungi, and N-fixing bacteria at the phylum level. Correlation analyses were performed to determine the correlations among N addition level, NO3−-N concentration, abundance of soil microorganisms, and N-fixing soil bacterial diversity.

3. Results

3.1. Effects of N Addition on Soil Nutrients

Table 1 shows the specific values and differences in soil nutrient content at different N addition levels. There were no significant differences in soil pH, SOC, TN, TP, AP, AK, carbon–nitrogen ratio (C/N), carbon–phosphorus ratio (C/P), and nitrogen–phosphorus ratio (N/P) under different N application concentrations. The TK content of soil under N40 treatment was significantly lower than that under N10 (p < 0.05). The NH4+-N content was the highest under N0 treatment and the lowest under N160 treatment, and there was a significant difference (p < 0.05). The soil NO3−-N content was the highest under N160 treatment and the lowest under N20 treatment, and there was a significant difference (p < 0.05).

3.2. Effects of N Addition on the Number of Soil Microorganisms

In this study, we used qPCR to measure the number (gene copy number) of bacteria, fungi, and N-fixing bacteria. Overall, bacterial (Figure 1a) and fungal (Figure 1b) numbers in the soil increased with the rise in N content. The 16 rRNA gene copy number of bacteria per gram of soil was in the range of 1.3 × 1011–1.8 × 1011. The ITS gene copy number of fungi was in the range of 1.6 × 109–2 × 109, which was lower than the number of bacteria by two orders of magnitude. However, the number of N-fixing bacteria (Figure 1c) decreased with the increase in N content, with the copy number of the nifH gene in the range of 3 × 107–6.5 × 107.

3.3. Effects of N Addition on the Composition of the Soil Microbial Community

In terms of RA, the microbial community compositions were similar under diverse N addition treatments (Figure 2). Overall, the five phyla with the highest RA levels were Proteobacteria (30.2%), Acidobacteria (21.0%), Verrucomicrobia (14.3%), Actinobacteria (14.2%), and Chloroflexi (6.8%), which jointly accounted for 86.5% of the total bacterial abundance.
In terms of RA, the main fungal phyla in each treatment group were Ascomycota (33.3%), Mortierellomycota (27.7%), and Basidiomycota (26.2%), which accounted for 87.2% of fungal abundance (Figure 3). N addition had a diverse influence on the RA of these three fungal groups. As the degree of N addition was increased, the RA of Ascomycota also rose, while Basidiomycota showed a declining trend. However, the RA of Mortierellomycota had no obvious change.
The effect of N addition on the RA of soil N-fixing bacteria was examined at the genus and phylum levels. Proteobacteria was the main N-fixing bacterial phylum under all treatment groups, accounting for 95%–98% of the total abundance (TA) of N-fixing bacteria (Figure 4). Interestingly, N addition obviously increased the RA of N-fixing Actinobacteria, which was consistent with the change in the RA of actinomycetes. The genus-level analysis revealed that the five most abundant N-fixing bacterial genera were Geobacter (50.2%), Bradyrhizobium (10.0%), Mesorhizobium (9.9%), Azospirillum (7.7%), and Herbaspirillum (6.4%), accounting for 84.2% of the TA of N-fixing bacteria (Figure 5). N addition had a great impact on the RA of N-fixing bacterial genera. Geobacter’s RA decreased (p < 0.05), while that of Bradyrhizobium, Mesorhizobium, and Frankia increased with the increasing amount of N addition into the soil.

3.4. Effects of Soil Nutrients on Soil Microorganisms

According to the correlation analysis of soil nutrients to the soil bacterial community, fungal community, and N-fixing bacterial community (Figure 6, Figure 7 and Figure 8), soil TK had a significant negative correlation with Bacteroidetes in the bacterial community (p < 0.05). Soil pH was negatively correlated with Zoopagomycota in fungal communities (p < 0.05); soil TK was positively correlated with Zoopagomycota in fungal communities (p < 0.05); soil AP was negatively correlated with Kickxellomycota in fungal communities (p < 0.05); and soil C/N ratio was negatively correlated with Mucoromycota in fungal communities (p < 0.05). Soil TP was positively correlated with Proteobacteria in the N-fixing bacterial community and negatively correlated with Verrucomicrobia in the N-fixing bacterial community (p < 0.05); soil TK was significantly positively correlated with Cyanobacteria in the N-fixing bacteria community (p < 0.05); soil AK was negatively correlated with Cyanobacteria in the N-fixing bacteria community (p < 0.05); and soil NO3−-N was significantly positively correlated with Firmicutes and Actinobacteria in the N-fixing bacteria community (p < 0.05).

3.5. Effects of N Addition on the Soil Microbial Diversity

According to the results of HTS, OTUs, and dada2 classification, Chao1 and observed species indices were determined to reflect the microbial species richness. Similarly, the Simpson and Shannon–Wiener indices were determined to reflect microbial community diversity, while the Pielou index was determined to indicate the evenness of microbial community. The results revealed the influences of short-term N addition on bacterial, fungal, and N-fixing bacterial communities’ diversity. Overall, short-term N addition did not have an obvious impact on bacterial (Figure 9) and fungal (Figure 10) community diversity, but it significantly reduced N-fixing microbial community diversity (Figure 11). With an increase in the level of N addition, no obvious differences in the five diversity indices were noticed for soil bacteria and fungi from the plot without N addition. However, five diversity indices of N-fixing bacteria were significantly reduced with increasing N level (p < 0.05) and were lower than the group without N addition. Among these indices, the Chao1 and observed species indices of N-fixing bacteria decreased by approximately 25% when the N addition was 160 kg N ha−1 yr−1. Meanwhile, the Pielou, Simpson, and Shannon–Wiener indices decreased by about 15%, 5%, and 15%, respectively.

3.6. Correlations Between the Influencing Factors and Changes in Soil Microbial Diversity After N Addition

The results of the correlation analyses revealed a considerable rise in the concentration of NO3−-N in the soil after short-term N addition to Larix gmelinii var. principis-rupprechtii (Mayr) Pilg. plantations (p < 0.001) (Figure 12a). The Shannon–Wiener index of N-fixing microbial communities was unaffected by low NO3−-N concentrations. However, it exhibited a declining trend as the concentration of NO3−-N exceeded a certain concentration (p < 0.05) (Figure 12b). The trend of the Chao1 index was not evident with the rise in NO3−-N concentration (Figure 12c), while the changes in Pielou index were comparable to the trend of the Shannon–Wiener index (p = 0.08) (Figure 12d). The correlation analysis of the Shannon–Wiener, Chao1, and Pielou indices of N-fixing microbial communities revealed a stronger correlation between the Shannon–Wiener and Pielou indices (p < 0.001) (Figure 12e,f).
Correlation analysis between N addition level and soil microbial abundance revealed that the relative and absolute abundance of actinomycetes increased nonlinearly and linearly, respectively, with the rise in N addition level in Larix gmelinii var. principis-rupprechtii (Mayr) Pilg. plantations (Figure 13a,b). With the increase in abundance of actinomycetes, the number of N-fixing bacteria gradually decreased, showing a significant negative correlation (p < 0.05) (Figure 13c).

4. Discussion

4.1. Effect of N Addition on the Number and Composition of Microbial Community

The microbial group numbers were influenced differently by short-term N addition. An increase in the level of N addition did not result in any detrimental influence on the fungal and bacterial communities’ numbers. This finding contrasted with the reported decrease in the number of microbial communities after long-term N addition [24,25]. Nevertheless, the number of N-fixing microorganisms decreased with short-term N addition, which agreed with previous studies exhibiting a significant decline in N-fixing bacterial numbers after N addition [26,27,28]. Although short-term N addition had little impact on the TA of fungal and bacterial groups, it started to affect the functional microorganisms related to N cycling (like N-fixing bacteria), which may be the initial sign of the influence of N input on the succession of the microbial community.
According to previous research, diverse degrees of N addition not only affect the amount of available N in the soil of forest ecosystems but also significantly alter fungal and bacterial community composition [15,29]. In this study, diverse N addition treatments greatly impacted the RA of some bacterial phyla. However, bacterial community composition (in terms of dominant taxa) was not greatly affected. With the increase in N addition level, soil NO3−-N enrichment occurred (Table 1), and the RA of eutrophic actinomycetes exhibited an increasing trend, while the RA of oligotrophic Nitrospira showed a declining tendency (Figure 5). These results were similar to those reported by Zhang et al. and Tong et al., reporting a rise in the RA of Actinobacteria, Acidobacteria, and Chloroflexi and a decline in the RA of Proteobacteria, Bacteroidetes, Verrucomicrobia, and Sphingomonas due to N addition [30,31]. This might be because soil NO3−-N enrichment better favors the growth of eutrophic bacteria such as actinomycetes, and oligotrophic bacteria such as Nitrospira failed in the competition for resources. This finding is similar to earlier research showing a rise in the RA of eutrophic bacteria and a decline in the RA of oligotrophic bacteria with an increase in N deposition [6,20,32]. Kaiser et al. found that the community dynamics between microorganisms that produce extracellular enzymes (referred to as “decomposers” here) and those that utilize the catalytic activity of other microorganisms (referred to as “cheaters” here) regulate the decomposition of soil organic matter [33]. That is, “cheaters” increase their biomass by down-regulating the ratio of extracellular enzymes to microbial biomass. Actinomycetes might belong to this type of microorganism. Interestingly, N addition obviously increased the RA of N-fixing Actinobacteria, which was consistent with the change in the RA of actinomycetes (Figure 4). This indicates that the increase in the relative abundance of actinomycetes in the soil with N addition might also be related to the increase in the RA of N-fixing Actinobacteria.
According to some studies, N deposition decreased the RA of basidiomycetes and raised the RA of ascomycetes in temperate forests [18,34]. However, fungal community composition in the northern broad-leaved forest and subtropical Moso bamboo forests was not obviously influenced by N deposition [35,36]. In this study, short-term N addition insignificantly altered fungal and bacterial community composition, despite having a small influence on the fungal number and diversity. The fungal community composition will respond more clearly to extended N addition.

4.2. Effect of N Addition on the Diversity of the Soil Microbial Community

Some studies have indicated that short-term N addition had no substantial effect on soil fungal and bacterial diversity [6,14,37]. Conversely, some studies reported that N addition alters soil bacterial community composition, leading to a loss of bacterial diversity [16,38]. For example, Craig et al. found that N addition in mangrove ecosystems significantly changed the bacterial community composition and reduced bacterial diversity [39]. In forest soils, N addition could also affect bacterial community structure; Weber et al. observed that N addition altered the fungal community composition and increased fungal community richness, with the most pronounced changes occurring in the 0–2 cm soil layer in Pinus taeda L. plantations [34]. Furthermore, some studies found a decrease in fungal and bacterial diversity with increased N addition in forest ecosystems [25,40]. For instance, Wang et al. observed a decreasing trend in the abundance of soil bacteria and fungi with increasing rates of N deposition in subtropical forest soils [25]. In this study, short-term N addition had no obvious influence on the fungal and bacterial communities’ diversity (Figure 11). The variations in climate, tree species, and/or environmental factors might be the reason for these inconsistent findings. Alternatively, the effect of N addition on microbial community diversity and abundance perhaps hinges on its amount and duration.
Earlier studies have found that N-fixing microbial community diversity decreases with the rise in soil-accessible N content [41,42,43,44]. Consistent with earlier studies, this work demonstrated a drastic decline in the diversity of N-fixing microbial communities after short-term N addition (Figure 11). Vitousek et al. reported that the energy-intensive process of biological N fixation restricts the growth of N-fixing microorganisms, ultimately leading to a sharp decline in the diversity of their communities [45]. Therefore, the sharp decline in the diversity of N-fixing microbial communities observed after N addition in this study is likely due to the high energy demand associated with biological N fixation.
In our research, short-term N addition resulted in an obvious rise in soil NO3−-N concentration (Table 1), which agreed with earlier findings [46,47]. When NO3−-N concentration exceeded a certain limit, the Shannon–Wiener index of N-fixing microbial communities started to decrease (Figure 12b). Furthermore, changes in the Pielou index were consistent with the trend of the Shannon–Wiener index (Figure 12d). Li et al. reported that N addition reduced the diversity of N-fixing microbial communities by increasing soil NO3−-N concentrations [48]. Similarly, Li et al. found that N addition decreased both the abundance and diversity of N-fixing microorganisms in the soil [49]. In this study, short-term N addition might have influenced the diversity of N-fixing microbial communities by increasing soil NO3−-N levels, as the N-fixing microorganisms no longer had a competitive advantage in the soil. Furthermore, the relative and absolute abundance of actinomycetes increased nonlinearly and linearly, respectively, with the rise in the dose of N addition, which was reported in earlier studies [38,50,51]. Then, the correlation analysis revealed a negative correlation between the number of actinomycetes and N-fixing bacteria. However, the diversity and composition of the N-fixing bacterial community changed, despite any change in soil pH. On the contrary, Sun et al. observed a decline in soil pH after applying long-term fertilizer, which led to alterations in community structure and a decline in bacterial diversity [52]. The reduced diversity of N-fixing microorganisms was attributed to the enrichment of soil NO3−-N resulting from N addition. Eutrophic bacteria usually grow more quickly in nutrient-rich environments, while the oligotrophic bacteria grow slowly [53,54,55]. In a recent study, NO3−-N soil enrichment boosted the growth of eutrophic bacteria and increased their abundance [37], resulting in a greater competitive disadvantage for oligotrophic bacteria such as N-fixing bacteria. Similarly, Hao et al. suggested that high N input may change the nutritional strategy of the soil bacterial community [56]. The change in soil nutrient level is more beneficial for the growth of eutrophic bacterial groups while inhibiting the growth of oligotrophic bacteria that decompose refractory compounds [56].
In summary, N addition forms an NO3−-N-rich soil environment, inhibits N-fixing bacteria growth, and stimulates the growth of nutrient-rich bacteria (such as actinomycetes), comprising the response mechanism of N-fixing microbial communities to short-term N addition. The competitive advantage of nutrient-rich bacteria is unfavorable to the N-fixing bacteria community, causing a reduction or even extinction of some N-fixing bacteria with weak adaptability. This results in a decrease in species evenness and a significant reduction in N-fixing bacterial community diversity. This study demonstrated that N-fixing bacterial community diversity can be an initial indicator of the impact of N deposition on forest soil, providing a scientific theoretical basis for precise management of soil N under N deposition. However, this study found that N addition had no significant effect on the number and diversity of most fungal and bacterial communities. This might be due to the short-term (one-year) N addition not yet causing changes in the number and structure of the fungal and bacterial communities. In the future, we will continue to add N to observe how these changes might evolve.

5. Conclusions

In this study, short-term N addition decreased both the number and diversity of soil N-fixing functional genes (nifH) and significantly altered the structure and composition of N-fixing bacterial communities. However, it had no noticeable influence on fungal and bacterial number and diversity. Soil pH was not the primary factor influencing the soil microbial community in the early stages of N addition. Rather than soil pH, competition between various microorganisms in an N-rich environment formed by N addition was possibly the main factor generating the succession of microbial communities in the initial stages of N addition. The findings of this study provide valuable insights into the early impacts of N deposition on the soil microbial community in forests, thus offering a scientific theoretical basis for the precise management of plantations under N deposition.

Author Contributions

Conceptualization, Y.J., Z.X., and H.H.; methodology, Y.J., Z.W., H.C., Z.X., and H.H.; software, Y.J. and Z.W.; validation, Y.J. and Z.W.; formal analysis, Y.J., Z.W., and H.C.; investigation, Y.J., Z.W., H.C., L.Y., J.L., and J.M.; resources, Y.J. and H.H.; data curation, Y.J., Z.W. and L.Y.; writing—original draft preparation, Y.J., Z.W., and H.C.; writing—review and editing, Y.J.; visualization, Y.J. and Z.W.; supervision, Y.J., Z.X., and H.H.; project administration, Y.J.; funding acquisition, Y.J. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the National Natural Science Foundation of China (31988102) and the Natural Science Foundation of Hebei (C2018204096).

Data Availability Statement

The data presented in this study are available from the corresponding author upon request.

Conflicts of Interest

The authors declare no conflicts of interest.

Abbreviations

The following abbreviations are used in this manuscript:
NNitrogen
RARelative abundance
qPCRQuantitative polymerase chain reaction
HTSHigh-throughput sequencing
TNTotal nitrogen
TPTotal phosphorus
SOCSoil organic carbon
APAvailable phosphorus
TKTotal potassium
AKAvailable potassium
TATotal abundance

References

  1. Lu, X.K.; Mo, J.M.; Zhang, W.; Mao, Q.G.; Liu, R.Z.; Wang, C.; Zheng, M.H.; Wang, S.H.; Mori, T.; Mao, J.H.; et al. Effects of Simulated Atmospheric Nitrogen Deposition on Forest Ecosystems in China: An Overview. J. Trop. Subtrop. Bot. 2019, 27, 500–522. [Google Scholar] [CrossRef]
  2. Galloway, J.N.; Townsend, A.R.; Erisman, J.W.; Bekunda, M.; Cai, Z.C.; Freney, J.R.; Martinelli, L.A.; Seitzinger, S.P.; Sutton, M.A. Transformation of the nitrogen cycle: Recent trends, questions, and potential solutions. Science 2008, 320, 889–892. [Google Scholar] [CrossRef] [PubMed]
  3. Liu, X.; Zhang, Y.; Han, W.; Tang, A.; Shen, J.; Cui, Z.; Vitousek, P.; Erisman, J.W.; Goulding, K.; Christie, P.; et al. Enhanced nitrogen deposition over China. Nature 2013, 494, 459–462. [Google Scholar] [CrossRef] [PubMed]
  4. Liu, L.; Wen, Z.; Liu, S.; Zhang, X.Y.; Liu, X.J. Decline in atmospheric nitrogen deposition in China between 2010 and 2020. Nat. Geosci. 2024, 17, 816. [Google Scholar] [CrossRef]
  5. Yang, X.C.; Yang, L.; Li, Q.R.; Li, X.; Xu, G.Q.; Xu, Z.Q.; Jia, Y.L. Short-term responses of soil nutrients and enzyme activities to nitrogen addition in a Larix principis-rupprechtii plantation in North China. Front. Ecol. Evol. 2023, 11, 1105150. [Google Scholar] [CrossRef]
  6. Sun, X.; Dai, H.; Zeng, Q.; Zhou, J.; Peng, Y.; Chen, W.; Zhang, Q.; Chen, Y. The influence of soil microbial community structure on microbial carbon use efficiency under nitrogen addition. Acta Ecol. Sin. 2024, 44, 1737–1746. [Google Scholar] [CrossRef]
  7. Schulte-Uebbing, L.; de Vries, W. Global-scale impacts of nitrogen deposition on tree carbon sequestration in tropical, temperate, and boreal forests: A meta-analysis. Glob. Chang. Biol 2018, 24, e416–e431. [Google Scholar] [CrossRef]
  8. De Schrijver, A.; De Frenne, P.; Ampoorter, E.; Van Nevel, L.; Demey, A.; Wuyts, K.; Verheyen, K. Cumulative nitrogen input drives species loss in terrestrial ecosystems. Glob. Ecol. Biogeogr. 2011, 20, 803–816. [Google Scholar] [CrossRef]
  9. Mao, J.; Xing, Y.; Ma, H.; Wang, Q. Research Progress of Nitrogen Deposition Effect on Plant Growth. Chin. Agric. Sci. Bull. 2017, 33, 42–48. [Google Scholar] [CrossRef]
  10. Clark, C.M.; Tilman, D. Loss of plant species after chronic low-level nitrogen deposition to prairie grasslands. Nature 2008, 451, 712–715. [Google Scholar] [CrossRef]
  11. Zhang, Y.H.; Lü, X.T.; Isbell, F.; Stevens, C.; Han, X.; He, N.P.; Zhang, G.M.; Yu, Q.; Huang, J.H.; Han, X.G. Rapid plant species loss at high rates and at low frequency of N addition in temperate steppe. Glob. Change Biol. 2014, 20, 3520–3529. [Google Scholar] [CrossRef] [PubMed]
  12. Midolo, G.; Alkemade, R.; Schipper, A.M.; Benítez-López, A.; Perring, M.P.; De Vries, W. Impacts of nitrogen addition on plant species richness and abundance: A global meta-analysis. Glob. Ecol. Biogeogr. 2019, 28, 398–413. [Google Scholar] [CrossRef]
  13. Douterelo, I.; Goulder, R.; Lillie, M. Soil microbial community response to land-management and depth, related to the degradation of organic matter in English wetlands: Implications for the in situ preservation of archaeological remains. Appl. Soil. Ecol. 2010, 44, 219–227. [Google Scholar] [CrossRef]
  14. Su, X.; Li, X.; Li, C.; Sun, H. Effect of nitrogen addition on soil fungal diversity in a degraded alpine meadow at different slopes. Environ. Sci. 2022, 43, 5286–5293. [Google Scholar] [CrossRef]
  15. Freedman, Z.B.; Romanowicz, K.J.; Upchurch, R.A.; Zak, D.R. Differential responses of total and active soil microbial communities to long-term experimental N deposition. Soil. Biol. Biochem. 2015, 90, 275–282. [Google Scholar] [CrossRef]
  16. Zhang, T.A.; Chen, H.Y.H.; Ruan, H.H. Global negative effects of nitrogen deposition on soil microbes. Isme J. 2018, 12, 1817–1825. [Google Scholar] [CrossRef]
  17. Moore, J.A.M.; Anthony, M.A.; Pec, G.J.; Trocha, L.K.; Trzebny, A.; Geyer, K.M.; van Diepen, L.T.A.; Frey, S.D. Fungal community structure and function shifts with atmospheric nitrogen deposition. Glob. Change Biol. 2021, 27, 1349–1364. [Google Scholar] [CrossRef]
  18. Morrison, E.W.; Frey, S.D.; Sadowsky, J.J.; van Diepen, L.T.A.; Thomas, W.K.; Pringle, A. Chronic nitrogen additions fundamentally restructure the soil fungal community in a temperate forest. Fungal Ecol. 2016, 23, 48–57. [Google Scholar] [CrossRef]
  19. Ling, N.; Chen, D.M.; Guo, H.; Wei, J.X.; Bai, Y.F.; Shen, Q.R.; Hu, S.J. Differential responses of soil bacterial communities to long-term N and P inputs in a semi-arid steppe. Geoderma 2017, 292, 25–33. [Google Scholar] [CrossRef]
  20. Nie, Y.X.; Wang, M.C.; Zhang, W.; Ni, Z.; Hashidoko, Y.; Shen, W.J. Ammonium nitrogen content is a dominant predictor of bacterial community composition in an acidic forest soil with exogenous nitrogen enrichment. Sci. Total Environ. 2018, 624, 407–415. [Google Scholar] [CrossRef]
  21. Fierer, N.; Leff, J.W.; Adams, B.J.; Nielsen, U.N.; Bates, S.T.; Lauber, C.L.; Owens, S.; Gilbert, J.A.; Wall, D.H.; Caporaso, J.G. Cross-biome metagenomic analyses of soil microbial communities and their functional attributes. Proc. Natl. Acad. Sci. USA 2012, 109, 21390–21395. [Google Scholar] [CrossRef] [PubMed]
  22. Lu, R.K. Analysis Method of Soil Agricultural Chemistry; China Agricultural Science and Technology Press: Beijing, China, 2000. [Google Scholar]
  23. Bao, S.D. Soil Agricultural Chemical Analysis, 3rd ed.; China Agricultural Press: Beijing, China, 2000. [Google Scholar]
  24. Wang, C.; Lu, X.K.; Mori, T.; Mao, Q.G.; Zhou, K.J.; Zhou, G.Y.; Nie, Y.X.; Mo, J.M. Responses of soil microbial community to continuous experimental nitrogen additions for 13 years in a nitrogen-rich tropical forest. Soil. Biol. Biochem. 2018, 121, 103–112. [Google Scholar] [CrossRef]
  25. Wang, J.; Shi, X.; Zheng, C.; Suter, H.; Huang, Z. Different responses of soil bacterial and fungal communities to nitrogen deposition in a subtropical forest. Sci. Total Env. 2021, 755, 142449. [Google Scholar] [CrossRef]
  26. Reed, S.C.; Cleveland, C.C.; Townsend, A.R. Functional Ecology of Free-Living Nitrogen Fixation: A Contemporary Perspective. Annu. Rev. Ecol. Evol. Syst. 2011, 42, 489–512. [Google Scholar] [CrossRef]
  27. Silva E, M.C.P.E.; Schloter-Hai, B.; Schloter, M.; van Elsas, J.D.; Salles, J.F. Temporal dynamics of abundance and composition of nitrogen-fixing communities across agricultural soils. PLoS ONE 2013, 8, e74500. [Google Scholar] [CrossRef]
  28. Wang, L.; Zhang, H.; Wang, J.; Wang, J.D.; Zhang, Y.C. Long-term fertilization with high nitrogen rates decreased diversity and stability of diazotroph communities in soils of sweet potato. Appl. Soil. Ecol. 2022, 170, 104266. [Google Scholar] [CrossRef]
  29. Li, J.; Li, Z.A.; Wang, F.M.; Zou, B.; Chen, Y.; Zhao, J.; Mo, Q.F.; Li, Y.W.; Li, X.B.; Xia, H.P. Effects of nitrogen and phosphorus addition on soil microbial community in a secondary tropical forest of China. Biol. Fertil. Soils 2015, 51, 207–215. [Google Scholar] [CrossRef]
  30. Zhang, X.; Song, X.; Wang, T.T.; Huang, L.; Ma, H.Y.; Wang, M.; Tan, D.Y. The responses to long-term nitrogen addition of soil bacterial, fungal, and archaeal communities in a desert ecosystem. Front. Microbiol. 2022, 13, 1015588. [Google Scholar] [CrossRef]
  31. Tong, Y.; Zhang, C.; Yu, Y.; Cao, Q.; Yang, Z.; Zhang, X.; Cao, Q.; Zhang, Z.; Yu, Y.; Yang, X. Response of microbiological properties to short-term nitrogen addition in perennial alpine cultivated grassland. Environ. Sci. 2024, 45, 7316–7325. [Google Scholar] [CrossRef]
  32. Fierer, N.; Lauber, C.L.; Ramirez, K.S.; Zaneveld, J.; Bradford, M.A.; Knight, R. Comparative metagenomic, phylogenetic and physiological analyses of soil microbial communities across nitrogen gradients. Isme J. 2012, 6, 1007–1017. [Google Scholar] [CrossRef]
  33. Kaiser, C.; Franklin, O.; Richter, A.; Dieckmann, U. Social dynamics within decomposer communities lead to nitrogen retention and organic matter build-up in soils. Nat. Commun. 2015, 6, 8960. [Google Scholar] [CrossRef] [PubMed]
  34. Weber, C.F.; Vilgalys, R.; Kuske, C.R. Changes in fungal community composition in response to elevated atmospheric CO2 and nitrogen fertilization varies with soil horizon. Front. Microbiol. 2013, 4, 78. [Google Scholar] [CrossRef] [PubMed]
  35. DeForest, J.L.; Zak, D.R.; Pregitzer, K.S.; Burton, A.J. Atmospheric nitrate deposition, microbial community composition, and enzyme activity in northern hardwood forests. Soil. Sci. Soc. Am. J. 2004, 68, 132–138. [Google Scholar] [CrossRef]
  36. Zheng, X.Z.; Xu, A.A.; Lin, Y.; Wang, H.P.; Ding, H.; Wu, Y.Q.; Zhang, Y.S. Long-term nitrogen deposition alters the soil bacterial community structure but has little effect on fungal communities. Glob. Ecol. Conserv. 2024, 54, e03080. [Google Scholar] [CrossRef]
  37. Sun, H.; Liu, G.; Zhu, Y.; Lin, X.; Guo, H.; Qian, X.; Fang, X. Effects of nitrogen addition and moisture change on microbial diversity and community composition in subtropical plantation red soil. Ecol. Sci. 2024, 43, 94–104. [Google Scholar] [CrossRef]
  38. Huang, T.; Liu, W.; Long, X.-E.; Jia, Y.; Wang, X.; Chen, Y. Different Responses of Soil Bacterial Communities to Nitrogen Addition in Moss Crust. Front. Microbiol. 2021, 12, 665975. [Google Scholar] [CrossRef]
  39. Craig, H.; Antwis, R.E.; Cordero, I.; Ashworth, D.; Robinson, C.H.; Osborne, T.Z.; Bardgett, R.D.; Rowntree, J.K.; Simpson, L.T. Nitrogen addition alters composition, diversity, and functioning of microbial communities in mangrove soils: An incubation experiment. Soil. Biol. Biochem. 2021, 153, 108076. [Google Scholar] [CrossRef]
  40. Allison, S.D.; Hanson, C.A.; Treseder, K.K. Nitrogen fertilization reduces diversity and alters community structure of active fungi in boreal ecosystems. Soil. Biol. Biochem. 2007, 39, 1878–1887. [Google Scholar] [CrossRef]
  41. Wang, C.; Zheng, M.M.; Song, W.F.; Wen, S.L.; Wang, B.R.; Zhu, C.Q.; Shen, R.F. Impact of 25 years of inorganic fertilization on diazotrophic abundance and community structure in an acidic soil in southern China. Soil. Biol. Biochem. 2017, 113, 240–249. [Google Scholar] [CrossRef]
  42. Orr, C.H.; James, A.; Leifert, C.; Cooper, J.M.; Cummings, S.P. Diversity and Activity of Free-Living Nitrogen-Fixing Bacteria and Total Bacteria in Organic and Conventionally Managed Soils. Appl. Environ. Microbiol. 2011, 77, 911–919. [Google Scholar] [CrossRef]
  43. Mirza, B.S.; Potisap, C.; Nüsslein, K.; Bohannan, B.J.M.; Rodrigues, J.L.M. Response of Free-Living Nitrogen-Fixing Microorganisms to Land Use Change in the Amazon Rainforest. Appl. Environ. Microbiol. 2014, 80, 281–288. [Google Scholar] [CrossRef] [PubMed]
  44. Wang, J.C.; Zhang, D.; Zhang, L.; Li, J.; Raza, W.; Huang, Q.W.; Shen, Q.R. Temporal variation of diazotrophic community abundance and structure in surface and subsoil under four fertilization regimes during a wheat growing season. Agric. Ecosyst. Environ. 2016, 216, 116–124. [Google Scholar] [CrossRef]
  45. Vitousek, P.M.; Cassman, K.; Cleveland, C.; Crews, T.; Field, C.B.; Grimm, N.B.; Howarth, R.W.; Marino, R.; Martinelli, L.; Rastetter, E.B.; et al. Towards an ecological understanding of biological nitrogen fixation. Biogeochemistry 2002, 57, 1–45. [Google Scholar] [CrossRef]
  46. Cao, Z.; Cheng, S.; Fang, H.; Xu, M.; Geng, J.; Lu, M.; Yang, Y.; Li, Y.N. Responses of Soil Organic Carbon Dynamics and Microbial Community Structure to Organic Nitrogen Fertilization in the Temperate Needle-broadleaved Mixed Forest. Acta Pedol. Sin. 2020, 57, 963–974. [Google Scholar] [CrossRef]
  47. Wei, X.; Wu, J.; Li, G.; Wang, H.; Liu, S.; Zhang, S.; Zhang, J. Response of soil nitrogen components to nitrogen addition in wet meadow in the Tibetan Plateau. Acta Agrestia Sin. 2021, 29, 677–683. (In Chinese) [Google Scholar]
  48. Li, X.D.; Su, L.B.; Jing, M.; Wang, K.Q.; Song, C.G.; Song, Y.L. Nitrogen addition restricts key soil ecological enzymes and nutrients by reducing microbial abundance and diversity. Sci. Rep. 2025, 15, 5560. [Google Scholar] [CrossRef]
  49. Li, C.Y.; Li, X.L.; Yang, Y.W.; Shi, Y.; Li, H.L. Degradation reduces the diversity of nitrogen-fixing bacteria in the alpine wetland on the Qinghai-Tibet Plateau. Front. Plant Sci. 2022, 13, 939762. [Google Scholar] [CrossRef]
  50. Gieske, M.F.; Kinkel, L.L. Long-term nitrogen addition in maize monocultures reduces in vitro inhibition of actinomycete standards by soil-borne actinomycetes. Fems Microbiol. Ecol. 2020, 96, fiaa181. [Google Scholar] [CrossRef]
  51. Zhang, Z.H.; Li, T.; Shao, P.S.; Sun, J.K.; Xu, W.J.; Zhao, Y.H. Effects of short-term nitrogen addition on rhizosphere and bulk soil bacterial community structure of three halophytes in the Yellow River Delta. Land. Degrad. Dev. 2023, 34, 3281–3294. [Google Scholar] [CrossRef]
  52. Sun, R.B.; Zhang, X.X.; Guo, X.S.; Wang, D.Z.; Chu, H.Y. Bacterial diversity in soils subjected to long-term chemical fertilization can be more stably maintained with the addition of livestock manure than wheat straw. Soil. Biol. Biochem. 2015, 88, 9–18. [Google Scholar] [CrossRef]
  53. Koch, A.L. Oligotrophs versus copiotrophs. Bioessays 2001, 23, 657–661. [Google Scholar] [CrossRef] [PubMed]
  54. Leff, J.W.; Jones, S.E.; Prober, S.M.; Barberán, A.; Borer, E.T.; Firn, J.L.; Harpole, W.S.; Hobbie, S.E.; Hofmockel, K.S.; Knops, J.M.H.; et al. Consistent responses of soil microbial communities to elevated nutrient inputs in grasslands across the globe. Proc. Natl. Acad. Sci. USA 2015, 112, 10967–10972. [Google Scholar] [CrossRef] [PubMed]
  55. Liu, W.X.; Jiang, L.; Yang, S.; Wang, Z.; Tian, R.; Peng, Z.Y.; Chen, Y.L.; Zhang, X.X.; Kuang, J.L.; Ling, N.; et al. Critical transition of soil bacterial diversity and composition triggered by nitrogen enrichment. Ecology 2020, 101, e03053. [Google Scholar] [CrossRef] [PubMed]
  56. Hao, Y.; Xie, L.; Chen, Y.; Tang, C.; Liu, X.; Lin, W.; Xiong, D.C.; Yang, Y.S. Effects of nitrogen deposition on diversity and composition of soil bacterial community in a subtropical Cunninghamia lanceolata plantation. Chin. J. Appl. Ecol. 2018, 29, 53–58. [Google Scholar] [CrossRef]
Forests 16 01096 g001
Figure 1. Effects of N addition on soil microbial number (gene copy number) in Larix gmelinii var. principis-rupprechtii (Mayr) Pilg. plantations: (a) bacteria; (b) fungi; (c) N-fixing bacteria. Green, red, and blue points represent bacteria, fungi, and N-fixing bacteria gene abundances, respectively.
Figure 1. Effects of N addition on soil microbial number (gene copy number) in Larix gmelinii var. principis-rupprechtii (Mayr) Pilg. plantations: (a) bacteria; (b) fungi; (c) N-fixing bacteria. Green, red, and blue points represent bacteria, fungi, and N-fixing bacteria gene abundances, respectively.
Forests 16 01096 g001
Forests 16 01096 g002
Figure 2. Effects of N addition on the relative abundance (RA) of different soil bacterial phyla in Larix gmelinii var. principis-rupprechtii (Mayr) Pilg. plantations.
Figure 2. Effects of N addition on the relative abundance (RA) of different soil bacterial phyla in Larix gmelinii var. principis-rupprechtii (Mayr) Pilg. plantations.
Forests 16 01096 g002
Forests 16 01096 g003
Figure 3. Effects of N addition on the RA of soil fungal phyla in Larix gmelinii var. principis-rupprechtii (Mayr) Pilg. plantations.
Figure 3. Effects of N addition on the RA of soil fungal phyla in Larix gmelinii var. principis-rupprechtii (Mayr) Pilg. plantations.
Forests 16 01096 g003
Forests 16 01096 g004
Figure 4. Effects of N addition on the RA of N-fixing soil bacteria (phylum level) in Larix gmelinii var. principis-rupprechtii (Mayr) Pilg. plantations.
Figure 4. Effects of N addition on the RA of N-fixing soil bacteria (phylum level) in Larix gmelinii var. principis-rupprechtii (Mayr) Pilg. plantations.
Forests 16 01096 g004
Forests 16 01096 g005
Figure 5. Effects of N addition on the RA of N-fixing soil bacteria (genus level) in Larix gmelinii var. principis-rupprechtii (Mayr) Pilg. plantations.
Figure 5. Effects of N addition on the RA of N-fixing soil bacteria (genus level) in Larix gmelinii var. principis-rupprechtii (Mayr) Pilg. plantations.
Forests 16 01096 g005
Forests 16 01096 g006
Figure 6. Correlation analysis between soil nutrients and soil bacterial communities. * p < 0.05.
Figure 6. Correlation analysis between soil nutrients and soil bacterial communities. * p < 0.05.
Forests 16 01096 g006
Forests 16 01096 g007
Figure 7. Correlation analysis between soil nutrients and soil fungal communities. * p < 0.05.
Figure 7. Correlation analysis between soil nutrients and soil fungal communities. * p < 0.05.
Forests 16 01096 g007
Forests 16 01096 g008
Figure 8. Correlation analysis between soil nutrients and soil nitrogen-fixing bacterial communities. * p < 0.05.
Figure 8. Correlation analysis between soil nutrients and soil nitrogen-fixing bacterial communities. * p < 0.05.
Forests 16 01096 g008
Forests 16 01096 g009
Figure 9. Effects of N addition on soil bacterial diversity in Larix gmelinii var. principis-rupprechtii (Mayr) Pilg. plantations.
Figure 9. Effects of N addition on soil bacterial diversity in Larix gmelinii var. principis-rupprechtii (Mayr) Pilg. plantations.
Forests 16 01096 g009
Forests 16 01096 g010
Figure 10. Effects of N addition on soil fungal diversity in Larix gmelinii var. principis-rupprechtii (Mayr) Pilg. plantations.
Figure 10. Effects of N addition on soil fungal diversity in Larix gmelinii var. principis-rupprechtii (Mayr) Pilg. plantations.
Forests 16 01096 g010
Forests 16 01096 g011
Figure 11. Effects of N addition on diversity of N-fixing soil bacteria in Larix gmelinii var. principis-rupprechtii (Mayr) Pilg. plantations. The different letters indicate significant differences (p < 0.05) between different N addition treatments.
Figure 11. Effects of N addition on diversity of N-fixing soil bacteria in Larix gmelinii var. principis-rupprechtii (Mayr) Pilg. plantations. The different letters indicate significant differences (p < 0.05) between different N addition treatments.
Forests 16 01096 g011
Forests 16 01096 g012
Figure 12. Correlation analysis between N addition level, NO3−-N concentration, and N-fixing soil bacterial diversity in Larix gmelinii var. principis-rupprechtii (Mayr) Pilg. plantations: (a) N addition vs. NO3−-N concentration; (b) NO3−-N concentration vs. Shannon–Wiener index; (c) NO3−-N concentration vs. Chao 1 index; (d) NO3−-N concentration vs. Pielou index; (e) Chao1 index vs. Shannon–Wiener index; (f) Pielou index vs. Shannon–Wiener index. Point colors in subfigures (b,d) represent sample values for segmented linear regression. Point colors in each subfigures have no quantitative significance and only serve to differentiate subfigures.
Figure 12. Correlation analysis between N addition level, NO3−-N concentration, and N-fixing soil bacterial diversity in Larix gmelinii var. principis-rupprechtii (Mayr) Pilg. plantations: (a) N addition vs. NO3−-N concentration; (b) NO3−-N concentration vs. Shannon–Wiener index; (c) NO3−-N concentration vs. Chao 1 index; (d) NO3−-N concentration vs. Pielou index; (e) Chao1 index vs. Shannon–Wiener index; (f) Pielou index vs. Shannon–Wiener index. Point colors in subfigures (b,d) represent sample values for segmented linear regression. Point colors in each subfigures have no quantitative significance and only serve to differentiate subfigures.
Forests 16 01096 g012
Forests 16 01096 g013
Figure 13. Correlation analysis between N addition level and the number of soil microorganisms in Larix gmelinii var. principis-rupprechtii (Mayr) Pilg. plantations: (a) N addition vs. relative abundance of actinomycetes; (b) N addition vs. absolute abundance of actinomycetes; (c) actinomycetes vs. N-fixing bacterial abundance. Inset in upper right corner shows the correlation under different N addition levels; Green dots represent the mean values of each treatment. The red line represents the linear regression line.
Figure 13. Correlation analysis between N addition level and the number of soil microorganisms in Larix gmelinii var. principis-rupprechtii (Mayr) Pilg. plantations: (a) N addition vs. relative abundance of actinomycetes; (b) N addition vs. absolute abundance of actinomycetes; (c) actinomycetes vs. N-fixing bacterial abundance. Inset in upper right corner shows the correlation under different N addition levels; Green dots represent the mean values of each treatment. The red line represents the linear regression line.
Forests 16 01096 g013
Table 1. Soil nutrients in nitrogen addition plots.
Table 1. Soil nutrients in nitrogen addition plots.
Nutrient IndicatorsTreatment
N0N5N10N20N40N80N160
pH6.28 ± 0.06 a6.13 ± 0.22 a6.17 ± 0.08 a6.32 ± 0.09 a6.30 ± 0.08 a6.25 ± 0.02 a6.21 ± 0.08 a
SOC (g kg−1)75.36 ± 5.56 a71.07 ± 7.00 a68.09 ± 5.28 a65.61 ± 3.03 a72.78 ± 6.03 a69.74 ± 6.35 a73.41 ± 5.24 a
TN (g kg−1)5.74 ± 0.48 a5.21 ± 0.38 a5.20 ± 0.33 a5.18 ± 0.34 a5.47 ± 0.62 a5.24 ± 0.46 a5.66 ± 0.78 a
TP (g kg−1)0.68 ± 0.09 a0.69 ± 0.12 a0.68 ± 0.09 a0.63 ± 0.05 a0.68 ± 0.10 a0.68 ± 0.09 a0.65 ± 0.07 a
TK (g kg−1)18.97 ± 0.38 ab19.54 ± 0.06 ab19.61 ± 0.64 a19.12 ± 0.23 ab18.77 ± 0.47b18.87 ± 0.44 ab19.36 ± 0.52 ab
AP (mg kg−1)5.60 ± 2.48 a6.48 ± 0.67 a7.15 ± 0.13 a6.61 ± 0.59 a7.42 ± 1.25 a6.78 ± 1.40 a6.41 ± 0.92 a
AK (mg kg−1)278.26 ± 14.85 a269.17 ± 35.09 a262.36 ± 38.19 a289.61 ± 23.24 a283.93 ± 16.06 a275.99 ± 11.30 a289.61 ± 21.39 a
NH4+-N (mg kg−1)6.55 ± 1.03 a5.46 ± 0.52 abc5.15 ± 0.68 bc5.85 ± 0.51 abc6.32 ± 0.71 ab5.93 ± 0.70 abc4.76 ± 0.26 c
NO3−-N (mg kg−1)18.54 ± 2.19 bc17.71 ± 1.62 bc16.74 ± 0.34 bc15.75 ± 2.55 c19.01 ± 1.85 b19.65 ± 0.80 b23.04 ± 0.81 a
C/N13.14 ± 0.38 a13.61 ± 0.47 a13.08 ± 0.54 a12.74 ± 1.09 a13.35 ± 0.59 a13.30 ± 0.21 a13.11 ± 1.07 a
C/P112.43 ± 9.90 a104.23 ± 8.39 a100.36 ± 7.62 a103.82 ± 4.83 a107.77 ± 11.43 a104.89 ± 18.88 a114.14 ± 8.79 a
N/P8.57 ± 0.90 a7.69 ± 0.83 a7.68 ± 0.63 a8.21 ± 0.75 a8.12 ± 1.12 a7.87 ± 1.34 a8.79 ± 1.11 a
Different letters indicate significant differences between different nitrogen addition treatments of the same soil nutrient (p < 0.05).
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Jia, Y.; Wang, Z.; Cui, H.; Yang, L.; Lu, J.; Ma, J.; Xu, Z.; He, H. Responses of Different Soil Microbial Communities to the Addition of Nitrogen into the Soil of Larix gmelinii var. principis-rupprechtii (Mayr) Pilg. Plantations. Forests 2025, 16, 1096. https://doi.org/10.3390/f16071096

AMA Style

Jia Y, Wang Z, Cui H, Yang L, Lu J, Ma J, Xu Z, He H. Responses of Different Soil Microbial Communities to the Addition of Nitrogen into the Soil of Larix gmelinii var. principis-rupprechtii (Mayr) Pilg. Plantations. Forests. 2025; 16(7):1096. https://doi.org/10.3390/f16071096

Chicago/Turabian Style

Jia, Yanlong, Ziyi Wang, Hongna Cui, Liu Yang, Jinping Lu, Jiaojiao Ma, Zhongqi Xu, and Honglin He. 2025. "Responses of Different Soil Microbial Communities to the Addition of Nitrogen into the Soil of Larix gmelinii var. principis-rupprechtii (Mayr) Pilg. Plantations" Forests 16, no. 7: 1096. https://doi.org/10.3390/f16071096

APA Style

Jia, Y., Wang, Z., Cui, H., Yang, L., Lu, J., Ma, J., Xu, Z., & He, H. (2025). Responses of Different Soil Microbial Communities to the Addition of Nitrogen into the Soil of Larix gmelinii var. principis-rupprechtii (Mayr) Pilg. Plantations. Forests, 16(7), 1096. https://doi.org/10.3390/f16071096

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop