You are currently viewing a new version of our website. To view the old version click .
Forests
  • Article
  • Open Access

14 February 2025

Wildfire Impacts Pinus tabulaeformis Forests on Soil Properties, Actinobacteriota, and Enzyme Activity in Northern China: Direct Effects or Mutual Interactions?

,
,
,
and
1
School of Ecology and Nature Conservation, Beijing Forestry University, Beijing 100083, China
2
College of Life Science, Hebei Normal University, Shijiazhuang 050024, China
3
College of Resource and Environment, Xinjiang Agricultural University, Urumqi 830052, China
*
Authors to whom correspondence should be addressed.
This article belongs to the Special Issue Fire Ecology and Management in Forest—2nd Edition

Abstract

Wildfires are significant disturbances that reshape soil ecosystems, impacting soil properties, microbial communities, and enzyme activities. In Pinus tabulaeformis forests in northern China, the effects of wildfire on soil health, particularly on Actinobacteriota and enzymatic functions, remain poorly understood. This study investigates both the direct and indirect effects of fire severity on these factors and examines how fire-induced changes in soil properties mediate microbial and enzymatic responses. Our findings show that wildfire significantly alters soil chemical properties, including an increase in soil pH and a reduction in organic carbon and water content, particularly under high fire severities. These changes directly impact microbial communities, with Actinobacteriota showing resilience under light and moderate fire intensities but declining under high severity, especially in subsoil layers. Soil enzymes, such as urease and protease, played a crucial role in mitigating the negative impacts of fire on nutrient cycling. Their activity promoted nutrient availability, aiding ecosystem recovery, even as fire intensity reduced overall soil fertility. Structural Equation Modeling (SEM) further revealed that the relationships between fire severity, soil properties, Actinobacteriota, and enzyme activity are shaped by both direct thermal effects and complex indirect interactions mediated by changes in soil moisture and nutrient levels. This study underscores the importance of considering both direct fire effects and the mutual interactions between soil properties, microbial communities, and enzymatic activities in post-fire recovery. The findings highlight that while high-severity fires disrupt soil health and microbial dynamics, soil enzymes can help regulate these impacts by enhancing nutrient cycling and supporting ecosystem stability. These insights contribute to a better understanding of wildfire-induced soil degradation and provide actionable strategies for enhancing post-fire soil restoration and microbial management in fire-prone ecosystems.

1. Introduction

Wildfires are major ecological disturbances, reshaping soil properties, microbial communities, and ecosystem functions globally [1,2,3]. The frequency and severity of wildfires have significantly increased due to climate change and anthropogenic activities, posing unprecedented challenges to forest ecosystems [4,5]. Wildfires profoundly affect soil physicochemical properties, including organic matter loss, pH shifts, and nutrient volatilization, with cascading effects on microbial communities and ecosystem recovery [6,7].
In China, Pinus tabulaeformis forests dominate the northern temperate regions, playing a critical role in biodiversity conservation, carbon sequestration, and soil stabilization [8,9]. However, their high resin content, combined with their dense canopy and thick litter layer, makes them highly flammable, creating conditions conducive to wildfire outbreaks [10,11]. Although specific data on recent changes in wildfire frequency or intensity within Pinus tabulaeformis forests are limited, their inherent flammability and the increasing impacts of climate change and human activities make fire a pressing concern in these ecosystems. These fire disturbances have led to profound changes in soil properties and microbial dynamics, making Pinus tabulaeformis forests an ideal system for studying the complex interactions between wildfires, soil, and microbial communities in post-fire environments. Actinobacteriota, a dominant bacterial phylum in forest ecosystems, plays a crucial role in nutrient cycling, organic matter decomposition, and soil structure maintenance [12,13]. Its ability to produce extracellular enzymes enables the breakdown of complex organic materials, contributing significantly to soil carbon and nitrogen cycling [14]. Furthermore, Actinobacteriota has been shown to promote soil aggregate stability by binding soil particles, which is essential for maintaining soil structure and fertility under changing environmental conditions [15]. These characteristics highlight its pivotal role in sustaining soil health and resilience, particularly in forest ecosystems facing external disturbances such as wildfires. Actinobacteriota exhibits notable resilience and functional versatility, allowing it to adapt to altered environmental conditions and contribute to post-fire recovery processes [16]. For example, its ability to thrive in nutrient-depleted or pH-altered soils makes it a key player in nutrient cycling and organic matter decomposition in post-fire environments [14,17]. These functional traits and its prominent role in regulating soil stability and fertility under disturbance conditions make Actinobacteriota the focal point of this study.
In recent years, several studies have highlighted the profound impacts of wildfires on the soil of Pinus tabulaeformis forests, specifically in northern China. For example, Li et al. (2019) reported that soil organic matter, total nitrogen, and ammonium nitrogen decreased significantly with increasing fire severity, while soil pH showed a marked increase following high-severity fires. These shifts in soil properties suggest that wildfires not only deplete essential nutrients but also create alkaline conditions that can influence microbial activity [18]. Similarly, Qin et al. (2020) observed that the soil bacterial community composition varied significantly with fire severity, with certain bacterial taxa becoming more dominant in response to fire-induced changes in soil pH and nutrient levels [19]. These findings underscore the complex interplay between fire severity, soil properties, and microbial community dynamics. By consolidating evidence from these studies, it becomes clear that wildfires have nuanced effects on Pinus tabulaeformis forests. While they disrupt soil structure and nutrient cycling, they also create opportunities for studying microbial resilience and adaptation. This research sets the stage for further investigations into how specific microbial groups contribute to soil recovery and ecosystem stability after fire disturbances.
Although numerous studies have demonstrated that wildfires significantly affect soil nutrients, microbial communities, and enzyme activities in Pinus tabulaeformis forests, the underlying mechanisms driving these changes remain poorly understood. Specifically, it is unclear whether wildfires directly alter soil nutrients, microbial abundance, and enzyme activities through immediate thermal effects or if these changes are mediated indirectly through post-fire modifications in environmental conditions, such as shifts in soil pH, organic matter, and nutrient availability. This knowledge gap highlights the need for further investigation into the interplay between direct fire-induced impacts and the cascading effects of altered soil properties, particularly in relation to Actinobacteriota, a dominant microbial group with critical ecological functions. To address this gap, this study employs Structural Equation Modeling (SEM) to differentiate between the direct impacts of wildfire—such as thermal destruction of microbial biomass—and the indirect effects mediated by changes in soil properties, including pH, organic matter, and nutrient availability. By focusing on Actinobacteriota as a key microbial group, the research investigates how fire intensity and soil depth influence microbial abundance, enzyme activities, and soil nutrient dynamics. This approach provides novel insights into the mechanisms underlying wildfire-induced changes in soil–microbe interactions, with broader implications for forest management and ecological restoration in fire-prone regions.

2. Materials and Methods

2.1. Study Area

The study was conducted in Pingquan County, located in the northern temperate region of China. The area has a temperate monsoon climate with an average annual temperature of 7.3 °C and annual precipitation of 540 mm, most of which falls in summer. The topography is characterized by hills and low mountains, with elevations ranging from 300 to 1000 m. The primary soil types are brown earth and cinnamon soil. Before the fire, the forest was dominated by natural secondary vegetation, including Pinus tabulaeformis and Platycladus orientalis as the main tree species, along with diverse shrub and herbaceous layers. These conditions provide a typical temperate forest environment for studying wildfire impacts.
In April 2015, a wildfire occurred in Dawopu Village, Liuxi Town, Pingquan County, Chengde City, Hebei Province, China. Local villagers burned paper during ancestral grave rituals and caused the fire. The wildfire spread over an area of about 53.33 hectares. The affected area was a natural secondary forest dominated by Pinus tabulaeformis. The forest stands experienced different levels of fire disturbance. After the fire, no human activities interfered with the site. This provided a valuable opportunity to study the effects of arson-related fires on soil nutrients and microbial communities. The incident emphasizes the need to understand the ecological and soil changes caused by human-induced fires. The post-fire study area is shown in Figure 1.
Figure 1. Overview of the study area. (a) DEM of Pingquan County, with different colors representing various elevations as shown in the legend. (b) Study area before the fire. (c) Study area after the fire. Panels (b,c) were captured using Landsat 9 imagery. The RGB432 band combination represents near-infrared (Band 4), red (Band 3), and green (Band 2), highlighting vegetation and surface features. In panel (c), the red-highlighted regions indicate the burned areas.

2.2. Sampling and Experimental Design

Plots were established after the fire. According to other previous research, fire severity classifications were determined using tree blackening heights and tree mortality percentages [20]. Light-severity fires were defined by blackening heights of up to 3 m and tree mortality rates not exceeding 10%. High-severity fires exhibited blackening heights of 6 m or more, tree mortality rates of at least 70%, significant ground vegetation destruction, and observable changes in soil color and structure. The moderate-severity zone was identified between the light-severity and high-severity regions. Control plots were selected from unburnt areas that shared similar geographical conditions. For each fire severity level, three replicate plots were established, each measuring 20 m × 20 m, totaling 12 plots. Detailed information is provided in Table 1. Soil samples were collected on 19 April 2021, using a 37 mm diameter soil auger. Three replicate plots of 20 m × 20 m were set up for each fire intensity category: control, light, moderate, and high. Within each plot, soil was sampled from two depths, 0–10 cm (top layer) and 10–20 cm (sublayer), to assess the stratified effects of wildfire [21]. These depths were chosen because the top-layer soil (0–10 cm) typically contains the highest organic matter content and microbial activity, making it highly responsive to environmental disturbances like wildfire [22]. The sublayer soil (10–20 cm), on the other hand, is less directly affected by surface disturbances but can provide insights into longer-term changes and nutrient-leaching dynamics following fire [23,24,25,26]. This stratified approach allows for a comprehensive understanding of the vertical variability in soil properties and microbial responses to wildfire. The design allows a comprehensive evaluation of wildfire’s direct and indirect impacts on soil physicochemical properties, microbial communities, and enzyme activity.
Table 1. Plot information.

2.3. Soil Properties

Soil organic carbon (SOC) was determined using the potassium dichromate-heating method, with samples measured in triplicates for accuracy [27]. Organic carbon content was calculated using specific constants, including the molar mass of carbon atoms and a correction factor for oxidation, with organic matter divided by a conversion factor of 1.724 [28]. Total nitrogen (TN) was measured using the Kjeldahl method [29], while ammonium nitrogen (NH4+-N) and nitrate nitrogen (NO3-N) were analyzed with a flow analyzer [30], and alkaline nitrogen (AN) content was determined using the alkaline distillation method [31]. The soil’s total phosphorus (TP) was determined using the sulfuric acid–perchloric acid digestion method. The soil’s available phosphorus (AP) was measured using the sodium bicarbonate extraction method, followed by colorimetric analysis with the molybdenum blue method [32]. The soil’s available potassium (AK) was determined using the ammonium acetate extraction method followed by flame photometry. Total potassium (TK) was determined using the NaOH fusion–flame photometric method [33]. The soil’s water content (WC) was calculated based on the weight difference before and after drying at 105 °C [34], and the soil’s pH was measured using a standard pH meter. Soil nutrient decomposition enzymes, including urease and protease, were assayed using the phenol–sodium colorimetric method [35] and the amino acid–ninhydrin complex formation method [36], respectively.

2.4. DNA Extraction, PCR Amplification, Processing of Sequencing Data

Microbial community analysis targeted the 16S rDNA V3-V4 region (338F, ACTCCTACGGGAGGCAGCAG–806R, GGACTACHVGGGTWTCTAAT) [37]. PCR amplification was conducted in a 25 μL reaction system containing 30 ng of DNA, 1 μL of each primer (5 μM), 12.5 μL of 2× Taq Plus Master Mix, and ddH2O to adjust the final volume. The PCR program included an initial denaturation at 94 °C for 5 min, 30 cycles of denaturation at 94 °C for 30 s, annealing at 50 °C for 30 s, extension at 72 °C for 60 s, and a final extension at 72 °C for 7 min. The PCR products were detected by 1% agarose gel electrophoresis to confirm the amplification specificity and ensure no non-specific bands or primer dimers were present. The products were then purified using the Agencourt AMPure XP nucleic acid purification kit (Beckman Coulter, Brea, CA, USA). The quality and quantity of the purified PCR products were verified using a Nanodrop spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA). MiSeq PE300 library construction was performed by Beijing Allwegene Technology Co. Ltd., Beijing, China. The names of the repository and accession number (s) can be found at: https://www.ncbi.nlm.nih.gov/sra/PRJNA1097343 (accessed on 8 April 2024).

2.5. Microbial Community Analysis

The Chao1 index was used to estimate species richness (OTU count) in microbial communities. It provides an estimate of the total OTU number, including undetected OTUs, based on the frequency of rare OTUs in the dataset [38]. The formula for the Chao1 index is
C h a o 1 = O b s + n 1 ( n 1 1 ) 2 ( n 2 + 1 )
where Chao1 is the estimated OTU count, Obs is the observed OTU count, n1 represents the number of OTUs with only one sequence, and n2 represents the number of OTUs with only two sequences. This index provides a robust measure of microbial richness, particularly in datasets where many taxa are represented by a small number of sequences [39].
Log Fold Change (logFC) was calculated to assess the differential abundance of microbial groups (OTUs) between fire severity levels. The calculation for comparing two conditions (e.g., Control, C and Light, L fire severity) is defined as follows:
log F C = log 2 A b u n d a n c e L A b u n d a n c e c
Differential abundance analysis was performed for all pairwise comparisons between fire severities (Control vs. Light, Control vs. Moderate, Control vs. High) using the edgeR package (version 4.4.0) [40]. A negative binomial model was applied to normalized count data, with normalization conducted using the trimmed mean of M-values (TMM) method to account for library size and compositional differences among samples. The False Discovery Rate (FDR) was calculated using the Benjamani–Hochberg procedure to correct for multiple testing. OTUs with an absolute logFC greater than 1 (|logFC| > 1) and FDR less than 0.05 (FDR < 0.05) were considered significantly different [41]. This approach enabled the identification of microbial taxa that responded distinctly to varying fire severities, providing insights into wildfire impacts on soil microbial communities.

2.6. Structural Equation Modeling (SEM)

Structural Equation Modeling (SEM) [42] was used to analyze the effects of wildfire severity, soil properties, microbial communities, and enzyme activities. To ensure comparability across datasets with different units and scales, all variables were standardized to z-scores. Multicollinearity among variables was addressed by calculating the Variance Inflation Factor (VIF), and variables with VIF values greater than 10 were excluded step by step to minimize redundancy and reduce the impact of collinearity [43]. Following this, Principal Component Analysis (PCA) was performed on the remaining variables within each category to reduce dimensionality while retaining key variations [44]. The SEM model was constructed using the lavaan package in R, incorporating the most representative components from the PCA [45]. Path coefficients were estimated to evaluate relationships among variables, and model fit indices such as χ2, cfi, and rmsea were calculated to assess the robustness of the model. This comprehensive approach allowed for the identification of significant pathways linking fire-induced changes in soil properties to microbial and enzymatic dynamics, offering a mechanistic understanding of post-fire recovery processes [46].

2.7. Statistical Analysis Software

All of the data analyses were performed using R (version 4.4.1). Log transformation was applied to non-normally distributed variables to ensure normality and homoscedasticity [47]. Structural Equation Modeling (SEM) was conducted using the lavaan package (version 0.6-19) to examine the effects of fire severity, soil physicochemical properties, microbial abundance, and enzyme activities [45]. Mantel tests were conducted to explore the correlations between microbial communities and soil properties, with visualizations created using the ggcor package [48]. In this package, all soil properties and microbial diversity indices were converted into distance matrices: Bray–Curtis dissimilarity was used for microbial community data, while Euclidean distance was applied to soil property data [49]. These matrix-based inputs satisfy the fundamental assumption of the Mantel test. Additionally, the Mantel test relies on no specific distribution of the data, and the statistical significance of correlations was assessed using 999 random permutations to ensure robust results. Differential abundance analysis for the volcano plots was performed using the edgeR package (version 4.4.0) [40], and the plots were generated using ggplot2 (version 3.5.1) [50]. The chord diagram illustrating microbial responses across soil layers and fire severities was created using the circlize package (version 0.4.16) [51], providing an overview of the Actinobacteriota class group under different fire severities. This multi-faceted statistical approach ensured robust analysis and visualization of the complex relationships within the soil ecosystem.

3. Results

3.1. Shifts in Actinobacteriota Abundance Under Different Fire Severities

Figure 2 illustrates the relative abundance of dominant phyla (greater than 1%) across various fire severity levels (Control, Light, Moderate, High) in both the topsoil layer (0–10 cm) and subsoil layer (10–20 cm). Actinobacteriota consistently emerged as a dominant phylum, with relative abundance exceeding 20% in both soil layers across all fire severity levels. Among all phyla, the relative abundance of Actinobacteriota ranked second, only after the top-ranking Proteobacteria. Notably, in soils subjected to the same fire severity, the relative abundance of Actinobacteriota in the subsoil was slightly higher than in the topsoil. Under different fire severities, the relative abundance of Actinobacteriota in lightly burned soils (L) showed the most significant increase compared to unburned soils (C). This was followed by moderate fire severity (M), where a clear increase was also observed, although less pronounced than in the lightly burned soils. In contrast, in heavily burned soils (H), no clear trend of increase or decrease in the relative abundance of Actinobacteriota was observed.
Figure 2. Relative abundances of dominant phyla. (A) Top-layer soil. (B) Sublayer soil. Phyla are selected as dominant phyla if their relative abundance is >1% in at least one sample type at each site. “C” stands for the control test, “L” represents light severity, “M” stands for moderate severity, and “H” stands for high severity of fire impact.

3.2. Mantel Test Analysis of Microbial Communities and Soil Properties

The Mantel test (Figure 3) was employed to explore the relationships between microbial communities (Actinobacteriota and Chao1 diversity) and soil properties, including soil organic carbon (SOC), total nitrogen (TN), total potassium (TK), total phosphorus (TP), alkaline nitrogen (AN), available phosphorus (AP), available potassium (AK), ammonium nitrogen (NH4+-N), nitrate nitrogen (NO3-N), pH, water content (WC), urease and protease. The results highlight the significant role of water content (WC) in shaping microbial dynamics. WC was significantly correlated with Actinobacteriota (p < 0.05) and exhibited a highly significant correlation with Chao1 diversity (p < 0.01). These findings suggest that WC is a key environmental factor influencing microbial abundance and community structure under fire-affected conditions. Other soil properties showed no significant correlations with the microbial community composition or diversity (p ≥ 0.05), indicating that these soil nutrients may have limited direct effects on microbial communities in the studied environment. However, correlations between soil properties revealed a strong relationship between SOC and urease (p < 0.001) and protease (p < 0.01), while AK also showed a significant correlation with urease (p < 0.001). These results underscore the interconnectedness between soil nutrient availability and enzyme activity, which may indirectly influence microbial communities. These Mantel test results emphasize the importance of WC in shaping both microbial abundance and Actinobacteriota composition. The observed correlations between soil properties, such as the relationship between SOC and enzyme activity, suggest that complex interactions within the soil environment may indirectly affect microbial communities. These findings provide valuable insights that can inform the development of structural equation models for future analyses.
Figure 3. Spearman correlation and Mantel test analysis between soil environmental factors and Actinobacteriota/Chao1. Soil environmental factors include soil organic carbon (SOC), total nitrogen (TN), total potassium (TK), alkaline nitrogen (AN), available phosphorus (AP), available potassium (AK), ammonium nitrogen (NH4+−N), nitrate nitrogen (NO3−N), pH, water content (WC), urease, and protease. The upper triangular matrix in Figure 2 displays the Spearman correlation coefficients between the environmental factors, with colors representing the strength and direction of the correlations (blue for negative, red for positive). The size of the squares is proportional to the magnitude of the correlation coefficients. In the squares, asterisks represent statistical significance: *** indicates p < 0.001, ** indicates p = 0.001–0.01, * indicates p = 0.01–0.05, and no asterisk indicates non-significance. Overlaying the correlation matrix, lines represent significant relationships identified by the Mantel test, with line colors indicating the p-value categories (0.001–0.01, 0.01–0.05, ≥0.05). Line thickness represents the Mantel’s r value, and line type (solid or dashed) corresponds to the p-value significance levels.

3.3. Differential Responses of Actinobacteriota Class to Fire Severities Across Soil Layers

The chord diagram (Figure 4) illustrates the relative abundance and interactions of Actinobacteriota classes under different fire severities (C: Control, L: Light, M: Moderate, H: High) across two soil layers (top layer: 0–10 cm; sub layer: 10–20 cm). In our study, five Actinobacteriota classes were identified: Acidimicrobiia, Actinobacteria, MB_A2_108, Rubrobacteria, and Thermoleophilia.
Figure 4. The relative abundance and interactions of Actinobacteriota classes under different fire severities (C: Control, L: Light, M: Moderate, H: High) across two soil layers (top layer: 0–10 cm; subsoil: 10–20 cm). Panel A shows the trend lines representing the changes in relative abundance of each class, while Panel B displays the chord diagram illustrating the interactions between these classes. Due to the variation in relative abundance among different classes, the data were normalized, meaning that the actual values on the y-axis are not meaningful. Instead, the focus is on the directional trends (increase or decrease) in abundance following different fire severities.
For Acidimicrobiia, the relative abundance in the topsoil was higher in fire-affected soils than in unburned soils, with the greatest increase observed under light-severity fire conditions. However, in the subsoil, Acidimicrobiia exhibited a decrease in relative abundance under light-severity fire, while moderate-severity fire resulted in an increase. For Actinobacteria, a similar trend was observed in both the topsoil and subsoil: light and moderate severity fires increased the relative abundance of Actinobacteria, while high-severity fire resulted in little to no change in abundance. For MB_A2_108, the relative abundance in the topsoil was consistently lower in fire-affected soils compared to unburned soils, with the most substantial reduction occurring under light-severity fire. In contrast, in the subsoil, the relative abundance of MB_A2_108 gradually increased with increasing fire severity. Regarding Rubrobacteria, the trends in the topsoil and subsoil were generally consistent. Under light- and moderate-severity fires, the relative abundance of Rubrobacteria slightly decreased, while under high-severity fire, it showed a slight increase. For Thermoleophilia, the relative abundance in the topsoil and subsoil remained similar to that of unburned soils under light-severity fire. Moderate-severity fire resulted in a significant increase in Thermoleophilia abundance, while high-severity fire led to a decrease in its relative abundance.
Together with the data from Figure 2, these results suggest that while the relative abundance of Actinobacteriota increased after light- and moderate-severity fires compared to unburned soils, the increase was driven predominantly by Acidimicrobiia and Actinobacteria under light-severity fire. In contrast, under moderate-severity fire, the increase in Actinobacteriota abundance was attributed to the combined effect of Acidimicrobiia, Actinobacteria, and Thermoleophilia. These findings highlight the differential responses of Actinobacteriota classes to varying fire severities, indicating that different classes within the phylum have distinct responses to fire disturbance.
The volcano plot analysis (Figure 5) provides a detailed view of the relative abundance changes in Actinobacteriota classes—Acidimicrobiia, Actinobacteria, MB_A2_108, Thermoleophilia, and Rubrobacteria—under different fire severities (C vs. L, C vs. M, C vs. H). In the comparison between control and light-severity fire (C vs. L), Actinobacteria showed a significant increase in abundance, with a much higher increase compared to other classes, reflecting its adaptability to mild fire-induced changes. In contrast, Thermoleophilia exhibited a marked reduction, highlighting its sensitivity to light-severity fire. No significant changes were observed for Acidimicrobiia, MB_A2_108, and Rubrobacteria under this condition. When comparing control with moderate-severity fire (C vs. M), Actinobacteria maintained a significant increase, although the magnitude of the increase was lower than in the light-severity fire comparison, as indicated by FDR analysis. Thermoleophilia continued to decrease. In comparison with high-severity fire (C vs. H), Actinobacteria still exhibited the highest increases, but the magnitude of the increase was significantly lower than in both the light- and moderate-severity fires. Additionally, the highest decrease in abundance was also observed in Actinobacteria, indicating a more complex response of Actinobacteria to high fire severity. Thermoleophilia showed the most significant reduction, with a decline greater than in both the light- and moderate-fire severities. These results show the differential sensitivities of Actinobacteria and Thermoleophilia to varying fire severities. Other classes, including Acidimicrobiia, MB_A2_108, and Rubrobacteria, showed a degree of stability across different fire severities.
Figure 5. Volcano plot of Actinobacteriota classes (Acidimicrobiia, Actinobacteria, MB_A2_108, Thermoleophilia, and Rubrobacteria) under different fire severities (C: Control, L: Light, M: Moderate, H: High). The plot visualizes the differential responses of these classes to varying fire severities. Class-specific responses are represented by the x-axis (log2FC) and y-axis (statistical significance, -log10FDR). The top three significantly increased and decreased classes are highlighted for clarity.

3.4. Structural Equation Model of Soil Properties, Actinobacteriota, and Enzyme Activity

A Variance Inflation Factor (VIF) analysis was performed to remove highly collinear factors, with factors having VIFs greater than 10 excluded. The remaining factors were used to construct a Structural Equation Model (SEM), with the results shown in Figure 6. The model achieved good fit indices, indicating that the hypothesized relationships among fire-related factors, soil properties, microbial communities, and nutrient-cycling processes were well supported (χ2 = 2.78, df = 3, cfi = 1.0, rmsea = 0.05, p = 0.427). Fire severity had a significant negative effect on soil chemical properties (β = −0.36). However, fire severity did not have a significant direct effect on soil water content (WC), Actinobacteriota abundance, or nutrient decomposition enzymes. Soil depth had a significant negative effect on WC (β = −0.53), indicating that deeper soil layers have lower water content. WC showed a significant negative correlation with Actinobacteriota abundance (β = −0.54), suggesting that drier conditions favor Actinobacteriota. However, no significant direct relationship was observed between WC and soil chemical properties. Actinobacteriota abundance negatively influenced nutrient decomposition enzymes (β = −0.56). Enzyme activity positively influenced soil chemical properties (β = 0.52), suggesting that increased enzymatic activity enhances soil chemical indicators.
Figure 6. Structural Equation Model of fire severities on soil properties, Actinobacteriota, and enzymes. The model shows the hypothesized relationships between fire severity, soil properties, Actinobacteriota, and nutrient decomposition enzymes. Gray lines indicate no significant direct effects, red lines represent significant positive effects, and green lines represent significant negative effects. Statistical significance levels indicated by * for p < 0.05, ** for p < 0.01.

4. Discussion

4.1. Impact of Wildfire on Soil Properties, Actinobacteriota, and Enzymes

The results of this study demonstrate that fire severity significantly influences soil chemical properties. Fire severity was found to have a negative impact on soil chemical properties, suggesting that more intense fires lead to a decrease in soil fertility. This aligns with previous studies that have shown that wildfires can alter soil pH, deplete essential nutrients, and degrade organic matter, all of which contribute to the reduction in soil chemical properties [52,53]. These changes in soil properties are critical, as they not only affect soil fertility but also have cascading effects on microbial communities and ecosystem functions [54]. However, in our research, fire severity did not significantly affect changes in soil water content (WC). To further validate the SEM finding that fire severity does not directly affect soil water content (WC), a between-subjects effect test (ANOVA) was conducted (Table 2). The results showed that fire severity had no significant direct effect on WC (F = 0.888, p = 0.468), while the soil layer exhibited a significant effect (F = 7.248, p = 0.016). The interaction term (Severity × Layer) was also not significant (F = 0.568, p = 0.644). These results confirm that the observed variations in WC are primarily driven by soil depth rather than fire severity, consistent with the pathways indicated in the SEM model. This finding is similar to some previous studies [55]. This may be because, although wildfire disrupts trees and vegetation, it does not significantly alter soil structure [56]. Alternatively, it could be due to the passage of time since the fire, as although soil structure may have been temporarily disrupted in the short term, after several years of recovery, the soil’s water retention capacity has gradually returned to levels similar to those before the fire [57]. Furthermore, our research shows that soil depth has a significant negative effect on soil water content, consistent with the natural decline in moisture content with increasing soil depth [58]. This is because surface soils typically have higher organic matter content, which can increase water-holding capacity [59]. This result highlights the role of soil structure in regulating moisture retention.
Table 2. ANOVA results for the effects of fire severity and soil layer on soil water content.
In fire-affected soils, changes in soil structure and organic matter content could further exacerbate this gradient, potentially altering moisture availability in the upper layers more than in deeper layers [1]. Our SEM analysis shows that fire severity did not have a direct effect on Actinobacteriota abundance or nutrient decomposition enzymes. Similar findings have been reported by Cheng et al., where no direct relationship between fire intensity and microbial or enzymatic activity was observed [60]. However, as shown in Figure 2, the relative abundance of Actinobacteriota was significantly higher after light and moderate fires compared to that in unburned soils. Combining the results from Figure 2 and Figure 6, it can be inferred that wildfire likely had an indirect impact on Actinobacteriota abundance. This may be because wildfire can alter the soil’s water retention capacity or nutrient availability, thereby indirectly affecting the structure of microbial communities [61]. Overall, the findings suggest that while fire severity has a direct and significant impact on soil chemical properties, its effects on microbial and enzymatic activities are more complex and likely mediated through changes in soil moisture and nutrient availability.

4.2. Actinobacteriota and Its Classes in Post-Fire Changes and Their Impact on Soil Nutrients and Enzymes

Actinobacteriota plays a crucial role in post-fire soil recovery, particularly in nutrient cycling and the regulation of soil enzymes. These microorganisms are essential for breaking down organic matter and recycling nutrients [62,63,64]. However, our study found a significant negative correlation between Actinobacteriota abundance and nutrient decomposition enzyme activity, consistent with findings from other previous studies [65]. Higher Actinobacteriota abundance may suppress enzyme activity, possibly due to competition for substrates or changes in resource availability, as observed in other ecosystems [66,67]. While this suppression could delay nutrient cycling, Actinobacteriota’s role in organic matter decomposition remains essential, particularly in post-fire environments where the breakdown of organic material is critical for nutrient release [68]. In general, Actinobacteriota can both support and suppress enzymatic processes, underscoring the complexity of post-fire soil recovery mechanisms.
Our research shows that different classes within Actinobacteriota exhibit varying responses to fire severity. Acidimicrobiia and Actinobacteria showed significant increases in abundance after fire. These microbial groups are well-known for their ability to decompose complex organic matter, such as plant debris and cellulose, which are abundant in fire-affected soils. Their proliferation in post-fire environments is likely due to their adaptability to altered conditions, particularly their ability to thrive on the complex carbon sources released during fire-induced disturbances. This increase in abundance is consistent with findings from previous studies that suggest Actinobacteriota plays a key role in organic matter decomposition in fire-impacted ecosystems [69]. Specifically, Acidimicrobiia showed a notable increase in the topsoil, which may be due to the availability of fresh organic material and the favorable conditions created by fire-induced changes in the soil environment. Similar findings have been reported in previous studies [70]. Thermoleophilia exhibited a mixed response under fire-affected conditions in this study. While its overall abundance increased under moderate fire severity, volcano plot analysis showed that specific taxa within this class were among the most negatively impacted under the same conditions. This suggests intra-class variability, where certain taxa may adapt to moderate fire conditions while others are more sensitive to fire-induced changes in carbon composition and pH. Similar findings have been reported in previous studies, highlighting Thermoleophilia sensitivity to post-fire environmental shifts [26]. MB_A2_108 showed contrasting responses between the topsoil and subsoil after fire exposure. In the topsoil, its relative abundance was consistently lower in fire-affected soils compared to unburned soils, with the most substantial reduction observed under light-severity fire. In contrast, in the subsoil, the relative abundance of MB_A2_108 gradually increased with increasing fire severity. This pattern suggests that MB_A2_108 may be sensitive to fire-induced changes in the topsoil but more adaptable in deeper soil layers where fire impacts are moderated. While specific studies on MB_A2_108 after fire exposure are limited, similar patterns of microbial adaptation to fire-affected environments have been observed in other Actinobacteriota groups [19,71]. Rubrobacteria displayed more stable abundances and slight reductions in the topsoil across fire severities. Its resilience may be attributed to its known thermotolerant characteristics, allowing it to endure high temperatures and potentially benefit from fire-induced changes in organic carbon availability [72].
In conclusion, the different responses of Actinobacteriota classes highlight their distinct ecological roles and adaptability to fire-induced changes in soil conditions. In general, while Actinobacteriota may suppress certain enzymatic activities, their role in organic matter decomposition and nutrient cycling remains crucial. The differing responses of Actinobacteriota classes emphasize the complexity of microbial recovery and the need to consider class-specific adaptations in post-fire soil restoration.

4.3. Stability of Soil Ecosystems After Fire

The post-fire soil environment often experiences a complex interplay between various factors, including soil chemical properties, microbial communities, and enzymatic activities. In this study, we found that fire severity negatively affected soil chemical properties, while enzymatic activity exhibited a positive influence, particularly through the enhancement of nutrient cycling. This dual interaction between fire-induced disturbances and enzymatic processes appears to have contributed to the development of a relatively stable regulatory mechanism in the post-fire soil environment. High fire intensity leads to nutrient volatilization, reduced organic matter, and altered pH, negatively impacting soil fertility [73,74]. While fire severity can influence recovery time, many studies have shown that the recovery of soil properties is a result of multiple factors working together [75]. Nutrient decomposition enzymes positively influence soil chemical properties and play a critical role in mitigating fire’s negative effects by breaking down organic matter and releasing essential nutrients like nitrogen, phosphorus, and carbon [76]. This positive feedback between enzymatic activity and soil chemistry helps stabilize the soil environment post-fire. Although fire decreases soil chemical properties, the compensatory effect of enzyme activity fosters a more resilient system [77]. Furthermore, other studies pointed out that Actinobacteriota can improve the structural stability of soil aggregates and that microorganisms in the soil can secrete cementing substances (such as extracellular polysaccharides, mucopolysaccharides, etc.) or form microbial bodies, which can also promote the formation of large aggregates of soil clay [78]. Their interaction with enzymes and adaptation to post-fire conditions highlights the importance of microbial processes in maintaining soil health. Post-fire soil stability is driven by the interplay between fire-induced degradation and the positive contributions of enzymatic and microbial activities. Understanding these mechanisms is crucial for managing soils in fire-prone ecosystems and enhancing resilience to future fire disturbances.

5. Conclusions

This study provides a detailed examination of the interactions between fire severity, soil properties, microbial communities, and enzymatic activities in post-fire ecosystems. Our results demonstrate that wildfire impacts on Pinus tabulaeformis forest soils are primarily mediated through mutual interactions rather than direct effects. Specifically, fire significantly reduces soil fertility by altering chemical properties, such as nutrient availability and pH. These changes indirectly affect microbial dynamics and enzymatic activities by creating resource and environmental constraints. Actinobacteriota, a pivotal microbial group, plays a dual role in nutrient cycling and enzymatic regulation, potentially suppressing enzymatic activity under specific conditions. The interplay between fire-induced chemical changes and enzymatic activity forms a stabilizing feedback mechanism that supports soil ecosystem resilience. This study advances understanding of the mechanisms driving soil recovery in fire-affected regions and underscores the ecological importance of microbial communities and enzymatic processes. Future research should prioritize the long-term monitoring of fire impacts on microbial community structure and nutrient cycling. Additionally, investigating the interactions between fire intensity, enzymatic activity, and microbial adaptations across different soil layers will provide further insights into soil health restoration.

Author Contributions

Conceptualization, G.L.; Methodology, G.L.; Software, G.L. and J.L.; Validation, G.L., B.L. and J.L.; Formal analysis, G.L. and B.L.; Investigation, G.L., B.L., Z.G. and X.L.; Resources, G.L., B.L. and X.L.; Data curation, G.L., B.L., Z.G. and X.L.; Writing—original draft, G.L.; Writing—review and editing, B.L., Z.G. and X.L.; Visualization, G.L. and B.L.; Supervision, X.L.; Project administration, X.L.; Funding acquisition, X.L. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the National Natural Science Foundation of China [32271890].

Data Availability Statement

All data are available on reasonable request to the corresponding authors.

Acknowledgments

The authors would like to thank the Beijing Key Laboratory for Forest Resources and Ecosystem Processes at Beijing Forestry University for providing support during this study.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Arunrat, N.; Kongsurakan, P.; Solomon, L.W.; Sereenonchai, S. Fire Impacts on Soil Properties and Implications for Sustainability in Rotational Shifting Cultivation: A Review. Agriculture 2024, 14, 1660. [Google Scholar] [CrossRef]
  2. Dove, N.C.; Tas, N.; Hart, S.C. Ecological and genomic responses of soil microbiomes to high-severity wildfire: Linking community assembly to functional potential. ISME J. 2022, 16, 1853–1863. [Google Scholar] [CrossRef]
  3. Li, T.; Cui, L.; Liu, L.; Chen, Y.; Liu, H.; Song, X.; Xu, Z. Advances in the study of global forest wildfires. J. Soils Sediments 2023, 23, 2654–2668. [Google Scholar] [CrossRef]
  4. Bercak, R.; Holusa, J.; Trombik, J.; Resnerova, K.; Hlasny, T. A Combination of Human Activity and Climate Drives Forest Fire Occurrence in Central Europe: The Case of the Czech Republic. Fire 2024, 7, 109. [Google Scholar] [CrossRef]
  5. Campos-Ruiz, R.; Parisien, M.; Flannigan, M.D. Temporal Patterns of Wildfire Activity in Areas of Contrasting Human Influence in the Canadian Boreal Forest. Forests 2018, 9, 159. [Google Scholar] [CrossRef]
  6. O’Kelley, R.; Evered, A.; Peter-Contesse, H.; Moore, J.; Lajtha, K. Postfire extracellular enzyme activity in a temperate montane forest. Soil Sci. Soc. Am. J. 2024, 88, 2277–2294. [Google Scholar] [CrossRef]
  7. Nocentini, A.; Kominoski, J.S.; O’Brien, J.J.; Redwine, J. Fire intensity and ecosystem oligotrophic status drive relative phosphorus release and retention in freshwater marshes. Ecosphere 2022, 13, e4263. [Google Scholar] [CrossRef]
  8. Yao, Y.; Hu, Y.; Kou, Z.; Zhang, B. Spatial patterns of Pinus tabulaeformis and Pinus massoniana forests in Qinling-Daba Mountains and the boundary of subtropical and warm temperate zones. J. Geogr. Sci. 2020, 30, 1523–1533. [Google Scholar] [CrossRef]
  9. Cai, L.; Li, J.; Bai, X.; Jin, Y.; Chen, Z. Variations in the growth response of Pinus tabulaeformis to a warming climate at the northern limits of its natural range. Trees 2020, 34, 707–719. [Google Scholar] [CrossRef]
  10. Yin, C.; He, B.; Quan, X.; Yebra, M.; Lai, G. Remote Sensing of Burn Severity Using Coupled Radiative Transfer Model: A Case Study on Chinese Qinyuan Pine Fires. Remote Sens. 2020, 12, 3590. [Google Scholar] [CrossRef]
  11. Yin, C.; Xing, M.; Yebra, M.; Liu, X. Relationships between Burn Severity and Environmental Drivers in the Temperate Coniferous Forest of Northern China. Remote Sens. 2021, 13, 5127. [Google Scholar] [CrossRef]
  12. Bereczki, K.; Toth, E.G.; Szili-Kovacs, T.; Megyes, M.; Korponai, K.; Lados, B.B.; Illes, G.; Benke, A.; Marialigeti, K. Soil Parameters and Forest Structure Commonly Form the Microbiome Composition and Activity of Topsoil Layers in Planted Forests. Microorganisms 2024, 12, 1162. [Google Scholar] [CrossRef] [PubMed]
  13. Hua, H.; Sui, X.; Liu, Y.; Liu, X.; Chang, Q.; Xu, R.; Li, M.; Mu, L. Effects of Land Use Type Transformation on the Structure and Diversity of Soil Bacterial Communities. Life 2024, 14, 252. [Google Scholar] [CrossRef] [PubMed]
  14. Wang, Y.; Xu, Y.; Jiang, L.; Yang, Y.; Shi, J.; Guan, X.; Sun, T.; Zhao, H.; Wang, Y.; Liu, Y. Effect of Mild Organic Substitution on Soil Quality and Microbial Community. Agronomy 2024, 14, 888. [Google Scholar] [CrossRef]
  15. Han, C.; Chen, L.; Jia, Z.; Zou, H.; Ma, L.; Feng, B.; Li, J.; Zhou, G.; Zhang, C.; Ma, D.; et al. Joint regulation of the soil organic carbon accumulation by mineral protection and microbial properties following conservation practices. Catena 2024, 245, 108298. [Google Scholar] [CrossRef]
  16. Cui, F.; Li, Q.; Shang, S.; Hou, X.; Miao, H.; Chen, X. Effects of cotton peanut rotation on crop yield soil nutrients and microbial diversity. Sci. Rep. 2024, 14, 28072. [Google Scholar] [CrossRef]
  17. Bowd, E.J.; Egidi, E.; Lindenmayer, D.B.; Wardle, D.A.; Kardol, P.; Cary, G.J.; Foster, C. Direct and indirect effects of fire on microbial communities in a pyrodiverse dry-sclerophyll forest. J. Ecol. 2022, 110, 1687–1703. [Google Scholar] [CrossRef]
  18. Li, W.K.; Niu, S.K.; Liu, X.D.; Wang, J.M. Short-term response of the soil bacterial community to differing wildfire severity in Pinus tabulaeformis stands. Sci. Rep. 2019, 9, 1148. [Google Scholar] [CrossRef]
  19. Qin, Q.; Liu, Y. Changes in microbial communities at different soil depths through the first rainy season following severe wildfire in North China artificial Pinus tabulaeformis forest. J. Environ. Manag. 2021, 280, 111865. [Google Scholar] [CrossRef]
  20. Niccoli, F.; Esposito, A.; Altieri, S.; Battipaglia, G. Fire Severity Influences Ecophysiological Responses of Pinus pinaster Ait. Front. Plant Sci. 2019, 10, 539. [Google Scholar] [CrossRef]
  21. Liu, J.; Qiu, L.; Wang, X.; Wei, X.; Gao, H.; Zhang, Y.; Cheng, J. Effects of wildfire and topography on soil nutrients in a semiarid restored grassland. Plant Soil 2018, 428, 123–136. [Google Scholar] [CrossRef]
  22. Smith, N.R.; Kishchuk, B.E.; Mohn, W.W. Effects of wildfire and harvest disturbances on forest soil bacterial communities. Appl. Environ. Microbiol. 2008, 74, 216–224. [Google Scholar] [CrossRef] [PubMed]
  23. Jhariya, M.K.; Singh, L. Effect of fire severity on soil properties in a seasonally dry forest ecosystem of Central India. Int. J. Environ. Sci. Technol. 2021, 18, 3967–3978. [Google Scholar] [CrossRef]
  24. Memoli, V.; Panico, S.C.; Esposito, F.; Barile, R.; De Marco, A.; Maisto, G. Volcanic soil phytotoxicity in a burnt Mediterranean area. Catena 2019, 183, 104181. [Google Scholar] [CrossRef]
  25. Pule, H.T.; Tjelele, J.T.; Tedder, M.J. Post-Fire Soil Nutrient Dynamics in Seriphium plumosum L. Encroached Semi-Arid Grassland of Gauteng Province, South Africa. Agriculture 2023, 13, 1971. [Google Scholar] [CrossRef]
  26. Zhou, H.; Yang, M.; Luo, X.; Yang, Z.; Wang, L.; Liu, S.; Zhang, Q.; Luo, M.; Ou, J.; Xiong, S.; et al. Short-Term Impacts of Fire and Post-Fire Restoration Methods on Soil Properties and Microbial Characteristics in Southern China. Fire 2024, 7, 474. [Google Scholar] [CrossRef]
  27. Lu, Y.; Wang, X.; Wang, M.; Zhu, B.; Zheng, M.; Li, S.; Song, K. Soil color mapping based on Munsell system in the northeast of China. Geoderma 2023, 439, 116669. [Google Scholar] [CrossRef]
  28. Luo, C.; Wang, Y.; Zhang, X.; Zhang, W.; Liu, H. Spatial prediction of soil organic matter content using multiyear synthetic images and partitioning algorithms. Catena 2022, 211, 106023. [Google Scholar] [CrossRef]
  29. Abrams, D.; Metcalf, D.; Hojjatie, M. Determination of Kjeldahl Nitrogen in Fertilizers by AOAC Official MethodSM 978.02: Effect of Copper Sulfate as a Catalyst. J. AOAC Int. 2014, 97, 764–767. [Google Scholar] [CrossRef]
  30. Tylova-Munzarova, E.; Lorenzen, B.; Brix, H.; Votrubova, O. The effects of NH4+ and NO3 on growth, resource allocation and nitrogen uptake kinetics of Phragmites australis and Glyceria maxima. Aquat. Bot. 2005, 81, 326–342. [Google Scholar] [CrossRef]
  31. Ronalds, J.A. Determination of the protein content of wheat and barley by direct alkaline distillation. J. Sci. Food Agric. 1974, 25, 179–185. [Google Scholar] [CrossRef] [PubMed]
  32. Olsen, S.R. Estimation of Available Phosphorus in Soils by Extraction with Sodium Bicarbonate; US Department of Agriculture: Washington, DC, USA, 1954.
  33. Page, A.L. (Ed.) Methods of Soil Analysis. Part 2: Chemical and Microbiological Properties; Wiley: Hoboken, NJ, USA, 1982; ISBN 0891180729. [Google Scholar]
  34. Lei, O.; Zhang, R. Effects of biochars derived from different feedstocks and pyrolysis temperatures on soil physical and hydraulic properties. J. Soils Sediments 2013, 13, 1561–1572. [Google Scholar] [CrossRef]
  35. O’Keeffe, M.; Sherington, J. Comparison of three methods for the determination of urea in compound feed and silage. Analyst 1983, 108, 1374–1379. [Google Scholar] [CrossRef] [PubMed]
  36. Maheshwari, R.; Dubey, R.S. Nickel toxicity inhibits ribonuclease and protease activities in rice seedlings: Protective effects of proline. Plant Growth Regul. 2007, 51, 231–243. [Google Scholar] [CrossRef]
  37. Lee, C.K.; Barbier, B.A.; Bottos, E.M.; Mcdonald, I.R.; Cary, S.C. The Inter-Valley Soil Comparative Survey: The ecology of Dry Valley edaphic microbial communities. ISME J. 2012, 6, 1046–1057. [Google Scholar] [CrossRef]
  38. Chao, A. Nonparametric estimation of the number of classes in a population. Scand. J. Stat. 1984, 11, 265–270. [Google Scholar]
  39. Chao, A.; Lee, S. Estimating the number of classes via sample coverage. J. Am. Stat. Assoc. 1992, 87, 210–217. [Google Scholar] [CrossRef]
  40. Robinson, M.D.; Mccarthy, D.J.; Smyth, G.K. edgeR: A Bioconductor package for differential expression analysis of digital gene expression data. Bioinformatics 2010, 26, 139–140. [Google Scholar] [CrossRef]
  41. Benjamini, Y.; Hochberg, Y. Controlling the false discovery rate: A practical and powerful approach to multiple testing. J. R. Stat. Soc. Ser. B (Methodol.) 1995, 57, 289–300. [Google Scholar] [CrossRef]
  42. Grace, J.B. Structural Equation Modeling and Natural Systems; Cambridge University Press: Cambridge, UK, 2006; ISBN 1139457845. [Google Scholar]
  43. Zuur, A.F.; Ieno, E.N.; Elphick, C.S. A protocol for data exploration to avoid common statistical problems. Methods Ecol. Evol. 2010, 1, 3–14. [Google Scholar] [CrossRef]
  44. Jolliffe, I.T.; Cadima, J. Principal component analysis: A review and recent developments. Philos. Trans. R. Soc. A Math. Phys. Eng. Sci. 2016, 374, 20150202. [Google Scholar] [CrossRef] [PubMed]
  45. Rosseel, Y. lavaan: An R package for structural equation modeling. J. Stat. Softw. 2012, 48, 1–36. [Google Scholar] [CrossRef]
  46. Shipley, B. Cause and Correlation in Biology: A User’s Guide to Path Analysis, Structural Equations and Causal Inference with R; Cambridge University Press: Cambridge, UK, 2016; ISBN 1107442591. [Google Scholar]
  47. Osborne, J. Improving your data transformations: Applying the Box-Cox transformation. Pract. Assess. Res. Eval. 2010, 15, 12. [Google Scholar]
  48. Mantel, N. The detection of disease clustering and a generalized regression approach. Cancer Res. 1967, 27, 209–220. [Google Scholar]
  49. Legendre, P. Numerical Ecology; Elsevier: Amsterdam, The Netherlands, 2012. [Google Scholar]
  50. Wickham, H.; Wickham, H. Data Analysis; Springer: Berlin/Heidelberg, Germany, 2016; ISBN 331924275X. [Google Scholar]
  51. Gu, Z.; Gu, L.; Eils, R.; Schlesner, M.; Brors, B. “Circlize” implements and enhances circular visualization in R. Bioinformatics 2014, 30, 2811–2812. [Google Scholar] [CrossRef]
  52. Kooch, Y.; Nouraei, A.; Wu, D.H.; Francaviglia, R.; Frouz, J. The effect of fire disturbance on the dynamics of soil physical, chemical, and biological properties over time in a semi-arid region. Appl. Soil Ecol. 2024, 202, 105568. [Google Scholar] [CrossRef]
  53. Salgado, L.; Alvarez, M.G.; Díaz, A.M.; Gallego, J.R.; Forján, R. Impact of wildfire recurrence on soil properties and organic carbon fractions. J. Environ. Manag. 2024, 354, 120293. [Google Scholar] [CrossRef]
  54. Agbeshie, A.A.; Awuah, R. Impact of fire-burn on soil geochemical, microbial biomass and carbon stocks in a dry tropical forest ecosystem. Int. J. Environ. Sci. Technol. 2024, 1–14. [Google Scholar] [CrossRef]
  55. Kitzberger, T.; Raffaele, E.; Heinemann, K.; Mazzarino, M.J. Effects of fire severity in a north Patagonian subalpine forest. J. Veg. Sci. 2005, 16, 5–12. [Google Scholar] [CrossRef]
  56. Jordan, A.; Zavala, L.M.; Mataix-Solera, J.; Nava, A.L.; Alanis, N. Effect of fire severity on water repellency and aggregate stability on Mexican volcanic soils. Catena 2011, 84, 136–147. [Google Scholar] [CrossRef]
  57. Granged, A.J.P.; Zavala, L.M.; Jordan, A.; Barcenas-Moreno, G. Post-fire evolution of soil properties and vegetation cover in a Mediterranean heathland after experimental burning: A 3-year study. Geoderma 2011, 164, 85–94. [Google Scholar] [CrossRef]
  58. Fierer, N.; Schimel, J.P.; Holden, P.A. Variations in microbial community composition through two soil depth profiles. Soil Biol. Biochem. 2003, 35, 167–176. [Google Scholar] [CrossRef]
  59. Werner, W.J.; Sanderman, J.; Melillo, J.M. Decreased Soil Organic Matter in a Long-Term Soil Warming Experiment Lowers Soil Water Holding Capacity and Affects Soil Thermal and Hydrological Buffering. J. Geophys. Res. Biogeosci. 2020, 125, e2019JG005158. [Google Scholar] [CrossRef]
  60. Cheng, Z.; Wu, S.; Pan, H.; Lu, X.; Liu, Y.; Yang, L. Effect of Forest Fires on the Alpha and Beta Diversity of Soil Bacteria in Taiga Forests: Proliferation of Rare Species as Successional Pioneers. Forests 2024, 15, 606. [Google Scholar] [CrossRef]
  61. Shi, Z.; Chen, Y.; Li, A.; Hu, M.; Liu, W. Fire alters soil bacterial and fungal communities and intensifies seasonal variation in subtropical forest ecosystem. Eur. J. Soil Biol. 2024, 123, 103677. [Google Scholar] [CrossRef]
  62. Tian, J.Q.; Wang, H.J.; Vilgalys, R.; Ho, M.C.; Flanagan, N.; Richardson, C.J. Response of fungal communities to fire in a subtropical peatland. Plant Soil 2021, 466, 525–543. [Google Scholar] [CrossRef]
  63. Wang, C.; Wu, M.; Peng, C.; Yan, F.; Jia, Y.; Li, X.; Li, M.; Wu, B.; Xu, H.; Qiu, Z. Bacterial dynamics and functions driven by a novel microbial agent to promote kitchen waste composting and reduce environmental burden. J. Clean. Prod. 2022, 337, 130491. [Google Scholar] [CrossRef]
  64. Shi, J.; Qian, W.; Zhou, Z.; Jin, Z.; Gao, X.; Fan, J.; Wang, X. Effects of acid mine drainage and sediment contamination on soil bacterial communities, interaction patterns, and functions in alkaline desert grassland. J. Hazard. Mater. 2024, 474, 134832. [Google Scholar] [CrossRef]
  65. Wang, J.; Song, M.; Lu, M.; Wang, C.; Zhu, C.; Dou, X. Insights into effects of conventional and biodegradable microplastics on organic carbon decomposition in different soil aggregates. Environ. Pollut. 2024, 359, 124751. [Google Scholar] [CrossRef]
  66. Wang, S.; Sun, Z.; Wang, S.; Yuan, H.; An, M.; Xia, Z.; Tang, Y.; Shen, C.; Kida, K. Bacterial Community Structure and Metabolic Function Succession During the Composting of Distilled Grain Waste. Appl. Biochem. Biotechnol. 2022, 194, 1479–1495. [Google Scholar] [CrossRef]
  67. Xiao, R.; Duan, B.; Dai, C.; Wu, Y. Soil Enzyme Activities and Microbial Nutrient Limitation of Various Temperate Forest Types in Northeastern China. Forests 2024, 15, 1815. [Google Scholar] [CrossRef]
  68. Ding, T.; Qian, R.; Guo, Z.; Huang, X.; Peng, X. Soil pore structure shaped compositions and structures of soil microbial community during 13C-labelled maize straw decomposition. Appl. Soil Ecol. 2024, 204, 105746. [Google Scholar] [CrossRef]
  69. Zhou, X.; Sun, H.; Sietio, O.; Pumpanen, J.; Heinonsalo, J.; Koster, K.; Berninger, F. Wildfire effects on soil bacterial community and its potential functions in a permafrost region of Canada. Appl. Soil Ecol. 2020, 156, 103713. [Google Scholar] [CrossRef]
  70. Zhai, K.; Hua, Y.; Liang, J.; Li, J.; Wang, Z.; Liu, L.; Gao, M.; Sa, R.; Zhao, M. Soil microbial diversity under different types of interference in birch secondary forest in the Greater Khingan Mountains in China. Front. Microbiol. 2023, 14, 1267746. [Google Scholar] [CrossRef]
  71. Sagova-Mareckova, M.; Zadorova, T.; Penizek, V.; Omelka, M.; Tejnecky, V.; Pruchova, P.; Chuman, T.; Drabek, O.; Buresova, A.; Vanek, A.; et al. The structure of bacterial communities along two vertical profiles of a deep colluvial soil. Soil Biol. Biochem. 2016, 101, 65–73. [Google Scholar] [CrossRef]
  72. Hatten, J.A.; Zabowski, D. Changes in Soil Organic Matter Pools and Carbon Mineralization as Influenced by Fire Severity. Soil Sci. Soc. Am. J. 2009, 73, 262–273. [Google Scholar] [CrossRef]
  73. Izbicki, B.; Walker, X.J.; Baltzer, J.L.; Day, N.J.; Ebert, C.; Johnstone, J.F.; Pegoraro, E.; Schuur, E.A.G.; Turetsky, M.R.; Mack, M.C. Drivers of legacy soil organic matter decomposition after fire in boreal forests. Ecosphere 2023, 14, e4672. [Google Scholar] [CrossRef]
  74. Chen, H.; Liu, F. Soil depth and recovery interval mediate soil water repellency under different forest types and fire intensity levels in China: Evidence for ecosystem resiliency. Soil Tillage Res. 2024, 237, 105982. [Google Scholar] [CrossRef]
  75. Li, J.; Niu, X.; Wang, P.; Yang, J.; Liu, J.; Wu, D.; Guan, P. Soil degradation regulates the effects of litter decomposition on soil microbial nutrient limitation: Evidence from soil enzymatic activity and stoichiometry. Front. Plant Sci. 2023, 13, 1090954. [Google Scholar] [CrossRef]
  76. Moya, D.; Gonzalez-De Vega, S.; Lozano, E.; Garcia-Orenes, F.; Mataix-Solera, J.; Lucas-Borja, M.E.; de Las Heras, J. The burn severity and plant recovery relationship affect the biological and chemical soil properties of Pinus halepensis Mill. stands in the short and mid-terms after wildfire. J. Environ. Manag. 2019, 235, 250–256. [Google Scholar] [CrossRef]
  77. Chen, M.; Liu, L.; Song, X.; Zhang, S.; Cheng, B.; Ding, X. How does phosphorus fertilizer improve the stability of soil aggregates? Evidence from a decade fertilization experiment. Plant Soil 2024, 504, 643–657. [Google Scholar] [CrossRef]
  78. Lan, J.; Wang, S.; Wang, J.; Qi, X.; Long, Q.; Huang, M. The Shift of Soil Bacterial Community After Afforestation Influence Soil Organic Carbon and Aggregate Stability in Karst Region. Front. Microbiol. 2022, 13, 901126. [Google Scholar] [CrossRef] [PubMed]
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Article Metrics

Citations

Article Access Statistics

Multiple requests from the same IP address are counted as one view.