Next Article in Journal
Effects of Nitrogen Addition on Soil Aggregate Stability and Mycorrhizal Morphological Characteristics: Differential Responses of Arbuscular Mycorrhizal and Ectomycorrhizal Fungi
Previous Article in Journal
Tree Species Classification Based on Point Cloud Completion
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Fingerprinting Chinese Sweetgum (Liquidambar formosana Hance) Accessions and Constructing a Core Collection Using Newly Developed SSR Markers

1
State Key Laboratory of Tree Genetics and Breeding, Research Institute of Tropical Forestry, Chinese Academy of Forestry, Guangzhou 510520, China
2
Guangzhou Institute of Forestry and Landscape Architecture, Guangzhou Collaborative Innovation Center on Science-Tech of Ecology and Landscape, Guangzhou 510405, China
*
Authors to whom correspondence should be addressed.
Forests 2025, 16(2), 281; https://doi.org/10.3390/f16020281
Submission received: 26 November 2024 / Revised: 25 January 2025 / Accepted: 29 January 2025 / Published: 6 February 2025
(This article belongs to the Section Genetics and Molecular Biology)

Abstract

Liquidambar formosana, endemic to China, is a multifunctional tree species valued for its wood production, urban landscaping, and medicinal applications. Here, 111 superior L. formosana accessions were genotyped using 24 novel expressed sequence tag-simple sequence repeat (EST-SSR) markers to assess genetic diversity and structure, establish DNA fingerprints, and construct a core collection. A high degree of genetic diversity was detected in the tested accessions, with mean values for the number of observed alleles (Na), polymorphism information content (PIC), and Shannon’s information index (I) recorded at 8.458, 0.579, and 1.336 per locus, respectively. Cluster analysis, principal coordinate analysis (PCoA), and population structure analysis collectively categorized these accessions into two major groups. Specifically, those from the SangZ provenance formed a distinct group, whereas accessions from other provenances exhibiting extensive gene exchange were assigned to the second group. The combined values of the probability of identity (PI) and the probability of identity among siblings (PIsibs) across 24 SSR loci were 1.475 × 10−19 and 2.561 × 10−8, respectively, indicating a strong ability for fingerprint identification. Unique fingerprints for the 111 accessions were established using four selected core markers. A final core collection consisting of 34 accessions was constructed using the allele maximization (M) strategy, accounting for 30.63% of the analyzed accessions. No significant differences in genetic diversity indicators, allele frequency distributions, and accession dispersion patterns were observed between the core and original collections, suggesting that the core collection could effectively represent the entire collection. This work will promote the identification, management, and conservation of L. formosana germplasm resources while providing valuable materials for the subsequent selection and breeding of this tree species.

1. Introduction

Chinese sweetgum (Liquidambar formosana Hance, 2n = 32), a large deciduous tree species belonging to the genus Liquidambar, family Altingiaceae, is naturally distributed in most temperate and subtropical regions of China and has abundant resource reserves [1]. L. formosana is an economically important species for wood production due to its fast growth rate and high-quality timber. In addition, it is also a valuable tree with diverse autumn leaf colors and is often used in urban landscaping [2]. In recent years, L. formosana has received increasing attention because its leaves are rich in shikimic acid, a key bioactive compound utilized as a precursor in the synthesis of the antiviral Tamiflu [3]. Selective breeding has been performed for this multipurpose tree species, and some progress has been made in the genetic improvement of different target traits, such as growth and stem form [4,5], wood properties [6], leaf shape and color [7,8], and shikimic acid content [9]. To date, hundreds of superior provenances, families, and individuals with desired characteristics have been screened out and can serve as basic materials for further breeding activities in L. formosana (e.g., genetic tests, parent selection for hybridization, and polyploidy induction). However, with the continuous increase in the number of new accessions, potential challenges arise from various adverse factors, including unclear accession identity and kinship, high resource maintenance costs, and limited utilization rates of accessions, which impedes the genetic improvement process of L. formosana. Therefore, it is necessary to confirm the identity, assess genetic diversity, and adopt effective methods to preserve and make use of these germplasm resources, thereby promoting genetic studies, conservation efforts, and germplasm innovations of L. formosana.
Traditional accession identification is dependent primarily on morphological data, which are relatively easy to obtain and can intuitively display differences between accessions. In the case of a large number of accessions, it is difficult to achieve effective identification using morphological features alone, principally because of their significant data acquisition errors and vulnerability to environmental factors, tree age, and the physiological stage of individual plants [10]. Molecular markers are free from environmental effects and have been demonstrated to be reliable tools for accurate accession identification [11]. Among the various types of molecular markers, simple sequence repeats (SSRs), or microsatellite markers, are characterized by abundant polymorphisms, high reproducibility, locus-specific amplification, a codominant nature, and extensive genome coverage [12]. Due to these favorable genetic attributes, SSR marker technology is recommended by the International Union for the Protection of New Varieties of Plants as one of the preferred methods for establishing DNA fingerprints to differentiate various accessions [13]. Furthermore, capillary electrophoresis has become the predominant technology for automated separation and detection of SSR amplification products and has gradually replaced the previously used low-resolution polyacrylamide gel electrophoresis [14]. To date, SSR marker-based fingerprinting sets have been constructed for a series of tree species, such as Prunus armeniaca L. and Prunus salicina Lindl. [15], Castanea mollissima Blume [16], Juglans sigillata Dode [17], Pinus koraiensis Sieb. et Zucc. [18], and Triadica sebifera (L.) Small [19]. These datasets are crucial for the identification and characterization of accessions, as well as for protecting the rights and interests of breeders.
The conservation and management of plant genetic resources are often costly, laborious, and time-consuming. The construction of a core collection representing a subset of accessions with minimum redundancy and maximum genetic diversity from an original collection is a practical method to reduce costs and increase the efficiency of genetic resources protection, management, and utilization [20,21]. SSR markers, which are widely used for genetic diversity analysis, have allowed the establishment of core collections in annual crops, including wheat (Triticum aestivum L.) [22], barley (Hordeum vulgare L.) [23], maize (Zea mays L.) [24], rice (Oryza sativa L.) [25], and wild soybean (Glycine soja Sieb. et Zucc.) [26]. Moreover, core collections have also been developed using SSR markers in many perennial trees, e.g., Castanea sativa Mill. [27], Eucalyptus cloeziana F. Muell. [28], Camellia sinensis (L.) O. Kuntze [29], Pinus tabuliformis Carr. [30], and Xanthoceras sorbifolium Bunge [31]. The results of these studies have collectively revealed the efficiency of the core collections in preserving and managing germplasm resources and provided desirable materials for accession evaluation, parental selection, gene discovery, marker development, genomic selection, and marker-assisted breeding [32,33,34,35].
The availability of transcriptome sequencing data provides an opportunity for the large-scale and cost-effective mining of expressed sequence tag-SSRs (EST-SSRs) [36]. Compared with traditional genomic SSRs, EST-SSRs exhibit greater cross-species transferability and are more likely to be tightly linked to functional genes associated with key breeding traits [37]. EST-SSR markers have played important roles in the fields of genetic diversity evaluation, variety identification, core collection construction, paternity determination, genetic linkage mapping, and marker-assisted selection. To date, studies on L. formosana have focused on the genetic diversity of different types of genetic materials using EST-SSR markers. For example, Sun et al. [2] employed 14 self-developed EST-SSR markers to explore the genetic diversity and differentiation of 25 natural populations of L. formosana covering nearly its entire geographic range in China. Chen et al. [38] designed and screened 16 pairs of SSR primers based on transcriptome data and evaluated the genetic diversity of 72 plus trees in the genus Liquidambar. However, the use of well-characterized EST-SSR markers for DNA fingerprinting and the construction of core collections in L. formosana breeding programs has not been reported to date.
In the present study, EST-SSR markers, which were newly developed based on transcriptome sequencing data, were used to construct DNA fingerprints of 111 L. formosana accessions with interesting phenotypic features, and a core collection representative of the overall genetic diversity of these excellent accessions was extracted. The detailed objectives of this work were (1) to screen and validate a new set of polymorphic EST-SSR markers and test their transferability in related Altingiaceae and Hamamelidaceae species; (2) to evaluate the genetic diversity of these accessions and clarify the genetic relationships among them; (3) to generate DNA fingerprints and confirm the identities of these accessions; and (4) to construct and validate the reliability of a suitable core collection. To our knowledge, this study is the first attempt to construct DNA fingerprints and a core collection of L. formosana accessions. Our study will contribute to the identification, conservation, and management of superior L. formosana germplasm resources and provide valuable materials for future breeding practices of this tree species.

2. Materials and Methods

2.1. Plant Materials and DNA Extraction

A total of 111 accessions (each accession represented by one individual) of L. formosana were selected from a provenance–family trial established in May 2008 at Heyuan, Guangdong Province (23°38′20″ N, 114°38′45″ E) using multiple-trait index selection [9]. The 111 accessions were divided into three types according to their main economic and ornamental characteristics, including ‘shikimic acid-rich’, ‘red-leaf’, and ‘yellow-leaf’, with 53, 54, and 4 accessions, respectively. Significant phenotypic differences in growth traits and leaf color parameters were observed among the three groups (Figure S1). Detailed information on these accessions, including name, type, and geographical origin, is provided in Table S1 and Figure S2. From January to March 2022, the scions of these individuals were grafted onto 2-year-old L. formosana rootstocks using the splitting grafting method at the nursery of the Institute of Tropical Forestry, Chinese Academy of Forestry (23°11′24″ N, 113°23′05″ E). After a year of scientific management, including precise irrigation and fertilization, systematic removal of rootstock sprouts, and rigorous pest and disease control, the normally growing ramets of 111 accessions were separated into three parts and planted in Qingyuan, Shaoguan, and Zhaoqing in Guangdong Province. In each trial, 3 to 25 ramets of similar size and vigor per accession were planted randomly at a spacing of 2 m × 3 m. Among the 111 accessions used for DNA fingerprinting and establishment of a core collection, 8 accessions derived from different provenances were chosen for screening polymorphic EST-SSR markers. Additionally, 10 related species from two genera of Altingiaceae and six genera of Hamamelidaceae, which were sampled from the South China Botanical Garden, Chinese Academy of Sciences (23°11′13″ N, 113°21′52″ E), were used to evaluate the cross-species transferability of the newly mined EST-SSR markers. These species included Altingia chinensis (Champ.) Oliv. ex Hance, Semiliquidambar cathayensis H. T. Chang, Corylopsis multiflora Hance, Distylium chinense (Fr.) Diels, Exbucklandia tonkinensis (Lec.) H. T. Chang, Loropetalum chinense (R. Br.) Oliv., L. chinense var. rubrum Yieh, Loropetalum subcordatum (Benth.) Oliv., Mytilaria laosensis Lec., and Rhodoleia championii Hook. f., with one to three individuals per species. Tender leaves for each accession were collected and stored in a self-sealed bag containing dry silica gel and then brought back to the laboratory until further use.
The genomic DNA for each accession was isolated using a plant genomic DNA kit (Tiangen, Beijing, China). DNA quality and concentration were determined using 0.8% agarose gels and a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA), respectively. The extracted DNA was finally diluted to 50 ng/μL for PCR amplification.

2.2. SSR Marker Screening and Genotyping

A set of 100 EST-SSR primer pairs was selected from a previously constructed primer library based on transcriptome sequencing data of L. formosana [38]. Eight accessions of L. formosana from different geographical sources were used as primary screening materials, and a subset of the resulting high-quality SSR primers was used to genotype 111 accessions of L. formosana and its 10 closely related species. Primer synthesis was performed at Rui Biotech (Beijing, China).
PCR amplification was conducted in 20 μL mixtures containing 2 μL of template DNA (50 ng/μL), 10 μL of 2 × Taq PCR Mix (Biomed-Tech, Beijing, China), 0.2 μL of universal fluorescent-labeled M13 primer (10 μM), 0.1 μL of forward primer (10 μM) with M13 tail at its 5′ end, 0.3 μL of reverse primer (10 μM), and 7.4 μL double-distilled water. The PCR procedure was as follows: 94 °C for 5 min; 30 cycles of 94 °C for 30 s, 56 °C for 30 s and 72 °C for 30 s; 8 cycles of 94 °C for 30 s, 53 °C for 30 s, and 72 °C for 30 s; and a final extension at 72 °C for 10 min. PCR products labeled with various fluorescence dyes (FAM, HEX, ROX, and TAMRA) in conjunction with the GeneScan 500 LIZ Size Standard were analyzed using a capillary-based ABI 3730XL DNA Analyzer (Applied Biosystems, Foster City, CA, USA), and the sizes of the amplicons were confirmed using Gene Mapper v4.0 (Applied Biosystems, Foster City, CA, USA).

2.3. Genetic Diversity and Structure Analysis

Microsatellite data, comprising the sizes of amplified fragments for different accessions at multiple loci, were compiled in Microsoft Excel 2019 (Microsoft, Redmond, WA, USA), and then these data were converted into formats that matched other analysis software using Convert version 1.3.1 [39]. Genetic diversity indicators such as the number of observed alleles (Na), number of effective alleles (Ne), observed heterozygosity (Ho), expected heterozygosity (He), Shannon’s information index (I), fixation index (F), polymorphism information content (PIC), probability of identity (PI), and probability of identity among siblings (PIsibs) at each locus were estimated using GenALEx version 6.5 [40,41] and Cervus version 3.0.3 [42]. Hardy–Weinberg equilibrium (HWE) for each locus was detected using Popgene version 1.32 [43] and applying likelihood ratio tests. Nei’s genetic distance [44] between any two accessions was calculated using PowerMarker version 3.25 [45], and the obtained data matrix was further used to construct a neighbor-joining (NJ) clustering tree with MEGA version 7.0 [46]. GenALEx version 6.5 software was also used to perform a principal coordinate analysis (PCoA) using the data matrix generated above. The genetic structure of the 111 accessions was analyzed in STRUCTURE version 2.3.4 [47] via an admixed model with a burn-in period of 10,000 followed by 100,000 Markov chain Monte Carlo iterations. The number of presumed subpopulations (K) ranged from 1 to 10, and 3 independent runs were conducted for each K value. The optimal K value was determined using the delta K (ΔK) method proposed by Evanno et al. [48] with the help of the online program Structure Harvester [49] (https://alumni.soe.ucsc.edu/~dearl/software/structureHarvester/, accessed on 5 January 2024).

2.4. Establishment of SSR Fingerprints

The core marker set for constructing SSR fingerprints was selected based on the following criteria: (1) the amplified products were unambiguous, and the results presented stability and reproducibility; (2) the marker exhibited high levels of polymorphism and discriminatory power; and (3) a unique fingerprint was built for each accession with the minimum number of markers. The sizes of the amplified fragments for these core markers, together with the name, type, and geographical source of the accession, were organized into an Excel file to ultimately create a fingerprint map.

2.5. Construction and Evaluation of the Core Collection

To construct a core collection, two sampling strategies, allele maximization (M) and random (R), were implemented in PowerMarker version 3.25 software to determine the optimal sampling method and sample capacity. Thirty-one subsets, including 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 55, 60, 65, 70, 75, and 80 accessions, were developed to compare the allele capture efficiency of both sampling strategies. A total of 1000 independent runs were generated for each sampling size, and the accessions with the highest frequency of occurrence per 1000 times were retained. R software version 4.2.0 [50] was used to perform a t-test on six main genetic parameters (Na, Ne, Ho, He, I, and PIC) of the core collection and the entire collection. The comparison of allele frequencies was conducted using Microsoft Excel 2019. Furthermore, PCoA was performed to verify the distribution of accessions between the core and raw groups.

3. Results

3.1. Screening of Polymorphic Primers and Their Cross-Species Transferability

A total of 100 EST-SSR primer pairs were selected and synthesized for primary screening across eight L. formosana accessions from different geographical sources. Among them, 18 primer pairs failed to amplify any bands using 2% agarose gel electrophoresis. The remaining 82 primer pairs were further detected using fluorescent capillary electrophoresis. After the primer pairs that presented nonspecific amplification, low amplification efficiency, and monomorphism were filtered out, 38 pairs of polymorphic primers were retained (Table 1). Eventually, a subset of 24 polymorphic EST-SSR primers with clear amplification patterns and good reproducibility was chosen for subsequent genetic analysis.
The 24 EST-SSR primers developed from L. formosana were examined in 10 related species of Altingiaceae and Hamamelidaceae. The results of cross-species amplification of these primer pairs are summarized in Table S2. The cross-species transferability rate varied from 8.33% for C. multiflora and E. tonkinensis to 100% for A. chinensis and S. cathayensis. Among the 24 pairs of primers, LF-eSSR5, LF-eSSR12, and LF-eSSR38 were successfully amplified in 2 out of 10 species, whereas LF-eSSR55 was amplified in all species. Overall, 20 (83.33%) primer pairs could be amplified in five or more species within the families Altingiaceae and Hamamelidaceae, demonstrating a relatively high level of cross-species transferability.

3.2. Genetic Diversity of L. formosana Accessions

In total, 203 alleles were detected at the 24 EST-SSR loci in 111 L. formosana accessions (Table 2). The number of observed alleles (Na) varied from 4 (LF-eSSR24, LF-eSSR94, and LF-eSSR95) to 14 (LF-eSSR80), with an average of 8.458. The number of effective alleles (Ne) ranged from 1.227 (LF-eSSR94) to 6.306 (LF-eSSR72), with an average of 3.120. The Shannon’s information index (I) varied between 0.407 (LF-eSSR94) and 2.050 (LF-eSSR80), with an average of 1.336. As a key genetic diversity indicator, the polymorphism information content (PIC) ranged from 0.176 (LF-eSSR94) to 0.822 (LF-eSSR72), with a mean of 0.579. These results indicated that the tested L. formosana materials had a high level of genetic diversity. The average values of the observed and expected heterozygosities (Ho, He) were 0.547 and 0.613, respectively. Ho was lower than He at 22 SSR loci, except for LF-eSSR12 and LF-eSSR39, in accordance with the mean fixation index (F = 0.111, Table 2). Of the 24 loci, five loci showed significant departures from HWE after likelihood ratio tests (p < 0.01), mainly due to a deficit of heterozygotes.

3.3. Genetic Structure of L. formosana Accessions

The genetic distances among the 111 L. formosana accessions were calculated on the basis of genotyping data from 24 EST-SSR loci, and the resulting genetic distance matrix is illustrated in Figure S3. Nei’s genetic distances varied from 0.066 (‘KX8-SA’ and ‘KX9-SA’) to 0.834 (‘BWL7-R’ and ‘SangZ24-SA’), with an average value of 0.481, indicating the diverse genetic backgrounds of the tested materials. To elucidate the genetic relationships among these accessions, a clustering tree was constructed using the NJ method (Figure 1a). The clustering tree distinctly distinguished all the accessions and confirmed the uniqueness of each accession collected in this study. The 111 accessions were divided into two major clusters. Cluster I contained only 11 accessions of the ’shikimic acid-rich’ type from the SangZ provenance. The remaining 100 accessions from different provenances, covering all three types, were assigned to cluster II, and the accessions were not clustered together according to their provenances. This finding suggests widespread introgression among accessions from these provenances. A two-dimensional scatterplot was generated to intuitively demonstrate the dispersion of the 111 accessions via PCoA (Figure 1b). Coordinates 1 and 2 explained 29.52% and 17.14% of the total variation, respectively. The 111 accessions were classified into two groups, which was consistent with the findings of the clustering analysis. Population structure analysis revealed that a sharp peak in ΔK appeared at K = 2 (Figure 1c), indicating the presence of two primary subpopulations for the 111 accessions (Figure 1d). The accessions from the SangZ provenance belonged to subpopulation 1 (blue), whereas all the accessions from the other provenances belonged to subpopulation 2 (red), as also observed in the clustering tree and PCoA scatterplot.

3.4. Selection of Core Markers and Establishment of SSR Fingerprints

To select a set of core markers suitable for fingerprinting the 111 L. formosana accessions, PI and PIsibs, two crucial parameters for assessing the fingerprint identification ability of molecular markers were calculated for 24 SSR loci (Table 2). The PI value of each locus ranged from 0.044 (LF-eSSR72) to 0.673 (LF-eSSR94), with an average of 0.214. Assuming that all marker loci were independently segregated, the probability of two random accessions possessing identical genotypes at the 24 loci was estimated as 1.475 × 10−19. PIsibs, which was defined as the upper limit of the PI [51], varied from 0.340 (LF-eSSR72) to 0.826 (LF-eSSR94), with a mean of 0.497. The PIsibs value for 24 marker combinations was 2.561 × 10−8. These results demonstrated that the SSR markers reported here have strong fingerprinting power.
When four SSR markers were combined, the PI value was close to 0, and 111 L. formosana accessions could be identified independently (Figure 2). According to the genotyping data and the criteria for core marker selection, four SSR markers were selected to form a core set of markers. LF-eSSR72 was chosen first because it presented the highest PIC value and lowest PI value, and 12 accessions were separated from all other accessions. When the second marker (LF-eSSR80) was added, 84 accessions were identified, accounting for 75.68% of all the accessions. When the third marker (LF-eSSR4) was added, 109 of the 111 accessions were identified, accounting for 98.20%. Finally, LF-eSSR97 was added as the fourth marker to uniquely distinguish the pair of accessions with the smallest genetic distance, namely, ‘KX8-SA’ and ‘KX9-SA’. The SSR fingerprints of the 111 L. formosana accessions were established using four determined core markers, and the name, type, and geographical source of each accession are presented in Table S1.

3.5. Construction and Quality Evaluation of the Core Collection

To determine the appropriate sampling method and optimal size of the core collection, 31 different subsets from the whole collection were extracted to compare allele capture efficiency using the M and R strategies. As shown in Figure 3, the number of alleles captured using the M strategy was always greater than that captured by the R strategy at the same sample capacity. Therefore, the M strategy was chosen to build the core collection. When the sample size reached 34, the number of retained alleles was 198, thus capturing 97.54% (198/203) of the total alleles. Ultimately, a core collection of 34 accessions (15, 17, and 2 from the types of ‘shikimic acid-rich’, ‘red-leaf’, and ‘yellow-leaf’, respectively) was constructed using the M strategy, accounting for 30.63% of the analyzed accessions. Information on the core collection is supplied in Table S1.
No significant differences (p > 0.05) in six main genetic parameters (Na, Ne, Ho, He, I, and PIC) were observed between the core and raw collections, as indicated by t-tests for the equality of means (Figure 4). Except for Na, the other five parameters calculated for the core collection were greater than those of the entire collection. The frequencies of alleles in the core collection and the 111 accessions were highly correlated (R2 = 0.961, p < 0.001) (Figure 5a). In addition, the PCoA scatterplot revealed that the distribution of accessions in the core collection was consistent with that of the original accessions (Figure 5b). These results confirmed the sufficient representativeness of the core collection for the whole collection of 111 accessions.

4. Discussion

4.1. Screening of SSR Markers Obtained from Transcriptome Data

Microsatellites, or SSRs, as popular molecular markers, are widely used in genetic analysis and breeding research due to their many prominent genetic properties [12]. The development of SSR markers using transcriptome data is one of the currently recognized effective approaches and has been performed across a wide spectrum of tree species, such as Corylus avellana L. [52], Larix principis-rupprechtii Mayr [36], Dalbergia odorifera T. Chen [53], Sorbus pohuashanensis (Hance) Hedl. [54], and Juglans mandshurica Maxim. [55]. To alleviate the severe shortage of SSR markers in L. formosana, 100 primer pairs initially designed based on transcriptome information were screened, and 38 of them were scored as polymorphic. Na and PIC are extremely important for evaluating marker polymorphisms [56]. For PIC, the following classifications are commonly adopted: a PIC value ranging from 0 to 0.25 indicates a low degree of polymorphism for markers; a PIC value between 0.25 and 0.50 indicates a moderate level of polymorphism; and a PIC value greater than 0.50 signifies a high level of polymorphism [57]. In our study, the mean values of these two indices (Na = 8.458; PIC = 0.579) across 111 accessions of L. formosana at 24 loci were comparable to or greater than those reported by Chen et al. [38] (Na = 5.750; PIC = 0.578) and Sun et al. [2] (Na = 6.091; PIC = 0.390), indicating a high degree of polymorphism among these markers overall. Specifically, of the 24 newly screened SSR markers, 17 (70.83%) were highly polymorphic, 5 (20.83%) were moderately polymorphic, and 2 (8.33%) were poorly polymorphic.
The transferability of markers is often considered a cost-effective method to provide genetic markers for species with limited genomic resources [58]. To increase marker utilization, the transferability of the 24 EST-SSR markers developed from L. formosana was evaluated using 10 related species within the Altingiaceae and Hamamelidaceae families, which greatly expanded the taxonomic range of the tested species compared with a previous report that examined marker transferability only in the genus Liquidambar [38]. The relatively high cross-species transferability of these markers further corroborated the high conservation of the EST-SSR markers identified from expressed regions. Therefore, our findings provide a new set of molecular markers for genetic diversity investigations, resource identification, core collection extraction, genetic map construction, parentage analysis, and marker-assisted breeding of L. formosana and other related species in the future.

4.2. Genetic Diversity and Structure of L. formosana Accessions

Germplasm resources, especially excellent accessions, lay a material foundation for genetic improvement, germplasm innovation, and variety breeding of forest trees [29]. A few years ago, 111 L. formosana accessions from different provenances were selected, grafted, and planted at three locations. Multiple-site trials and abundant variation in the 111 L. formosana accessions provide potential opportunities for the development of new varieties of L. formosana. Genetic diversity and structural information are essential for the conservation and sustainable utilization of genetic resources [23]. In this study, the genetic diversity of this group of accessions was comparable to that of a plus tree population (He = 0.621; PIC = 0.578) [38] but significantly greater than that of 25 natural populations (He = 0.432; PIC = 0.390) [2]. This high genetic diversity may be partially attributed to the considerable genetic variation among L. formosana accessions derived from multiple geographical provenances and the high degree of polymorphism of the newly screened EST-SSR markers. Moreover, the selection effect may be a key influencing factor to be considered [38]. The 111 accessions utilized were rigorously selected from a provenance–family trial based on their phenotypic traits; owing to heterosis, this selection process appears to be beneficial for increasing the heterozygosity of accessions. Similar explanations have also been presented for Pinus tabulaeformis Carr. [59] and L. principis-rupprechtii [36].
Nei’s genetic distance is a critical parameter for assessing the genetic relationship between two individuals or groups [55]. The lowest genetic distance of 0.066 was recorded between accessions ‘KX8-SA’ and ‘KX9-SA’, both of which were derived from the same provenance, indicating a close genetic relationship. Conversely, the greatest genetic distance of 0.834 was found between accessions ‘BWL7-R’ and ‘SangZ24-SA’, demonstrating that these two accessions from distinct provenances and types exhibited significant genetic differences and were well suited as hybrid parents for breeding research. The discovery of a deficiency in genetic exchange between the SangZ provenance and other provenances, as evidenced by the clustering tree, PCoA, and genetic structure analysis, corroborated the findings of Sun et al. [2], who noted that the SZHN (referred to as SangZ in this study) population was clearly separated from the other 24 natural populations in the cluster dendrogram. SangZ is situated at the northern foot of the Wuling Mountains. The complex topography and diverse climatic conditions in this region are likely to have played a significant role in shaping the genetic distinctiveness of accessions. Eleven accessions from the SangZ provenance were of the ‘shikimic acid-rich’ type. Their unique genetic attributes and phenotypic characteristics will contribute to elucidating the mechanisms underlying shikimic acid accumulation and facilitate the development of new varieties rich in shikimic acid, thereby promoting exploitation and utilization of L. formosana germplasm resources.

4.3. Construction and Application of SSR Fingerprints

DNA fingerprinting is a molecular-level technique employed to identify diverse genetic resources accurately, relying on unique alleles and genotypes generated by molecular markers to minimize the influence of environmental factors and biological developmental stages [56]. It has been extensively utilized in crops, ornamental plants, and forest trees, facilitating the management of germplasm resources, protection of variety rights, and plant breeding [18,60,61]. Waits et al. [51] argued that the theoretical value of PI may be overestimated; thus, PIsibs is designated as an upper limit for PI. In addition, when the PI value falls within the range of 1 × 10−4 to 1 × 10−2, it is considered adequate for the identification of individuals within natural populations. The PI and PIsibs values reported herein were markedly lower than the putative values, suggesting that the 24 SSR markers possess a strong ability for fingerprint identification. Four core SSR markers were chosen and utilized to construct DNA fingerprints for 111 accessions of L. formosana. These fingerprints will contribute to germplasm resource management, evaluation, and genetic improvement in L. formosana.
However, it is important to emphasize that considerable room remains for refining the current fingerprinting map by enhancing the accuracy and efficiency of accession identification. As the number of L. formosana accessions continues to increase, increasing the quantity of SSR markers with increased discriminative ability and polymorphism may be necessary. Simultaneously, SSR multiplex systems can be developed and employed for the amplification and genotyping of large-scale samples to reduce costs and improve detection efficiency. The integration of multiple marker types represents an effective method to increase identification efficiency [62]. Consequently, single nucleotide polymorphism (SNP) markers should be mined and used in conjunction with SSR markers for fingerprinting purposes.

4.4. Extraction of a Core Collection

A core collection is a subset of germplasm resources that optimally represents the genetic diversity of the original collection while minimizing redundancy. Core collections play a crucial role in the protection, management, and efficient utilization of genetic resources [63]. The sampling method and size are critical determinants in the extraction of a core collection, as these factors significantly affect the quality of the resulting collection [20]. In the present study, a comparison of allele capture efficiency favored the M strategy as the preferred approach for establishing the core collection of L. formosana, and similar findings were also reported in Ziziphus jujuba Mill. [64] and Cunninghamia lanceolata (Lamb.) Hook. [65]. In general, the R strategy may miss specific accessions that harbor rare alleles, leading to insufficient representation of genetic diversity within the original population; conversely, the M strategy is capable of capturing nearly all alleles from the entire collection, including rare ones, thus ensuring a high level of genetic representativeness [30]. Compared with other tree species, the sampling ratio in L. formosana was greater than that of Quercus suber L. (7.5%) [66], Ficus carica L. (13.1%) [67], C. sativa (13.7%) [27], C. avellana (16.6%) [63], and Ceratonia siliqua L. (19.1%) [68]. Moreover, the sampling ratio was comparable to that of C. mollissima (30.8%) [16], P. tabuliformis (31.2%) [30], and Robinia pseudoacacia L. (32.1%) [21] but lower than that of C. lanceolata (42.9%) [65] and Castanopsis hystrix Hook. f. & Thomson ex A. DC. (67.7%) [69]. Differences in sampling ratios may arise from several factors, including discrepancies in species composition, original population size, levels of genetic diversity, population structure, sampling strategies, and intended application objectives [28]. The established core collection is valuable for the conservation of genetic resources and the efficient breeding of L. formosana.
This study represents the first attempt to construct a core collection of L. formosana using SSR markers. However, the core collection extracted from limited original accessions that utilize exclusively molecular marker data is likely to encounter certain limitations in its application. The construction of a core collection should be regarded as a dynamic process [64]. In the near future, a multitude of new genetic resources of L. formosana are anticipated to be incorporated, and different sampling strategies will be employed to enhance the core collection through the combination of molecular marker and phenotypic data. The revised core collection can subsequently be used for association mapping, ultimately elucidating the genetic basis of key breeding traits in L. formosana.

5. Conclusions

This study aimed to evaluate the polymorphism and cross-species transferability of a new set of EST-SSR markers, as well as their utility in assessing the genetic diversity and structure of 111 accessions of L. formosana. Additionally, DNA fingerprints for these accessions and a core collection were established. The results indicated that 24 EST-SSR markers presented a high level of polymorphism among the 111 accessions and exhibited a relatively high transferability rate across 10 related species within the Altingiaceae and Hamamelidaceae families. The 111 accessions displayed abundant genetic diversity and were classified into two distinct groups. The DNA fingerprints of the 111 accessions were successfully constructed using four core SSR markers. A core collection of 34 accessions was extracted, representing 30.63% of the original collection. These findings provide valuable information for the identification, conservation, management and effective utilization of L. formosana germplasm resources.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/f16020281/s1, Table S1: DNA fingerprints of 111 accessions of L. formosana based on four core SSR markers; Table S2: Evaluation of the transferability of 24 newly developed EST-SSR markers in related Altingiaceae and Hamamelidaceae species; Figure S1: Differences in growth traits and leaf color parameters among the three types of superior accessions of Liquidambar formosana. (a) Tree height; (b) Diameter at breast height; (c) Height to crown base; (d) Color parameter L*; (e) Color parameter a*; (f) Color parameter b*. All phenotypic data used in this analysis were sourced from the dataset provided by Dong et al. [9]. ns not significant; * p < 0.05; ** p < 0.01; *** p < 0.001; Figure S2: Geographical distribution of 21 L. formosana provenances. The location of each provenance is indicated by a red triangle, and the black lines represent administrative divisions among different provinces in China; Figure S3: Nei’s genetic distance matrix heatmap of 111 accessions of L. formosana. The relationship between numerical identifiers and accession names is provided in Table S1.

Author Contributions

Conceptualization, J.Y. and Y.C.; methodology, J.Y. and M.D.; software, M.D. and N.Y.; validation, R.L., D.H. and Z.Y.; formal analysis, N.Y., R.L. and D.H.; investigation, R.L. and D.H.; resources, J.Y.; data curation, M.D.; writing—original draft preparation, M.D.; writing—review and editing, M.D., N.Y., R.L., D.H. and Z.Y.; visualization, M.D., N.Y. and R.L.; supervision, J.Y. and Y.C.; project administration, J.Y. and Y.C.; funding acquisition, J.Y. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by the National Nonprofit Institute Research Grant of Chinese Academy of Forestry, China (CAFYBB2022SY015), the Forestry Science and Technology Innovation Project of Guangdong, China (2021KJCX018) and the Social Development Project of Guangzhou Municipal Science and Technology Bureau (202206010058).

Data Availability Statement

Data are contained within the article and Supplementary Materials.

Acknowledgments

We are grateful to the South China Botanical Garden and Dongjiang Forest Farm for their assistance in collecting samples.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Li, Y.; Qi, S.; Chen, S.; Li, H.; Zhang, T.; Bao, F.; Zhan, D.; Pang, Z.; Zhang, J.; Zhao, J. Genome-wide identification and expression analysis of late embryogenesis abundant (LEA) genes reveal their potential roles in somatic embryogenesis in hybrid sweetgum (Liquidambar styraciflua × Liquidambar formosana). For. Res. 2023, 3, 12. [Google Scholar] [CrossRef] [PubMed]
  2. Sun, R.; Lin, F.; Huang, P.; Zheng, Y. Moderate genetic diversity and genetic differentiation in the relict tree Liquidambar formosana Hance revealed by genic simple sequence repeat markers. Front. Plant Sci. 2016, 7, 1411. [Google Scholar] [CrossRef] [PubMed]
  3. Candeias, N.R.; Assoah, B.; Simeonov, S.P. Production and synthetic modifications of shikimic acid. Chem. Rev. 2018, 118, 10458–10550. [Google Scholar] [CrossRef] [PubMed]
  4. Hu, W.; Pang, H.; Hu, X.; Wang, X.; Zheng, Y. Genetic variation, excellent family and individual selection of 9-year-old Liquidambar formosana. J. Trop. Subtrop. Bot. 2018, 26, 506–514. [Google Scholar]
  5. Hu, W.; Pang, H.; Hu, X.; Wang, X.; Lin, F. Variation and selection of Liquidambar formosana based on a nine-year-old provenance test. J. Cent. South Univ. For. Technol. 2019, 39, 40–46. [Google Scholar]
  6. Chen, X. Genetic variation and selection of 14-year-old Liquidambar formosana progeny. Forest Res. 2015, 28, 183–187. [Google Scholar]
  7. Wang, J.; Zhang, B.; Zhang, W. A new variety, Liquidambars formosana ‘Jinjue’. Sci. Silvae Sin. 2015, 51, 154. [Google Scholar]
  8. Zhou, J. Variation Analysis of Leaf Phenotypic Characteristics from Different Provenances and Ornamental Value Assessment of Liquidambar formosana. Master’s Thesis, Anhui Agricultural University, Hefei, China, 2022. [Google Scholar]
  9. Dong, M.; Zhou, L.; Yu, N.; Li, R.; Wu, S.; Yang, J.; Su, J. Genetic parameters and selection responses for important breeding traits in Liquidambar formosana based on a provenance–family trial. Forests 2023, 14, 2293. [Google Scholar] [CrossRef]
  10. Huang, L.; Zeng, Y.; Li, J.; Deng, Y.; Su, G.; Zhang, J. One hundred single-copy nuclear sequence markers for olive variety identification: A case of fingerprinting database construction in China. Mol. Breed. 2023, 43, 86. [Google Scholar] [CrossRef] [PubMed]
  11. Khan, A.S.; Ali, S.; Khan, I.A. Morphological and molecular characterization and evaluation of mango germplasm: An overview. Sci. Hortic. 2015, 194, 353–366. [Google Scholar] [CrossRef]
  12. Varshney, R.K.; Graner, A.; Sorrells, M.E. Genic microsatellite markers in plants: Features and applications. Trends Biotechnol. 2005, 23, 48–55. [Google Scholar] [CrossRef]
  13. UPOV (Union for the Protection of New Varieties of Plants). Guidelines for DNA-Profiling: Molecular Marker Selection and Database Construction (BMT Guidelines); UPOV: Geneva, Switzerland, 2007; pp. 3–4. [Google Scholar]
  14. Wang, L.; Gao, W.; Wang, Q.; Qu, J.; Zhang, J.; Huang, C. Identification of commercial cultivars of Agaricus bisporus in China using genome-wide microsatellite markers. J. Integr. Agr. 2019, 18, 580–589. [Google Scholar] [CrossRef]
  15. Ruiz, D.; García-Gómez, B.E.; Egea, J.; Molina, A.; Martínez-Gómez, P.; Campoy, J.A. Phenotypical characterization and molecular fingerprinting of natural early-flowering mutants in apricot (Prunus armeniaca L.) and Japanese plum (P. salicina Lindl.). Sci. Hortic. 2019, 254, 187–192. [Google Scholar] [CrossRef]
  16. Nie, X.; Wang, Z.; Liu, N.; Song, L.; Yan, B.; Xing, Y.; Zhang, Q.; Fang, K.; Zhao, Y.; Chen, X.; et al. Fingerprinting 146 Chinese chestnut (Castanea mollissima Blume) accessions and selecting a core collection using SSR markers. J. Integr. Agr. 2021, 20, 1277–1286. [Google Scholar] [CrossRef]
  17. Wambulwa, M.C.; Fan, P.Z.; Milne, R.; Wu, Z.Y.; Luo, Y.H.; Wang, Y.H.; Wang, H.; Gao, L.M.; Xiahou, Z.Y.; Jin, Y.C.; et al. Genetic analysis of walnut cultivars from southwest China: Implications for germplasm improvement. Plant Divers. 2022, 44, 530–541. [Google Scholar] [CrossRef]
  18. Yan, P.; Xie, Z.; Feng, K.; Qiu, X.; Zhang, L.; Zhang, H. Genetic diversity analysis and fingerprint construction of Korean pine (Pinus koraiensis) clonal seed orchard. Front. Plant Sci. 2023, 13, 1079571. [Google Scholar] [CrossRef]
  19. Zhou, Q.; Chen, B.; Jiang, D.; Zhuge, F.; Li, Y. Genetic analysis and construction of a fingerprint for licensed Triadica sebifera cultivars using SSR markers. Plants 2024, 13, 1767. [Google Scholar] [CrossRef]
  20. Liu, M.; Hu, X.; Wang, X.; Zhang, J.; Peng, X.; Hu, Z.; Liu, Y. Constructing a core collection of the medicinal plant Angelica biserrata using genetic and metabolic data. Front. Plant Sci. 2020, 11, 600249. [Google Scholar] [CrossRef]
  21. Guo, Q.; Liu, J.; Li, J.; Cao, S.; Zhang, Z.; Zhang, J.; Zhang, Y.; Deng, Y.; Niu, D.; Su, L.; et al. Genetic diversity and core collection extraction of Robinia pseudoacacia L. germplasm resources based on phenotype, physiology, and genotyping markers. Ind. Crop Prod. 2022, 178, 114627. [Google Scholar] [CrossRef]
  22. Balfourier, F.; Roussel, V.; Strelchenko, P.; Exbrayat-Vinson, F.; Sourdille, P.; Boutet, G.; Koenig, J.; Ravel, C.; Mitrofanova, O.; Beckert, M.; et al. A worldwide bread wheat core collection arrayed in a 384-well plate. Theor. Appl. Genet. 2007, 114, 1265–1275. [Google Scholar] [CrossRef] [PubMed]
  23. Xu, Q.; Zeng, X.; Lin, B.; Li, Z.; Yuan, H.; Wang, Y.; Zhasang; Tashi, N. A microsatellite diversity analysis and the development of core-set germplasm in a large hulless barley (Hordeum vulgare L.) collection. BMC Genet. 2017, 18, 102. [Google Scholar] [CrossRef]
  24. Porta, B.; Condón, F.; Franco, J.; Iriarte, W.; Bonnecarrère, V.; Guimaraens-Moreira, M.; Vidal, R.; Galván, G.A. Genetic structure, core collection, and regeneration quality in white dent corn landraces. Crop Sci. 2018, 58, 1644–1658. [Google Scholar] [CrossRef]
  25. Kumar, S.; Kumar, P.; Maddala, S.R.S.C.S.; Rao, S.; Sundaram, R.M.; Krishnan, G.; Singh, A.K.; Singh, K.; LV, S.R.; Rani, S.; et al. Development of coreset of aromatic rice (Oryza sativa L. Indica) based on molecular and morphological diversity. Genet. Resour. Crop Evol. 2021, 68, 441–450. [Google Scholar]
  26. Li, F.; Sayama, T.; Yokota, Y.; Hiraga, S.; Hashiguchi, M.; Tanaka, H.; Akashi, R.; Ishimoto, M. Assessing genetic diversity and geographical differentiation in a global collection of wild soybean (Glycine soja Sieb. et Zucc.) and assigning a mini-core collection. DNA Res. 2024, 31, dsae009. [Google Scholar] [CrossRef]
  27. Pereira-Lorenzo, S.; Ramos-Cabrer, A.M.; Barreneche, T.; Mattioni, C.; Villani, F.; Díaz-Hernández, M.B.; Martín, L.M.; Martín, A. Database of European chestnut cultivars and definition of a core collection using simple sequence repeats. Tree Genet. Genomes 2017, 13, 114. [Google Scholar] [CrossRef]
  28. Lv, J.; Li, C.; Zhou, C.; Chen, J.; Li, F.; Weng, Q.; Li, M.; Wang, Y.; Chen, S.; Chen, J.; et al. Genetic diversity analysis of a breeding population of Eucalyptus cloeziana F. Muell. (Myrtaceae) and extraction of a core germplasm collection using microsatellite markers. Ind. Crop Prod. 2020, 145, 112157. [Google Scholar] [CrossRef]
  29. Tao, L.; Ting, Y.; Chen, H.; Wen, H.; Xie, H.; Luo, L.; Huang, K.; Zhu, J.; Liu, S.; Wei, C. Core collection construction of tea plant germplasm in Anhui Province based on genetic diversity analysis using simple sequence repeat markers. J. Integr. Agr. 2023, 22, 2719–2728. [Google Scholar] [CrossRef]
  30. Yang, B.; Wang, H.; Xia, Q.; El-Kassaby, Y.A.; Li, W. Preserving genetic diversity in Pinus tabuliformis breeding population through core collection development. Tree Genet. Genomes 2023, 19, 57. [Google Scholar] [CrossRef]
  31. Le, L.; Yang, X.; Xie, X.; Zhang, W.; Wang, G.; Cao, F. Construction of the core germplasm of yellowhorn (Xanthoceras sorbifolium Bunge) using physiological traits and SSR markers. Sci. Hortic. 2024, 323, 112556. [Google Scholar] [CrossRef]
  32. Anderson, W.F.; Maas, A.; Ozias-Akins, P. Genetic variability of a forage bermudagrass core collection. Crop Sci. 2009, 49, 1347–1358. [Google Scholar] [CrossRef]
  33. Qiu, L.J.; Xing, L.L.; Guo, Y.; Wang, J.; Jackson, S.A.; Chang, R.Z. A platform for soybean molecular breeding: The utilization of core collections for food security. Plant Mol. Biol. 2013, 83, 41–50. [Google Scholar] [CrossRef] [PubMed]
  34. Hong, J.P.; Ro, N.; Lee, H.Y.; Kim, G.W.; Kwon, J.K.; Yamamoto, E.; Kang, B.C. Genomic selection for prediction of fruit-related traits in pepper (Capsicum spp.). Front. Plant Sci. 2020, 11, 570871. [Google Scholar] [CrossRef]
  35. McLeod, L.; Barchi, L.; Tumino, G.; Tripodi, P.; Salinier, J.; Gros, C.; Boyaci, H.F.; Ozalp, R.; Borovsky, Y.; Schafleitner, R.; et al. Multi-environment association study highlights candidate genes for robust agronomic quantitative trait loci in a novel worldwide Capsicum core collection. Plant J. 2023, 116, 1508–1528. [Google Scholar] [CrossRef]
  36. Dong, M.; Wang, Z.; He, Q.; Zhao, J.; Fan, Z.; Zhang, J. Development of EST-SSR markers in Larix principis-rupprechtii Mayr and evaluation of their polymorphism and cross-species amplification. Trees-Struct. Funct. 2018, 32, 1559–1571. [Google Scholar] [CrossRef]
  37. Kalia, R.K.; Rai, M.K.; Kalia, S.; Singh, R.; Dhawan, A.K. Microsatellite markers: An overview of the recent progress in plants. Euphytica 2011, 177, 309–334. [Google Scholar] [CrossRef]
  38. Chen, S.; Dong, M.; Zhang, Y.; Qi, S.; Liu, X.; Zhang, J.; Zhao, J. Development and characterization of simple sequence repeat markers for, and genetic diversity analysis of Liquidambar formosana. Forests 2020, 11, 203. [Google Scholar] [CrossRef]
  39. Glaubitz, J.C. CONVERT: A user-friendly program to reformat diploid genotypic data for commonly used population genetic software packages. Mol. Ecol. Notes 2004, 4, 309–310. [Google Scholar] [CrossRef]
  40. Peakall, R.; Smouse, P.E. GENALEX 6: Genetic analysis in Excel. Population genetic software for teaching and research. Mol. Ecol. Notes 2006, 6, 288–295. [Google Scholar] [CrossRef]
  41. Peakall, R.; Smouse, P.E. GenAlEx 6.5: Genetic analysis in Excel. Population genetic software for teaching and research—An update. Bioinformatics 2012, 28, 2537–2539. [Google Scholar] [CrossRef]
  42. Kalinowski, S.T.; Taper, M.L.; Marshall, T.C. Revising how the computer program cervus accommodates genotyping error increases success in paternity assignment. Mol. Ecol. 2007, 16, 1099–1106. [Google Scholar] [CrossRef] [PubMed]
  43. Yeh, F.C.; Boyle, T.J.B. Population genetic analysis of codominant and dominant markers and quantitative traits. Belg. J. Bot. 1997, 129, 157. [Google Scholar]
  44. Nei, M.; Tajima, F.; Tateno, Y. Accuracy of estimated phylogenetic trees from molecular data II. Gene frequency data. J. Mol. Evol. 1983, 19, 153–170. [Google Scholar] [CrossRef] [PubMed]
  45. Liu, K.; Muse, S.V. PowerMarker: An integrated analysis environment for genetic marker analysis. Bioinformatics 2005, 21, 2128–2129. [Google Scholar] [CrossRef] [PubMed]
  46. Kumar, S.; Stecher, G.; Tamura, K. MEGA7: Molecular evolutionary genetics analysis version 7.0 for bigger datasets. Mol. Biol. Evol. 2016, 33, 1870–1874. [Google Scholar] [CrossRef] [PubMed]
  47. Pritchard, J.K.; Stephens, M.; Donnelly, P. Inference of population structure using multilocus genotype data. Genetics 2000, 155, 945–959. [Google Scholar] [CrossRef] [PubMed]
  48. Evanno, G.; Regnaut, S.; Goudet, J. Detecting the number of clusters of individuals using the software STRUCTURE: A simulation study. Mol. Ecol. 2005, 14, 2611–2620. [Google Scholar] [CrossRef] [PubMed]
  49. Earl, D.A.; Vonholdt, B.M. STRUCTURE HARVESTER: A website and program for visualizing STRUCTURE output and implementing the Evanno method. Conserv. Genet. Resour. 2012, 4, 359–361. [Google Scholar] [CrossRef]
  50. R Core Team. R: A Language and Environment for Statistical Computing; R Foundation for Statistical Computing: Vienna, Austria, 2022. [Google Scholar]
  51. Waits, L.P.; Luikart, G.; Taberlet, P. Estimating the probability of identity among genotypes in natural populations: Cautions and guidelines. Mol. Ecol. 2001, 10, 249–256. [Google Scholar] [CrossRef]
  52. Colburn, B.C.; Mehlenbacher, S.A.; Sathuvalli, V.R. Development and mapping of microsatellite markers from transcriptome sequences of European hazelnut (Corylus avellana L.) and use for germplasm characterization. Mol. Breed. 2017, 37, 16. [Google Scholar] [CrossRef]
  53. Liu, F.M.; Hong, Z.; Yang, Z.J.; Zhang, N.N.; Liu, X.J.; Xu, D.P. De novo transcriptome analysis of Dalbergia odorifera T. Chen (Fabaceae) and transferability of SSR markers developed from the transcriptome. Forests 2019, 10, 98. [Google Scholar] [CrossRef]
  54. Wu, Y.; He, R.; Lu, Y.; Zhang, Z.; Yang, L.; Guan, X.; Zhang, R.; Zheng, J. Development and evaluation of EST-SSR markers in Sorbus pohuashanensis (Hance) Hedl. and their application to other Sorbus species. Trees-Struct. Funct. 2020, 34, 455–467. [Google Scholar] [CrossRef]
  55. Zhang, Q.; Zhang, X.; Yang, Y.; Xu, L.; Feng, J.; Wang, J.; Tang, Y.; Pei, X.; Zhao, X. Genetic diversity of Juglans mandshurica populations in Northeast China based on SSR markers. Front. Plant Sci. 2022, 13, 931578. [Google Scholar] [CrossRef] [PubMed]
  56. Zhang, X.; Chen, W.; Yang, Z.; Luo, C.; Zhang, W.; Xu, F.; Ye, J.; Liao, Y. Genetic diversity analysis and DNA fingerprint construction of Zanthoxylum species based on SSR and iPBS markers. BMC Plant Biol. 2024, 24, 843. [Google Scholar] [CrossRef] [PubMed]
  57. Botstein, D.; White, R.L.; Skolnick, M.; Davis, R.W. Construction of a genetic linkage map in man using restriction fragment length polymorphisms. Am. J. Hum. Genet. 1980, 32, 314–331. [Google Scholar]
  58. Ellis, J.R.; Burke, J.M. EST-SSRs as a resource for population genetic analyses. Heredity 2007, 99, 125–132. [Google Scholar] [CrossRef] [PubMed]
  59. Li, Y.; Zhang, C. Genetic diversity within a breeding system of Pinus tabulaeformis. J. Beijing For. Univ. 2000, 22, 12–19. [Google Scholar]
  60. Zhang, J.J.; Shu, Q.Y.; Liu, Z.A.; Ren, H.X.; Wang, L.S.; De Keyser, E. Two EST-derived marker systems for cultivar identification in tree peony. Plant Cell Rep. 2012, 31, 299–310. [Google Scholar] [CrossRef]
  61. Kaur, S.; Panesar, P.S.; Bera, M.B.; Kaur, V. Simple sequence repeat markers in genetic divergence and marker-assisted selection of rice cultivars: A review. Crit. Rev. Food Sci. 2015, 55, 41–49. [Google Scholar] [CrossRef] [PubMed]
  62. Gramazio, P.; Prohens, J.; Borràs, D.; Plazas, M.; Herraiz, F.J.; Vilanova, S. Comparison of transcriptome-derived simple sequence repeat (SSR) and single nucleotide polymorphism (SNP) markers for genetic fingerprinting, diversity evaluation, and establishment of relationships in eggplants. Euphytica 2017, 213, 264. [Google Scholar] [CrossRef]
  63. Boccacci, P.; Aramini, M.; Ordidge, M.; van Hintum, T.J.L.; Marinoni, D.T.; Valentini, N.; Sarraquigne, J.P.; Solar, A.; Rovira, M.; Bacchetta, L.; et al. Comparison of selection methods for the establishment of a core collection using SSR markers for hazelnut (Corylus avellana L.) accessions from European germplasm repositories. Tree Genet. Genomes 2021, 17, 48. [Google Scholar] [CrossRef]
  64. Xu, C.; Gao, J.; Du, Z.; Li, D.; Wang, Z.; Li, Y.; Pang, X. Identifying the genetic diversity, genetic structure and a core collection of Ziziphus jujuba Mill. var. jujuba accessions using microsatellite markers. Sci. Rep. 2016, 6, 31503. [Google Scholar] [CrossRef] [PubMed]
  65. Duan, H.; Cao, S.; Zheng, H.; Hu, D.; Lin, J.; Cui, B.; Lin, H.; Hu, R.; Wu, B.; Sun, Y.; et al. Genetic characterization of Chinese fir from six provinces in southern China and construction of a core collection. Sci. Rep. 2017, 7, 13814. [Google Scholar] [CrossRef] [PubMed]
  66. Assemar, F.E.; Alami, M.; Rabeh, K.; Medraoui, L.; El Antri, S.; Filali-Maltouf, A.; Belkadi, B. Genetic diversity and population structure in Quercus suber L. revealed by nuclear microsatellite markers and generation of a core collection. Tree Genet. Genomes 2024, 20, 5. [Google Scholar] [CrossRef]
  67. Balas, F.C.; Osuna, M.D.; Domínguez, G.; Pérez-Gragera, F.; López-Corrales, M. Ex situ conservation of underutilised fruit tree species: Establishment of a core collection for Ficus carica L. using microsatellite markers (SSRs). Tree Genet. Genomes 2014, 10, 703–710. [Google Scholar] [CrossRef]
  68. Di Guardo, M.; Scollo, F.; Ninot, A.; Rovira, M.; Hermoso, J.F.; Distefano, G.; La Malfa, S.; Batlle, I. Genetic structure analysis and selection of a core collection for carob tree germplasm conservation and management. Tree Genet. Genomes 2019, 15, 41. [Google Scholar] [CrossRef]
  69. Li, N.; Yang, Y.; Xu, F.; Chen, X.; Wei, R.; Li, Z.; Pan, W.; Zhang, W. Genetic diversity and population structure analysis of Castanopsis hystrix and construction of a core collection using phenotypic traits and molecular markers. Genes 2022, 13, 2383. [Google Scholar] [CrossRef] [PubMed]
Figure 1. Genetic structure of 111 accessions of Liquidambar formosana. (a) NJ cluster analysis. The 111 accessions were divided into two major clusters (I–II), which are depicted as blue triangles and red squares; (b) Principal coordinate analysis (PCoA). The percentages of total variation explained by the first two coordinates are 29.52% and 17.14%, respectively. The two groups correspond to those of the clusters derived from clustering analysis, represented by identical colors and symbols; (c) Graphical representation of the relationship between K and ΔK. The ΔK value is at its maximum when K = 2; (d) Population structure diagram generated using STRUCTURE v2.3.4 software (K = 2). The two subpopulations, indicated by blue for subpopulation 1 and red for subpopulation 2, are consistent with those inferred from PCoA and cluster analysis.
Figure 1. Genetic structure of 111 accessions of Liquidambar formosana. (a) NJ cluster analysis. The 111 accessions were divided into two major clusters (I–II), which are depicted as blue triangles and red squares; (b) Principal coordinate analysis (PCoA). The percentages of total variation explained by the first two coordinates are 29.52% and 17.14%, respectively. The two groups correspond to those of the clusters derived from clustering analysis, represented by identical colors and symbols; (c) Graphical representation of the relationship between K and ΔK. The ΔK value is at its maximum when K = 2; (d) Population structure diagram generated using STRUCTURE v2.3.4 software (K = 2). The two subpopulations, indicated by blue for subpopulation 1 and red for subpopulation 2, are consistent with those inferred from PCoA and cluster analysis.
Forests 16 00281 g001
Figure 2. Evaluation of the fingerprinting power of 24 EST-SSR markers in Liquidambar formosana accessions.
Figure 2. Evaluation of the fingerprinting power of 24 EST-SSR markers in Liquidambar formosana accessions.
Forests 16 00281 g002
Figure 3. Relationships between sample size and the number of alleles under the M and R strategies implemented in PowerMarker v3.25.
Figure 3. Relationships between sample size and the number of alleles under the M and R strategies implemented in PowerMarker v3.25.
Forests 16 00281 g003
Figure 4. T-test results for genetic diversity parameters of the core and raw collections of Liquidambar formosana. Na, number of observed alleles; Ne, number of effective alleles; PIC, polymorphism information content; Ho, observed heterozygosity; He, expected heterozygosity; I, Shannon’s information index.
Figure 4. T-test results for genetic diversity parameters of the core and raw collections of Liquidambar formosana. Na, number of observed alleles; Ne, number of effective alleles; PIC, polymorphism information content; Ho, observed heterozygosity; He, expected heterozygosity; I, Shannon’s information index.
Forests 16 00281 g004
Figure 5. Assessment of the quality of the core collection of Liquidambar formosana. (a) Linear relationship between allele frequencies in the core collection and those in the original 111 accessions; (b) PCoA scatterplot of the core and raw collections.
Figure 5. Assessment of the quality of the core collection of Liquidambar formosana. (a) Linear relationship between allele frequencies in the core collection and those in the original 111 accessions; (b) PCoA scatterplot of the core and raw collections.
Forests 16 00281 g005
Table 1. Information on the 38 polymorphic EST-SSR markers developed for Liquidambar formosana.
Table 1. Information on the 38 polymorphic EST-SSR markers developed for Liquidambar formosana.
CodeLocusPrimer Sequence (5′-3′)Repeat MotifProduct Size (bp)Tm (°C)
1LF-eSSR4 *CCACAAGTCCACGAGACAGA
GGGGGAGGAGATTAATGAGC
(AGC)914059.9
2LF-eSSR5 *GTGGCGCTAGGATTTCTGAG
CTTCCGCTCTCTCAAACCAC
(CCT)718560.0
3LF-eSSR12 *TTCAAATCATCCTGGGAAGC
GGAGGTGGCTGATCGATTTA
(TCT)717260.0
4LF-eSSR17CGTCTTGGCTGGCTTCTATC
ATCCCATCAAAACCCATCAA
(CTT)727760.0
5LF-eSSR18 *TTTGTTTTCATGGGACGACA
AGGGTCTCATTATGCCAACG
(CCA)624659.9
6LF-eSSR24 *CCCATCACCAAAAATCTGCT
GTCTTCTCTCAATCTGCCCG
(AAG)614459.9
7LF-eSSR25 *CCTGACCTAGGGTTTCCCTC
TATATCGCCCACTGGTAGCC
(CAA)927559.9
8LF-eSSR29 *GAACCAGATAGCGAGACCCA
CTCGTCCTGCAGCACTTGTA
(AGA)727960.2
9LF-eSSR30CCACTCTCTTCCTCGCATTC
TGCCCACAACCTAAGAAACC
(ACT)626860.0
10LF-eSSR33ACTCCTTGGGGAGTTGGACT
CCCTGCTGAAATACCACGTT
(GAT)925860.0
11LF-eSSR35 *GGTCGTTTCATTGTTTGGCT
ATGAGCCTCGAACTCCTTCA
(GCT)715260.0
12LF-eSSR38 *CCTTTGTCCCCCTCTCTTTC
GAGCAAGGTGGGTTTGTTGT
(AAC)723760.0
13LF-eSSR39 *TAAACTCCTCACCGTCGTCC
GATCTCATCACCCACATCCC
(CCA)723560.1
14LF-eSSR41CGTCCAACACAGAACCCTTT
ATTAAAGTTGCCGGACATGC
(CAC)713760.0
15LF-eSSR49 *GGAGCGTGTTCCAGAGAAAG
GGTTTGTAGTGGCGGTGAGT
(AGC)716460.0
16LF-eSSR50 *CATGGCACCTTCATCATTTG
CCCTTTTGCATGAAGTGGTT
(GCA)713859.9
17LF-eSSR52CTCTTCTGGGTGCTTGAAGG
CCAAGGCCTGGAATGTAAAA
(AGG)916460.0
18LF-eSSR55 *CCGATCTTCCTCCTGACAAA
CTCATAAGGCCTGTGACCGT
(CGC)621960.2
19LF-eSSR56AAGAGAAGGGTGGTGAGGGT
GTAGGCACTGCAAAAGGCTC
(GGA)719360.0
20LF-eSSR59 *ATTGTCACCCCGCTATTCTG
GGAGATGGGACACTGAAGGA
(CAG)719560.0
21LF-eSSR63ACGCCAAACCAAGAAACAAC
CTTTCCATCTTTGCATCGGT
(AGA)620060.0
22LF-eSSR67CTCTCCATCGTCCACCAACT
GATTCTCCCGTCGACAAAAA
(CTT)627660.1
23LF-eSSR70 *ATGCTGAATTGGAAAGTGGG
TTTGAAGAAACTTGCGGCTT
(ACC)826460.0
24LF-eSSR71GAGCGCAGTAAAAAGTTGCC
TTTCCCAGATGAACGACACA
(ACA)626660.1
25LF-eSSR72 *TTTGCCCTTTTAGCTCCTCA
ACATGGAGCAGTGGCTCTCT
(CAG)927060.0
26LF-eSSR76CCTTCCCACCAAAAGTTCAA
TGCCTCTCTGGTTGCCTACT
(GAA)826860.0
27LF-eSSR78GGCCTCCTCCTAAGACCATC
AGACCCAAGAACCACATTCG
(CAC)726460.0
28LF-eSSR79 *ATAGCAAATATCCGGCGATG
GACTCCTCCTCGTCGTTGTC
(ATC)712359.9
29LF-eSSR80 *TAGGGCATCATGCAATACGA
TCTGAGCGTGTGAGAAATGG
(GAA)722960.0
30LF-eSSR84TAAAATCCTTCACCATCCGC
ACCGCCAACTTCATGTTTTC
(CCA)626559.9
31LF-eSSR86ACGCCCCTTATCTTCTTGGT
TTGGCCTTGTTAGCGTCTTT
(GGT)623759.9
32LF-eSSR90CCATTTTCTCCTCCACTCCA
AGTGGGCATTTTAATGGCTG
(CAC)721460.0
33LF-eSSR91 *GCAAGCCGACAGAGAGTACC
CTACCGTCTTGTCCCTCCAA
(ACT)623560.1
34LF-eSSR92 *TTGGTGTAGGCTTCTTTGGG
CCTCCTCCCTCTCTTTCCAC
(GGT)627260.1
35LF-eSSR94 *TCCGAAACTCCAAGTCCAAG
TGGTCCTTCAGAACCCCATA
(GTT)621660.3
36LF-eSSR95 *AGATCTCGATGATGGGAACG
ACTCCATCCTCACCTTGTGC
(CTT)614960.1
37LF-eSSR97 *TGTTAGCACCACCCGTATCA
AGGATGTTGACGAGAATGCC
(CAA)622160.0
38LF-eSSR100 *TGTTGCTGGTTTTGTTCTCG
CACCCAAATTCTGCCAAAGT
(GTG)827759.9
* EST-SSR markers that were selected for the analysis of genetic diversity, the construction of DNA fingerprints, and the establishment of a core collection.
Table 2. Diversity information parameters for 24 SSR loci in 111 accessions of Liquidambar formosana.
Table 2. Diversity information parameters for 24 SSR loci in 111 accessions of Liquidambar formosana.
LocusNaNeHoHeIFPICHWPIPIsibs
LF-eSSR4114.8880.7570.7951.8910.0490.773ns0.0640.368
LF-eSSR593.0460.6420.6721.3790.0440.622ns0.1570.453
LF-eSSR12104.6670.8260.7861.815−0.0510.758ns0.0730.375
LF-eSSR18124.8060.7180.7921.9010.0930.770ns0.0650.370
LF-eSSR2441.3210.2250.2430.5020.0730.229ns0.5870.775
LF-eSSR2582.8930.6310.6541.2360.0360.593ns0.1810.468
LF-eSSR2951.8300.3150.4540.9070.3050.425***0.3270.605
LF-eSSR3563.2500.5590.6921.3810.1930.652ns0.1350.438
LF-eSSR3882.3930.5590.5821.3060.0410.557ns0.1990.509
LF-eSSR39102.6930.6850.6291.340−0.0890.583ns0.1830.482
LF-eSSR4983.4250.7030.7081.5370.0080.678ns0.1150.425
LF-eSSR5062.1370.4770.5320.9020.1030.436ns0.3150.563
LF-eSSR5582.6670.5320.6251.2180.1500.553ns0.2130.491
LF-eSSR5983.3840.6760.7041.5370.0410.674ns0.1170.427
LF-eSSR70133.1660.5770.6841.6230.1570.657ns0.1260.440
LF-eSSR72126.3060.7930.8412.0150.0580.822ns0.0440.340
LF-eSSR7963.1200.5320.6791.3390.2180.634***0.1480.447
LF-eSSR80146.2120.7660.8392.0500.0870.819ns0.0450.342
LF-eSSR9161.9510.3240.4880.9850.3350.458***0.2920.579
LF-eSSR9281.8670.4140.4641.0350.1080.441*0.3100.595
LF-eSSR9441.2270.1730.1850.4070.0650.176ns0.6730.826
LF-eSSR9541.4540.2970.3120.5930.0490.282ns0.5030.720
LF-eSSR97112.7100.4320.6311.4860.3150.609**0.1580.474
LF-eSSR100123.4630.5090.7111.6900.2840.687***0.1080.421
Mean8.4583.1200.5470.6131.3360.1110.579-0.2140.497
Combined--------1.475 × 10−192.561 × 10−8
Na, observed number of alleles; Ne, effective number of alleles; Ho, observed heterozygosity; He, expected heterozygosity; I, Shannon’s information index; F, fixation index; PIC, polymorphism information content; PI, probability of identity in random individuals; PIsibs, probability of identity in random sibs; HW, likelihood ratio tests for Hardy–Weinberg equilibrium. ns—not significant; * p < 0.05; ** p < 0.01; *** p < 0.001.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Dong, M.; Yu, N.; Li, R.; He, D.; Yuan, Z.; Yang, J.; Chen, Y. Fingerprinting Chinese Sweetgum (Liquidambar formosana Hance) Accessions and Constructing a Core Collection Using Newly Developed SSR Markers. Forests 2025, 16, 281. https://doi.org/10.3390/f16020281

AMA Style

Dong M, Yu N, Li R, He D, Yuan Z, Yang J, Chen Y. Fingerprinting Chinese Sweetgum (Liquidambar formosana Hance) Accessions and Constructing a Core Collection Using Newly Developed SSR Markers. Forests. 2025; 16(2):281. https://doi.org/10.3390/f16020281

Chicago/Turabian Style

Dong, Mingliang, Niu Yu, Rongsheng Li, Dong He, Zaixiang Yuan, Jinchang Yang, and Yong Chen. 2025. "Fingerprinting Chinese Sweetgum (Liquidambar formosana Hance) Accessions and Constructing a Core Collection Using Newly Developed SSR Markers" Forests 16, no. 2: 281. https://doi.org/10.3390/f16020281

APA Style

Dong, M., Yu, N., Li, R., He, D., Yuan, Z., Yang, J., & Chen, Y. (2025). Fingerprinting Chinese Sweetgum (Liquidambar formosana Hance) Accessions and Constructing a Core Collection Using Newly Developed SSR Markers. Forests, 16(2), 281. https://doi.org/10.3390/f16020281

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop