Relative Expression of Genes Elicited by Clonostachys rosea in Pinus radiata Induces Systemic Resistance
Abstract
1. Introduction
Main Genes Involved in Systemic Resistance
2. Materials and Methods
2.1. Plant Material
2.2. Clonostachys rosea and Fusarium circinatum Strain Culture Conditions
2.3. Induced Systemic Resistance Assay
2.4. RNA Extraction and Quantitative Real-Time PCR Analysis
2.5. Statistical Analysis
3. Results
3.1. Effect of the Application of C. rosea Strain Cr7 on the Damage Caused by F. circinatum in a Resistant Genotype of P. radiata
3.2. Relative Expression of Genes Involved in the Defensive Response of P. radiata Plants
4. Discussion
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Martin-Rodrigues, N.; Espinel, S.; Sanchez-Zabala, J.; Ortiz, A.; Gonzalez-Murua, C.; Dunabeitia, M.K. Spatial and temporal dynamics of the colonization of Pinus radiata by Fusarium circinatum, of conidiophora development in the pith and of traumatic resin duct formation. New Phytol. 2013, 198, 1215–1227. [Google Scholar] [CrossRef] [PubMed]
- Moraga-Suazo, P.; Orellana, L.; Quiroga, P.; Balocchi, C.; Sanfuentes, E.; Whetten, R.W.; Hasbún, R.; Valenzuela, S. Development of a genetic linkage map for Pinus radiata and detection of pitch canker disease resistance associated QTLs. Trees 2014, 28, 1823–1835. [Google Scholar] [CrossRef]
- Wikler, K.; Storer, A.J.; Newman, W.; Gordon, T.R.; Wood, D.L. The dynamics of an introduced pathogen in a native Monterey pine (Pinus radiata) forest. For. Ecol. Manag. 2003, 179, 209–221. [Google Scholar] [CrossRef]
- Ismael, A.; Suontama, M.; Klapste, J.; Kennedy, S.; Graham, N.; Telfer, E.; Dungey, H. Indication of Quantitative Multiple Disease Resistance to Foliar Pathogens in Pinus radiata D.Don in New Zealand. Front. Plant Sci. 2020, 11, 1044. [Google Scholar] [CrossRef]
- Rubilar, R.; Bozo, D.; Albaugh, T.; Cook, R.; Campoe, O.; Carter, D.; Allen, H.L.; Álvarez, J.; Pincheira, M.; Zapata, Á. Rotation-age effects of subsoiling, fertilization, and weed control on radiata pine growth at sites with contrasting soil physical, nutrient, and water limitations. For. Ecol. Manag. 2023, 544, 121213. [Google Scholar] [CrossRef]
- Richardson, B.; Vanner, A.; Davenhill, N.; Balneaves, J.; Miller, K.; Ray, J. Interspecific Competition between Pinus radiata and Some Common Weed Species—First-Year Results. N. Z. J. For. Sci. 1993, 23, 14. [Google Scholar]
- Carnegie, A.J.; Kathuria, A.; Nagel, M.; Mitchell, P.J.; Stone, C.; Sutton, M. Current and future risks of drought-induced mortality in Pinus radiata plantations in New South Wales, Australia. Aust. For. 2023, 85, 161–177. [Google Scholar] [CrossRef]
- Visser, E.A.; Kampmann, T.P.; Wegrzyn, J.L.; Naidoo, S. Multispecies comparison of host responses to Fusarium circinatum challenge in tropical pines show consistency in resistance mechanisms. Plant Cell Environ. 2023, 46, 1705–1725. [Google Scholar] [CrossRef]
- Gordon, T.R. Pitch canker disease of pines. Phytopathology 2006, 96, 657–659. [Google Scholar] [CrossRef]
- Wingfield, M.J.; Hammerbacher, A.; Ganley, R.J.; Steenkamp, E.T.; Gordon, T.R.; Wingfield, B.D.; Coutinho, T.A. Pitch canker caused by Fusarium circinatum—A growing threat to pine plantations and forests worldwide. Australas. Plant Pathol. 2008, 37, 15. [Google Scholar] [CrossRef]
- Gordon, T.R.; Storer, A.J.; Wood, D.L. The Pitch Canker Epidemic in California. Plant Dis. 2001, 85, 1128–1139. [Google Scholar] [CrossRef] [PubMed]
- Thomas, R.G.; Gregory, J.R.; Sharon, C.K.; Andrew, J.S.; David, L.W.; Daniel, M.F.; Brice, A.M. Monterey pine forest made a remarkable recovery from pitch canker. Calif. Agric. 2020, 74, 169–173. [Google Scholar] [CrossRef]
- Moraga-Suazo, P.; Opazo, A.; Zaldúa, S.; González, G.; Sanfuentes, E. Evaluation of Trichoderma spp. and Clonostachys spp. Strains to Control Fusarium circinatum in Pinus radiata Seedlings. Chil. J. Agric. Res. 2011, 71, 412–417. [Google Scholar] [CrossRef]
- Schweigkofler, W.; O’Donnell, K.; Garbelotto, M. Detection and quantification of airborne conidia of Fusarium circinatum, the causal agent of pine pitch canker, from two California sites by using a real-time PCR approach combined with a simple spore trapping method. Appl. Environ. Microbiol. 2004, 70, 3512–3520. [Google Scholar] [CrossRef] [PubMed]
- Martín-García, J.; Zas, R.; Solla, A.; Woodward, S.; Hantula, J.; Vainio, E.J.; Mullett, M.; Morales-Rodríguez, C.; Vannini, A.; Martínez-Álvarez, P.; et al. Environmentally friendly methods for controlling pine pitch canker. Plant Pathol. 2019, 68, 843–860. [Google Scholar] [CrossRef]
- Wingfield, M.J.; Jacobs, A.; Coutinho, T.A.; Ahumada, R.; Wingfield, B.D. First report of the pitch canker fungus, Fusarium circinatum, on pines in Chile. Plant Pathol. 2002, 51, 397. [Google Scholar] [CrossRef]
- Drenkhan, R.; Ganley, B.; Martín-García, J.; Vahalík, P.; Adamson, K.; Adamčíková, K.; Ahumada, R.; Blank, L.; Bragança, H.; Capretti, P.; et al. Global Geographic Distribution and Host Range of Fusarium circinatum, the Causal Agent of Pine Pitch Canker. Forests 2020, 11, 724. [Google Scholar] [CrossRef]
- Coutinho, T.A.; Steenkamp, E.T.; Mongwaketsi, K.; Wilmot, M.; Wingfield, M.J. First outbreak of pitch canker in a South African pine plantation. Australas. Plant Pathol. 2007, 36, 256–261. [Google Scholar] [CrossRef]
- Zamora-Ballesteros, C.; Diez, J.J.; Martín-García, J.; Witzell, J.; Solla, A.; Ahumada, R.; Capretti, P.; Cleary, M.; Drenkhan, R.; Dvořák, M.; et al. Pine Pitch Canker (PPC): Pathways of Pathogen Spread and Preventive Measures. Forests 2019, 10, 1158. [Google Scholar] [CrossRef]
- Donoso, A.; Rodriguez, V.; Carrasco, A.; Ahumada, R.; Sanfuentes, E.; Valenzuela, S. Relative expression of seven candidate genes for pathogen resistance on Pinus radiata infected with Fusarium circinatum. Physiol. Mol. Plant Pathol. 2015, 92, 42–50. [Google Scholar] [CrossRef]
- Valdebenito, D. Desarrollo de Formulaciones Biológicas a Base de Cepas de Trichoderma spp. y Clonostachys spp. para el Control de Fusarium circinatum en Plántulas de Pinus radiata; Universidad de Concepción: Concepción, Chile, 2016. [Google Scholar]
- Lübeck, M.; Knudsen, I.M.B.; Jensen, B.; Thrane, U.; Janvier, C.; Jensen, D.F. GUS and GFP transformation of the biocontrol strain Clonostachys rosea IK726 and the use of these marker genes in ecological studies. Mycol. Res. 2002, 106, 815–826. [Google Scholar] [CrossRef]
- Sutton, J.C.; Liu, W.; Huang, R.; Owen-Going, N. Ability of Clonostachys rosea to Establish and Suppress Sporulation Potential of Botrytis cinerea in Deleafed Stems of Hydroponic Greenhouse Tomatoes. Biocontrol Sci. Technol. 2002, 12, 413–425. [Google Scholar] [CrossRef]
- Hoopen, G.M.; Rees, R.; Aisa, P.; Stirrup, T.; Krauss, U. Population dynamics of epiphytic mycoparasites of the genera Clonostachys and Fusarium for the biocontrol of black pod (Phytophthora palmivora) and moniliasis (Moniliophthora roreri) on cocoa (Theobroma cacao). Mycol. Res. 2003, 107 Pt 5, 587–596. [Google Scholar] [CrossRef]
- Morandi, M.A.B.; Maffia, L.A.; Sutton, J.C. Development of Clonostachys rosea and interactions with Botrytis cinerea in rose leaves and residues. Phytoparasitica 2001, 29, 10. [Google Scholar] [CrossRef]
- Lahoz, E.; Contillo, R.; Porrone, F. Induction of Systemic Resistance to Erysiphe orontii Cast in Tobacco by Application on Roots of an Isolate of Gliocladium roseum Bainier. J. Phytopathol. 2004, 152, 465–470. [Google Scholar] [CrossRef]
- Nobre, S.A.M.; Maffia, L.A.; Mizubuti, E.S.G.; Cota, L.V.; Dias, A.P.S. Selection of Clonostachys rosea isolates from Brazilian ecosystems effective in controlling Botrytis cinerea. Biol. Control 2005, 34, 132–143. [Google Scholar] [CrossRef]
- Tarantino, P.; Caiazzo, R.; Carella, A.; Lahoz, E. Control of Rhizoctonia solani in a tobacco-float system using low rates of iprodione- and iprodione-resistant strains of Gliocladium roseum. Crop Prot. 2007, 26, 1298–1302. [Google Scholar] [CrossRef]
- Rodriguez, M.A.; Cabrera, G.; Gozzo, F.C.; Eberlin, M.N.; Godeas, A. Clonostachys rosea BAFC3874 as a Sclerotinia sclerotiorum antagonist: Mechanisms involved and potential as a biocontrol agent. J. Appl. Microbiol. 2011, 110, 1177–1186. [Google Scholar] [CrossRef]
- Molina, G.; Zaldúa, S.; González, G.; Sanfuentes, E. Selección de hongos antagonistas para el control biológico de Botrytis cinerea en viveros forestales en Chile. Bosque 2006, 27, 18. [Google Scholar]
- Zaldua, S.; Sanfuentes, E. Control of Botrytis cinerea in Eucalyptus globulus mini-cuttings using Clonostachys and Trichoderma strains. Chil. J. Agric. Res. 2010, 70, 6. [Google Scholar] [CrossRef]
- Sutton, J.C.; Li, D.-W.; Peng, G.; Yu, H.; Zhang, P.; Valdebenito-Sanhueza, R.M. Gliocladium roseum a versatile adversary of Botrytis cinerea. Plant Dis. 1997, 81, 12. [Google Scholar] [CrossRef] [PubMed]
- van Loon, L.C. Plant responses to plant growth-promoting rhizobacteria. Eur. J. Plant Pathol. 2007, 119, 243–254. [Google Scholar] [CrossRef]
- Walters, D.R.; Ratsep, J.; Havis, N.D. Controlling crop diseases using induced resistance: Challenges for the future. J. Exp. Bot. 2013, 64, 1263–1280. [Google Scholar] [CrossRef] [PubMed]
- Conn, V.M.; Walker, A.R.; Franco, C.M.M. Endophytic Actinobacteria Induce Defense Pathways in Arabidopsis thaliana. Mol. Plant Microbe Interact. 2008, 21, 10. [Google Scholar] [CrossRef] [PubMed]
- Ganley, R.J.; Sniezko, R.A.; Newcombe, G. Endophyte-mediated resistance against white pine blister rust in Pinus monticola. For. Ecol. Manag. 2008, 255, 2751–2760. [Google Scholar] [CrossRef]
- Eyles, A.; Bonello, P.; Ganley, R.; Mohammed, C. Induced resistance to pests and pathogens in trees. New Phytol. 2010, 185, 893–908. [Google Scholar] [CrossRef]
- Ebrahim, S.; Usha, K.; Singh, B. Pathogenesis related (PR) proteins in plant defense mechanism. Sci. Against Microb. Pathog. 2011, 2, 1043–1054. [Google Scholar]
- Mauch, F.; Mauch-Mani, B.; Boller, T. Antifungal Hydrolases in Pea Tissue. Plant Physiol. 1998, 88, 6. [Google Scholar]
- Benhamou, N.; Joosten, M.H.; De Wit, P.J. Subcellular Localization of Chitinase and of Its Potential Substrate in Tomato Root Tissues Infected by Fusarium oxysporum f. sp. radicis-lycopersici. Plant Physiol. 1990, 92, 12. [Google Scholar] [CrossRef]
- Campbell, M.M.; Ellis, B.E. Fungal Elicitor-Mediated Responses in Pine Cell Cultures. Plant Physiol. 1992, 98, 8. [Google Scholar] [CrossRef][Green Version]
- Dixon, R.A.; Paiva, N.L. Stress-lnduced Phenylpropanoid Metabolism. Plant Cell 1995, 7, 12. [Google Scholar] [CrossRef]
- Messner, B.; Meinrad, B.; Jfirgen, B. L-Phenylalanine ammonia-lyase in suspensionculture cells of spruce (Picea abies) Induction by UV-light and fungal elicitor. Plant Cell Tissue Organ Cult. 1991, 27, 7. [Google Scholar] [CrossRef]
- Lam, M.L. Phenylalanine Ammonia-Lyase (Ec 4.3.1.5) from Pinus banksiana: Partial cDNA Cloning and Effect of Exogenously Supplied Frans-Cinnamic Acid on Elicitor Inducible Expression; University of British Columbia: Vancouver, BC, Canada, 1996. [Google Scholar]
- Veronico, P.; Giannino, D.; Melillo, M.T.; Leone, A.; Reyes, A.; Kennedy, M.W.; Bleve-Zacheo, T. A novel lipoxygenase in pea roots. Its function in wounding and biotic stress. Plant Physiol. 2006, 141, 1045–1055. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Porta, H.; Rocha-Sosa, M. Plant lipoxygenases. Physiological and molecular features. Plant Physiol. 2002, 130, 15–21. [Google Scholar] [CrossRef]
- Rosahl, S. Lipoxygenases in Plants—Their Role in Development and Stress Response. Z. Naturforsch. 1996, 51, 15. [Google Scholar] [CrossRef]
- Sprenger, G.A.; Schorken, U.; Wiegert, T.; Grolle, S.; Graaf, A.A.D.; Taylor, S.V.; Begley, T.P.; Bringer-Meyer, S.; Sahm, H. Identification of a thiamin-dependent synthase in Escherichia coli required for the formation of the 1-deoxy-D-xylulose 5-phosphate precursor to isoprenoids, thiamin, and pyridoxol. Proc. Natl. Acad. Sci. USA 1997, 94, 5. [Google Scholar] [CrossRef]
- Croteau, R.; Gurkewitz, S.; Johnson, M.A.; Fisk, H.J. Biochemistry of Oleoresinosis. Plant Physiol. 1987, 85, 5. [Google Scholar] [CrossRef] [PubMed]
- Phillips, M.A.; Croteau, R.B. Resin-based defenses in conifers. Trends Plant Sci. 1999, 4, 7. [Google Scholar] [CrossRef]
- Bonello, P.; Gordon, T.R.; Herms, D.A.; Wood, D.L.; Erbilgin, N. Nature and ecological implications of pathogen-induced systemic resistance in conifers: A novel hypothesis. Physiol. Mol. Plant Pathol. 2006, 68, 95–104. [Google Scholar] [CrossRef]
- Moraga-Suazo, P.; Sanfuentes, E.; Le-Feuvre, R. Induced Systemic Resistance Triggered by Clonostachys rosea against Fusarium circinatum in Pinus radiata. For. Res. Open Access 2016, 5, 174. [Google Scholar]
- Chang, S.; Puryear, J.; Cairney, J. A simple and efficient method for isolating RNA from pine trees. Plant Mol. Biol. Rep. 1993, 11, 4. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
- Rodriguez, V. Expresión Diferencial de Genes Asociados a la Respuesta al Patógeno Fusarium circinatum en Pinus radiata. Master’s Thesis, Departamento de Silvicultura, Facultad de Ciencias Forestales, Universidad de Concepción, Concepción, Chile, 2013; 54p. [Google Scholar]
- Sutton, J.C.; Peng, G. Biocontrol of Botrytis cinerea in strawberry leaves. Dis. Control Pest Manag. 1993, 83, 7. [Google Scholar]
- Mouekouba, L.D.; Zhang, L.; Guan, X.; Chen, X.; Chen, H.; Zhang, J.; Zhang, J.; Li, J.; Yang, Y.; Wang, A. Analysis of Clonostachys rosea-induced resistance to tomato gray mold disease in tomato leaves. PLoS ONE 2014, 9, e102690. [Google Scholar] [CrossRef] [PubMed]
- Roberti, R.; Veronesi, A.; Cesari, A.; Cascone, A.; Di Berardino, I.; Bertini, L.; Caruso, C. Induction of PR proteins and resistance by the biocontrol agent Clonostachys rosea in wheat plants infected with Fusarium culmorum. Plant Sci. 2008, 175, 339–347. [Google Scholar]
- Lahlali, R.; Peng, G. Suppression of clubroot by Clonostachys rosea via antibiosis and induced host resistance. Plant Pathol. 2013, 63, 447–455. [Google Scholar] [CrossRef]
- Durrant, W.E.; Dong, X. Systemic acquired resistance. Annu. Rev. Phytopathol. 2004, 42, 185–209. [Google Scholar] [CrossRef]
- Bonello, P.; Gordon, T.R.; Storer, A.J. Systemic induced resistance in Monterey pine. For. Pathol. 2001, 31, 8. [Google Scholar] [CrossRef]
- Vallad, G.E.; Goodman, R.M. Systemic Acquired Resistance and Induced Systemic Resistance. Crop Sci. 2004, 44, 15. [Google Scholar] [CrossRef]
- Gurr, S.J.; Rushton, P.J. Engineering plants with increased disease resistance: What are we going to express? Trends Biotechnol. 2005, 23, 275–282. [Google Scholar] [CrossRef]
- Chatterton, S.; Punja, Z.K. Chitinase and β-1,3-glucanase enzyme production by the mycoparasite Clonostachys rosea f. catenulata against fungal plant pathogens. Can. J. Microbiol. 2009, 55, 356–367. [Google Scholar]
- Keeling, C.I.; Bohlmann, J. Genes, enzymes and chemicals of terpenoid diversity in the constitutive and induced defence of conifers against insects and pathogens. New Phytol. 2006, 170, 657–675. [Google Scholar] [CrossRef]
- Slinski, S.L.; Zakharov, F.; Gordon, T.R. The Effect of Resin and Monoterpenes on Spore Germination and Growth in Fusarium circinatum. Phytopathology 2015, 105, 119–125. [Google Scholar] [CrossRef]
- Walter, M.H.; Hans, J.; Strack, D. Two distantly related genes encoding 1-deoxy-D-xylulose 5-phosphate synthases: Differential regulation in shoots and apocarotenoid-accumulating mycorrhizal roots. Plant J. 2002, 31, 12. [Google Scholar] [CrossRef]
- Phillips, M.A.; Walter, M.H.; Ralph, S.G.; Dabrowska, P.; Luck, K.; Uros, E.M.; Boland, W.; Strack, D.; Rodriguez-Concepcion, M.; Bohlmann, J.; et al. Functional identification and differential expression of 1-deoxy-D-xylulose 5-phosphate synthase in induced terpenoid resin formation of Norway spruce (Picea abies). Plant Mol. Biol. 2007, 65, 243–257. [Google Scholar] [CrossRef]
- Steele, C.L.; Lewinsohn, E.; Croteau, R. Induced oleoresin biosynthesis in grand fir as a defense against bark beetles. Proc. Natl. Acad. Sci. USA 1995, 92, 5. [Google Scholar] [CrossRef]
- Martin, D.; Tholl, D.; Gershenzon, J.; Bohlmann, J. Methyl jasmonate induces traumatic resin ducts, terpenoid resin biosynthesis, and terpenoid accumulation in developing xylem of Norway spruce stems. Plant Physiol. 2002, 129, 1003–1018. [Google Scholar] [CrossRef]
- Kim, Y.B.; Kim, S.M.; Kang, M.K.; Kuzuyama, T.; Lee, J.K.; Park, S.C.; Shin, S.C.; Kim, S.U. Regulation of resin acid synthesis in Pinus densiflora by differential transcription of genes encoding multiple 1-deoxy-D-xylulose 5-phosphate synthase and 1-hydroxy-2-methyl-2-(E)-butenyl 4-diphosphate reductase genes. Tree Physiol. 2009, 29, 737–749. [Google Scholar] [CrossRef]
- Zamora-Ballesteros, C.; Pinto, G.; Amaral, J.; Valledor, L.; Alves, A.; Diez, J.J.; Martin-Garcia, J. Dual RNA-Sequencing Analysis of Resistant (Pinus pinea) and Susceptible (Pinus radiata) Hosts during Fusarium circinatum Challenge. Int. J. Mol. Sci. 2021, 22, 5231. [Google Scholar] [CrossRef]
- Shoresh, M.; Yedidia, I.; Chet, I. Involvement of Jasmonic Acid/Ethylene Signaling Pathway in the Systemic Resistance Induced in Cucumber by Trichoderma asperellum T203. Phytopathology 2005, 95, 76–84. [Google Scholar] [CrossRef]
- Yang, J.; Duan, G.; Li, C.; Liu, L.; Han, G.; Zhang, Y.; Wang, C. The Crosstalks between Jasmonic Acid and Other Plant Hormone Signaling Highlight the Involvement of Jasmonic Acid as a Core Component in Plant Response to Biotic and Abiotic Stresses. Front. Plant Sci. 2019, 10, 1349. [Google Scholar] [CrossRef]
- Wang, J.; Song, L.; Gong, X.; Xu, J.; Li, M. Functions of Jasmonic Acid in Plant Regulation and Response to Abiotic Stress. Int. J. Mol. Sci. 2020, 21, 1446. [Google Scholar] [CrossRef]
- Fatouros, G.; Gkizi, D.; Fragkogeorgi, G.A.; Paplomatas, E.J.; Tjamos, S.E. Biological control of Pythium, Rhizoctonia and Sclerotinia in lettuce: Association of the plant protective activity of the bacterium Paenibacillus alvei K165 with the induction of systemic resistance. Plant Pathol. 2017, 67, 418–425. [Google Scholar] [CrossRef]
- Sailaja, P.R.; Podile, A.R.; Reddanna, P. Biocontrol strain of Bacillus subtilis rapidly induces lipoxygenase in groundnut compared to crown rot pathogen Aspergillus niger. Eur. J. Plant Pathol. 1997, 104, 8. [Google Scholar]
- Ben Amira, M.; Lopez, D.; Triki Mohamed, A.; Khouaja, A.; Chaar, H.; Fumanal, B.; Gousset-Dupont, A.; Bonhomme, L.; Label, P.; Goupil, P.; et al. Beneficial effect of Trichoderma harzianum strain Ths97 in biocontrolling Fusarium solani causal agent of root rot disease in olive trees. Biol. Control 2017, 110, 70–78. [Google Scholar] [CrossRef]
- Shoresh, M.; Harman, G.E.; Mastouri, F. Induced systemic resistance and plant responses to fungal biocontrol agents. Annu. Rev. Phytopathol. 2010, 48, 21–43. [Google Scholar] [CrossRef]
- Fitza, K.N.E.; Payn, K.G.; Steenkamp, E.T.; Myburg, A.A.; Naidoo, S. Chitosan application improves resistance to Fusarium circinatum in Pinus patula. S. Afr. J. Bot. 2013, 85, 70–78. [Google Scholar] [CrossRef]
- Hahlbrock, K.; Scheel, D. Physiology and Molecular Biology of Phenylpropanoid Metabolism. Annu. Rev. Plant Physiol. Plant Mol. Biol. 1989, 40, 347–369. [Google Scholar] [CrossRef]
- Osakabe, Y.; Osakabe, K.; Chiang, V.L. Characterization of the tissue-specific expression of phenylalanine ammonia-lyase gene promoter from loblolly pine (Pinus taeda) in Nicotiana tabacum. Plant Cell Rep. 2009, 28, 1309–1317. [Google Scholar] [CrossRef]
- Singh, D.P.; Bahadur, A.; Sarma, B.K.; Maurya, S.; Singh, H.B.; Singh, U.P. Exogenous application of L-phenylalanine and ferulic acid enhance phenylalanine ammonia lyase activity and accumulation of phenolic acids in pea (Pisum sativum) to offer protection against Erysiphe pisi. Arch. Phytopathol. Plant Prot. 2010, 43, 1454–1462. [Google Scholar] [CrossRef]
- Yu, X.Y.; Bi, Y.; Yan, L.; Liu, X.; Wang, Y.; Shen, K.P.; Li, Y.C. Activation of phenylpropanoid pathway and PR of potato tuber against Fusarium sulphureum by fungal elicitor from Trichothecium roseum. World J. Microbiol. Biotechnol. 2016, 32, 142. [Google Scholar] [CrossRef]
- Bu, B.; Qiu, D.; Zeng, H.; Guo, L.; Yuan, J.; Yang, X. A fungal protein elicitor PevD1 induces Verticillium wilt resistance in cotton. Plant Cell Rep. 2014, 33, 461–470. [Google Scholar] [CrossRef]
- Mutawila, C.; Stander, C.; Halleen, F.; Vivier, M.A.; Mostert, L. Response of Vitis vinifera cell cultures to Eutypa lata and Trichoderma atroviride culture filtrates: Expression of defence-related genes and phenotypes. Protoplasma 2017, 254, 863–879. [Google Scholar] [CrossRef]
- Agrios, G. Plant Pathology, 5th ed.; Academic Press: Cambridge, MA, USA, 2005. [Google Scholar]
- Jayaraj, J.; Rahman, M.; Wan, A.; Punja, Z.K. Enhanced resistance to foliar fungal pathogens in carrot by application of elicitors. Ann. Appl. Biol. 2009, 155, 71–80. [Google Scholar] [CrossRef]
- Anand, A.; Lei, Z.; Sumner, L.W.; Mysore, K.S.; Arakane, Y.; Bockus, W.W.; Muthukrishnan, S. Apoplastic Extracts from a Transgenic Wheat Line Exhibiting Lesion-Mimic Phenotype Have Multiple Pathogenesis-Related Proteins That Are Antifungal. Mol. Plant Microbe Interact. 2004, 17, 12. [Google Scholar] [CrossRef]
- Pechanova, O.; Hsu, C.; Adams, J.P. Apoplast proteome reveals that extracellular matrix contributes to multistress response in poplar. BMC Genom. 2010, 11, 22. [Google Scholar] [CrossRef]
- Gerhardt, A.L.B.; Sachetto-Martins, G.; Contarini, M.G.; Sandroni, M.; Ferreira, R.D.; Lima, V.M.; Cordeiro, M.C.; Oliveira, D.E.; Margis-Pinheiro, M. Arabidopsis thaliana class IV chitinase is early induced during the interaction with Xanthomonas campestris. FEBS Lett. 1997, 419, 69–75. [Google Scholar] [CrossRef]
- Grover, A. Plant Chitinases: Genetic Diversity and Physiological Roles. Crit. Rev. Plant Sci. 2012, 31, 57–73. [Google Scholar] [CrossRef]
- Yasuda, M.; Isawa, T.; Shinozaki, S.; Minamisawa, K.; Nakashita, H. Effects of colonization of a bacterial endophyte, Azospirillum sp. B510, on disease resistance in rice. Biosci. Biotechnol. Biochem. 2009, 73, 2595–2599. [Google Scholar] [CrossRef]
- Bordiec, S.; Paquis, S.; Lacroix, H.; Dhondt, S.; Ait Barka, E.; Kauffmann, S.; Jeandet, P.; Mazeyrat-Gourbeyre, F.; Clément, C.; Baillieul, F.; et al. Comparative analysis of defence responses induced by the endophytic plant growth-promoting rhizobacterium Burkholderia phytofirmans strain PsJN and the non-host bacterium Pseudomonas syringae pv. pisi in grapevine cell suspensions. J. Exp. Bot. 2010, 62, 595–603. [Google Scholar] [CrossRef]
- Dababat, A.E.-F.A.; Sikora, R.A. Influence of the mutualistic endophyte Fusarium oxysporum 162 on Meloidogyne incognita attraction and invasion. Nematology 2017, 9, 6. [Google Scholar] [CrossRef]
- Donoso, E.; Lobos, G.A.; Rojas, N. Efecto de Trichoderma harzianum sobre el crecimiento de Pinus radiata en vivero. Bosque 2008, 29, 5. [Google Scholar] [CrossRef]



| Gene | Forward (5′-3′) | Reverse (5′-3′) | GenBank ID Gene | Amplicon | Reference |
|---|---|---|---|---|---|
| DXS | TGGGAAGGCGGGTTGGTAAAG | TTGATTGTGTCCAGGAGAGGTGTC | EU439293 | 97 | This work |
| LOX | AGGCAGTGGAAATGGAAAGTTTGG | CAAGCGTGAGTGAGTTGAGGAAG | JQ262756 | 191 | This work |
| PAL | GGAGCCACTTCTCACAGGAG | CCGGGTAGTATCTTCGGACA | U39792 | 123 | [55] |
| PR3 | AAACCTGGATTGCAACAACC | TTATGGCAAACGGGTACACA | AF457093 | 150 | [20] |
| GAPDH (hkp) | GCTCCCAGCAAGGATGCCCC | AGCCAAAGGGGCCAAGCAGT | L07501 | 117 | [20] |
| UBQ (hkp) | TGGCCGGGCAGGATCAAACG | TCCCCTCGTAAACGCCTCCC | BM133596 | 122 | [20] |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Moraga-Suazo, P.; Le-Feuvre, R.; Navarrete, D.; Sanfuentes, E. Relative Expression of Genes Elicited by Clonostachys rosea in Pinus radiata Induces Systemic Resistance. Forests 2024, 15, 854. https://doi.org/10.3390/f15050854
Moraga-Suazo P, Le-Feuvre R, Navarrete D, Sanfuentes E. Relative Expression of Genes Elicited by Clonostachys rosea in Pinus radiata Induces Systemic Resistance. Forests. 2024; 15(5):854. https://doi.org/10.3390/f15050854
Chicago/Turabian StyleMoraga-Suazo, Priscila, Regis Le-Feuvre, Dario Navarrete, and Eugenio Sanfuentes. 2024. "Relative Expression of Genes Elicited by Clonostachys rosea in Pinus radiata Induces Systemic Resistance" Forests 15, no. 5: 854. https://doi.org/10.3390/f15050854
APA StyleMoraga-Suazo, P., Le-Feuvre, R., Navarrete, D., & Sanfuentes, E. (2024). Relative Expression of Genes Elicited by Clonostachys rosea in Pinus radiata Induces Systemic Resistance. Forests, 15(5), 854. https://doi.org/10.3390/f15050854

