Screening and Expression Analysis of POD Gene in POD-H2O2 Pathway on Bud Dormancy of Pear (Pyrus pyrifolia)
Abstract
1. Introduction
2. Materials and Methods
2.1. Plant Materials
2.2. Statistics of Germination Rate and Detection of H2O2 Content and POD Activity in Different Dormancy States of Pear
2.3. RNA Extraction
2.4. Screening Determination of POD Gene in Bud Dormancy of Pear
2.5. Gene Cloning
2.6. Structural Characterization of PpPOD4-like
2.7. Subcellular Localization and Determination of H2O2 Content in Overexpression
2.8. Analysis of PpPOD4-like Gene Expression during Pear Dormancy
2.9. Correlation Analysis of H2O2 Content and POD Activity with PpPOD4-like
3. Results
3.1. Statistical Analysis of Germination Rate and Determination of Pear Dormancy Stage
3.2. Alterations in H2O2 Content and POD Activity across Distinct Dormancy Phases in Pear
3.3. Screening Determination of PpPOD4-like from POD Genes
3.4. cDNA Cloning of PpPOD4-like Gene from Pear
3.5. Bioinformatics Analysis of PpPOD4-like
3.5.1. Physicochemical Properties of PpPOD4-like Protein in Pear
3.5.2. Protein Domain and Motif Prediction Protein Sequence Alignment Analysis
3.5.3. Evolutionary Tree and Promoter Cis-Acting Element Analysis
3.6. Subcellular Localization and H2O2 Content in Overexpressed N. benthamiana
3.7. Expression Analysis of PpPOD4-like during Pear Bud Dormancy
3.8. Correlation Analysis
4. Discussion
5. Conclusions
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Nan, W.; Jing, Z.; Lei, Y.U.; Qi, Z.O.U.; Zhang-Wen, G.U.O.; Zuo-Lin, M.A.O.; Yi-Cheng, W.; Sheng-Hui, J.; Hong-Cheng, F.; Hai-Feng, X.U.; et al. Progress on the Resource Breeding of Kernel Fruits Ⅰ: Progress on the Germplasm Resources, Quality development and Genetic Breeding of Apple in China. Plant Genet. Resour. 2019, 20, 801–812. [Google Scholar]
- Salama, A.-M.; Ezzat, A.; El-Ramady, H.; Alam-Eldein, S.M.; Okba, S.K.; Elmenofy, H.M.; Hassan, I.F.; Illés, A.; Holb, I.J. Temperate Fruit Trees under Climate Change: Challenges for Dormancy and Chilling Requirements in Warm Winter Regions. Horticulturae 2021, 7, 86. [Google Scholar] [CrossRef]
- Prudencio, A.S.; Díaz-Vivancos, P.; Dicenta, F.; Hernández, J.A.; Martínez-Gómez, P. Monitoring the transition from endodormancy to ecodormancy in almond through the analysis and expression of a specific class III peroxidase gene. Tree Genet. Genomes 2019, 15, 44. [Google Scholar] [CrossRef]
- Zeng, J.; Dong, Z.; Wu, H.; Tian, Z.; Zhao, Z. Redox regulation of plant stem cell fate. EMBO J. 2017, 36, 2844–2855. [Google Scholar] [CrossRef]
- Swanson, S.; Gilroy, S. ROS in plant development. Physiol. Plant. 2010, 138, 384–392. [Google Scholar] [CrossRef] [PubMed]
- Petrov, V.; Hille, J.; Mueller-Roeber, B.; Gechev, T.S. ROS-mediated abiotic stress-induced programmed cell death in plants. Front. Plant Sci. 2015, 6, 69. [Google Scholar] [CrossRef]
- Turkan, I. ROS and RNS: Key signalling molecules in plants. J. Exp. Bot. 2018, 69, 3313–3315. [Google Scholar] [CrossRef]
- Kuroda, H.; Sugiura, T.; Sugiura, H. Effect of hydrogen peroxide on breaking endodormancy in flower buds of Japanese pear (Pyrus pyrifolia Nakai). J. Jpn. Soc. Hortic. Sci. 2005, 74, 255–257. [Google Scholar] [CrossRef]
- Dangl, J.L.; Jones, J.D.G. Plant pathogens and integrated defence responses to infection. Nature 2001, 411, 826–833. [Google Scholar] [CrossRef]
- Li, L.; Liu, J.; Liang, Q.; Feng, Y.; Wang, C.; Wu, S.; Li, Y. Downregulation of lncRNA PpL-T31511 and Pp-miRn182 Promotes Hydrogen Cyanamide-Induced Endodormancy Release through the PP2C-H2O2 Pathway in Pear (Pyrus pyrifolia). Int. J. Mol. Sci. 2021, 22, 11842. [Google Scholar] [CrossRef]
- Pérez, F.J.; Vergara, R.; Rubio, S. H2O2 is involved in the dormancy-breaking effect of hydrogen cyanamide in grapevine buds. Plant Growth Regul. 2008, 55, 149–155. [Google Scholar] [CrossRef]
- Ito, A.; Tuan, P.A.; Saito, T.; Bai, S.; Kita, M.; Moriguchi, T. Low temperature, but not photoperiod, controls growth cessation and dormancy induction and release in apple and pear. Tree Physiol. 2011, 41, 529–543. [Google Scholar] [CrossRef]
- Shao, H.; Ma, F.-W. Relationship between breaking of dormancy and reactive oxygen species metabolism in flower buds of pear. J. Plant Physiol. Mol. Biol. 2004, 30, 660–664. [Google Scholar]
- Gao, D.; Shu, H.; Li, X. The relationship of H2O2 Content in Buds with the Endodormancy of Fruit Trees. Acta Hortic. Sin. 2002, 29, 209–213. [Google Scholar]
- Lee, C.-J.; Park, S.-U.; Kim, S.-E.; Lim, Y.-H.; Ji, C.Y.; Kim, Y.-H.; Kim, H.S.; Kwak, S.-S. Overexpression of IbLfp in sweetpotato enhances the low-temperature storage ability of tuberous roots. Plant Physiol. Biochem. 2021, 167, 577–585. [Google Scholar] [CrossRef]
- Passardi, F.; Cosio, C.; Penel, C.; Dunand, C. Peroxidases have more functions than a Swiss army knife. Plant Cell Rep. 2005, 24, 255–265. [Google Scholar] [CrossRef]
- Kawano, T. Roles of the reactive oxygen species-generating peroxidase reactions in plant defense and growth induction. Plant Cell Rep. 2003, 21, 829–837. [Google Scholar] [CrossRef]
- Foyer, C.H.; Descourvières, P.; Kunert, K.J. Protection against oxygen radicals: An important defence mechanism studied in transgenic plants. Plant Cell Environ. 1994, 17, 507–523. [Google Scholar] [CrossRef]
- Li, L.; Liu, J.; Liang, Q.; Zhang, Y.; Kang, K.; Wang, W.; Feng, Y.; Wu, S.; Yang, C.; Li, Y. Genome-wide analysis of long noncoding RNAs affecting floral bud dormancy in pears in response to cold stress. Tree Physiol. 2021, 41, 771–790. [Google Scholar] [CrossRef]
- Li, W.; Zhang, S.; Tang, H.; He, L. Effect of Exogenous Gibberellic Acid on Paeonia rockii Seeds Germination. Acta Bot. Boreali-Occident. Sin. 2019, 39, 1819–1826. [Google Scholar]
- Noriega, X.; Burgos, B.; Pérez, F.J. Short day-photoperiod triggers and low temperatures increase expression of peroxidase RNA transcripts and basic peroxidase isoenzyme activity in grapevine buds. Phytochemistry 2007, 68, 1376–1383. [Google Scholar] [CrossRef]
- Amaya, I.; Botella, M.A.; de la Calle, M.; Medina, M.I.; Heredia, A.; Bressan, R.A.; Hasegawa, P.M.; Quesada, M.A.; Valpuesta, V. Improved germination under osmotic stress of tobacco plants overexpressing a cell wall peroxidase. FEBS Lett. 1999, 457, 80–84. [Google Scholar] [CrossRef]
- Xie, Z.; Rui, W.; Yuan, Y.; Song, X.; Liu, X.; Gong, X.; Bao, J.; Zhang, S.; Shahrokh, K.; Tao, S. Analysis of PRX Gene Family and Its Function on Cell Lignification in Pears (Pyrus bretschneideri). Plants 2021, 10, 1874. [Google Scholar] [CrossRef]
- Liu, F.; Liang, D.; Wang, J.; Lv, X.; Gong, M. The Effect of Promoting Sprouting Process by Cyanamide on the Growth of Grape Leaves. J. Biobased Mater. Bioenergy 2017, 11, 649–654. [Google Scholar] [CrossRef]
- Wang, Z.; Ma, R.; Zhao, M.; Wang, F.; Zhang, N.; Si, H. NO and ABA Interaction Regulates Tuber Dormancy and Sprouting in Potato. Front. Plant Sci. 2020, 11, 311. [Google Scholar] [CrossRef] [PubMed]
- Ma, X.; Li, L.; Liu, J.; Yang, M.; Chen, J.; Liang, Q.; Wu, S.; Li, Y. Identification and Differentially Expressed Analysis of microRNA Associated with Dormancy of Pear Flower Buds. Acta Hortic. Sin. 2018, 45, 2089–2105. [Google Scholar] [CrossRef]
- Yamane, H.; Ooka, T.; Jotatsu, H.; Hosaka, Y.; Sasaki, R.; Tao, R. Expressional regulation of PpDAM5 and PpDAM6, peach (Prunus persica) dormancy-associated MADS-box genes, by low temperature and dormancy-breaking reagent treatment. J. Exp. Bot. 2011, 62, 3481–3488. [Google Scholar] [CrossRef] [PubMed]
- Liu, G. Molecular Physiological Mechanism of Pear Dormancy. Ph.D. Thesis, Zhejiang University, Hangzhou, China, 2013. [Google Scholar]
- Lang, G.A.; Early, J.D.; Martin, G.C.; Darnell, R.L. Endo-, Para-, and Ecodormancy: Physiological Terminology and Classification for Dormancy Research. HortScience 1987, 22, 371–377. [Google Scholar] [CrossRef]
- Wu, J.; Wang, Z.; Shi, Z.; Zhang, S.; Ming, R.; Zhu, S.; Khan, M.A.; Tao, S.; Korban, S.S.; Wang, H.; et al. The genome of the pear (Pyrus bretschneideri Rehd.). Genome Res. 2013, 23, 396–408. [Google Scholar] [CrossRef]
- Gong, B.; Yi, J.; Wu, J.; Sui, J.; Khan, M.A.; Wu, Z.; Zhong, X.; Seng, S.; He, J.; Yi, M. LlHSFA1, a novel heat stress transcription factor in lily (Lilium longiflorum), can interact with LlHSFA2 and enhance the thermotolerance of transgenic Arabidopsis thaliana. Plant Cell Rep. 2014, 33, 1519–1533. [Google Scholar] [CrossRef]
- Yan, P.; Zeng, Y.; Shen, W.; Tuo, D.; Li, X.; Zhou, P. Nimble Cloning: A Simple, Versatile, and Efficient System for Standardized Molecular Cloning. Front. Bioeng. Biotechnol. 2020, 7, 460. [Google Scholar] [CrossRef]
- Arora, R.; Rowland, L.J.; Tanino, K. Induction and release of bud dormancy in woody perennials: A science comes of age. HortScience 2003, 38, 911–921. [Google Scholar] [CrossRef]
- Alves, G.; Decourteix, M.; Fleurat-Lessard, P.; Sakr, S.; Bonhomme, M.; Améglio, T.; Lacointe, A.; Julien, J.-L.; Petel, G.; Guilliot, A. Spatial activity and expression of plasma membrane H+-ATPase in stem xylem of walnut during dormancy and growth resumption. Tree Physiol. 2007, 27, 1471–1480. [Google Scholar] [CrossRef]
- Desikan, R.; A.-H.-Mackerness, S.; Hancock, J.T.; Neill, S.J. Regulation of the arabidopsis transcriptome by oxidative stress. Plant Physiol. 2001, 127, 159–172. [Google Scholar] [CrossRef]
- Choudhary, R.; Saroha, A.E.; Swarnkar, P.L. Effect of abscisic acid and hydrogen peroxide on antioxidant enzymes in Syzygium cumini plant. J. Food Sci. Technol. 2012, 49, 649–652. [Google Scholar] [CrossRef]
- Song, X.G.; She, X.P.; Wang, J. Inhibition of darkness-induced stomatal closure by ethylene involves a removal of hydrogen peroxide from guard cells of Vicia faba. Russ. J. Plant Physiol. 2012, 59, 372–380. [Google Scholar] [CrossRef]
- Wendehenne, D.; Durner, J.; Klessig, D.F. Nitric oxide: A new player in plant signalling and defence responses. Curr. Opin. Plant Biol. 2004, 7, 449–455. [Google Scholar] [CrossRef]
- Wang, L.; Chen, L.; Li, R.; Zhao, R.; Yang, M.; Sheng, J.; Shen, L. Reduced Drought Tolerance by CRISPR/Cas9-Mediated SlMAPK3 Mutagenesis in Tomato Plants. J. Agric. Food Chem. 2017, 65, 8674–8682. [Google Scholar] [CrossRef]
- O’Brien, J.A.; Daudi, A.; Butt, V.S.; Paul Bolwell, G. Reactive oxygen species and their role in plant defence and cell wall metabolism. Planta 2012, 236, 765–779. [Google Scholar] [CrossRef]
- Zhang, A.; Zheng, Y.; Chen, T.; Geng, W.; Fang, Y.; Wang, H. Variation of Active Oxygen Metabolism, An-ti-oxidation System in Grapevine Buds Tissue during Bud Dormancy Inducing and Releasing. Acta Bot. Bore-Ali-Occident. Sin. 2012, 32, 2075–2081. [Google Scholar]
- Tian, L.; Fang, J.; Wang, L.; Niu, L. Changes of several physiological indexes during dormancy releasing in nectarine cultivar Huaguang. J. Fruit Sci. 2006, 23, 121–124. [Google Scholar]
- Li, B.; Xia, X.; Liu, S. Changes in Physiological and Biochemical Properties and Variation in DNA Methylation Patterns during Dormancy and Dormancy Release in Blueberry (Vaccinium corymbosum L.). Plant Physiol. J. 2015, 51, 1133–1141. [Google Scholar] [CrossRef]
- Kim, B.H.; Kim, S.Y.; Nam, K.H. Genes encoding plant-specific class III peroxidases are responsible for increased cold tolerance of the brassinosteroid-insensitive 1 mutant. Mol. Cells 2012, 34, 539–548. [Google Scholar] [CrossRef]
- Mei, W.; Qin, Y.; Song, W.; Li, J.; Zhu, Y. Cotton GhPOX1 encoding plant class III peroxidase may be responsible for the high level of reactive oxygen species production that is related to cotton fiber elongation. J. Genet. Genom. 2009, 36, 141–150. [Google Scholar] [CrossRef]
- Kumar, S.; Jaggi, M.; Sinha, A.K. Ectopic overexpression of vacuolar and apoplastic Catharanthus roseus peroxidases confers differential tolerance to salt and dehydration stress in transgenic tobacco. Protoplasma 2012, 249, 423–432. [Google Scholar] [CrossRef]
- Bright, J.; Desikan, R.; Hancock, J.T.; Weir, I.S.; Neill, S.J. ABA-induced NO generation and stomatal closure in Arabidopsis are dependent on H2O2 synthesis. Plant J. 2006, 45, 113–122. [Google Scholar] [CrossRef]
- Li, X.; Yang, Y.; Zhang, L.; Zuo, S.; Li, L.; Jiao, J.; Li, J. Regulation of Endogenous Hormone Content and Asr1 Gene Expression in Maize Seedlings by Exogenous ABA under Low Temperature Stress. Chin. J. Crops 2017, 43, 141–148. [Google Scholar] [CrossRef]
- Li, H.; Dong, J.; Jiang, J.; Liu, G. Cloning and expression analysis of two novel Prxs genes from Tamarix hispida. J. Beijing For. Univ. 2012, 34, 48–52. [Google Scholar] [CrossRef]
- Sherf, B.A.; Bajar, A.M.; Kolattukudy, P.E. Abolition of an Inducible Highly Anionic Peroxidase Activity in Transgenic Tomato. Plant Physiol. 1993, 101, 201–208. [Google Scholar] [CrossRef] [PubMed]
- Li, W.; Feng, J.; Tang, Z.; Dong, S.; Xu, L.; Zhang, S.; Zhang, Y. Correlation Analysis of Solid Stone Cell Content and Expression of POD4 Gene in Korla Fragrant Pear. Xinjiang Agric. Sci. 2017, 54, 60–65. [Google Scholar]
- Fujita, Y.; Fujita, M.; Shinozaki, K.; Yamaguchi-Shinozaki, K. ABA-mediated transcriptional regulation in response to osmotic stress in plants. J. Plant Res. 2011, 124, 509–525. [Google Scholar] [CrossRef] [PubMed]
- Kumar, M.; Kesawat, M.S.; Ali, A.; Lee, S.-C.; Gill, S.S.; Kim, H.U. Integration of Abscisic Acid Signaling with Other Signaling Pathways in Plant Stress Responses and Development. Plants 2019, 8, 592. [Google Scholar] [CrossRef] [PubMed]
- Liang, Q.; Lin, X.; Liu, J.; Feng, Y.; Niu, X.; Wang, C.; Song, K.; Yang, C.; Li, L.; Li, Y. Genome-Wide Identification of MAPKK and MAPKKK Gene Family Members and Transcriptional Profiling Analysis during Bud Dormancy in Pear (Pyrus × bretschneideri). Plants 2022, 11, 1731. [Google Scholar] [CrossRef] [PubMed]









| Primer Name | Primer Sequences (5′-3′) | Use |
|---|---|---|
| PpPOD4-like-F | ATGGCTTCCAGTAATACTTTTTCTTTGT | Clone |
| PpPOD4-like-R | CTAATTAGGCTTCCTGCAGTTCAATCT | Clone |
| NCPpPOD4-like-F | agtggtctctgtccagtcctATGGCTTCCAGTAATACTTTTTCTTTGT | Vector construction |
| NCPpPOD4-like-R | ggtctcagcagaccacaagtCTAATTAGGCTTCCTGCAGTTCAATCT | Vector construction |
| PpActin-F | CCATCCAGGCTGTTCTCTC | qRT-PCR |
| PpActin-R | GCAAGGTCCAGACGAAGG | qRT-PCR |
| PpPOD4-like-qF | CCCACTGCTACCCTCAAC | qRT-PCR |
| PpPOD4-like-qR | CTGCCGCTGTACGATTTA | qRT-PCR |
| PpPOD8-qF | TCACTCGGCTTCACTTCC | qRT-PCR |
| PpPOD8-qR | CGCTGTTGTGCTATCCCT | qRT-PCR |
| PpPOD12-qF | TCAAACCGCCTTTACAAT | qRT-PCR |
| PpPOD12-qR | GGACTTCCCAAACTCGTC | qRT-PCR |
| PpPOD18-qF | CGTGGTGTCATGTGCTGA | qRT-PCR |
| PpPOD18-qR | GTTTAGGTTTCGGGTTGG | qRT-PCR |
| PpPOD24-qF | TTGGTTTGGGAAGAAGAG | qRT-PCR |
| PpPOD24-qR | GCAGCATTGATGGTGGAT | qRT-PCR |
| PpPOD33-qF | GAGACTTGGTTGCCTTATC | qRT-PCR |
| PpPOD33-qR | ATCGCTTGTATTTATCGTG | qRT-PCR |
| PpPOD47-qF | GAGTTGGGAAGATTGGAT | qRT-PCR |
| PpPOD47-qR | ATGTTGATGGCTATGTCG | qRT-PCR |
| Chilling Days | Content of H2O2 | Activity of POD | PpPOD4-like | |
|---|---|---|---|---|
| Content of H2O2 | 0 | 1 | 0.949 | 0.045 * |
| 7 | 1 | 0.019 * | 0.050 * | |
| 14 | 1 | 0.987 | 0.468 | |
| 21 | 1 | 0.889 | 0.883 | |
| 28 | 1 | 0.682 | 0.087 | |
| 35 | 1 | 0.166 | 0.800 | |
| 42 | 1 | 0.576 | 0.682 | |
| 49 | 1 | 0.877 | 0.306 | |
| Activity of POD | 0 | 1 | 0.904 | |
| 7 | 1 | 0.031 * | ||
| 14 | 1 | 0.519 | ||
| 21 | 1 | 0.227 | ||
| 28 | 1 | 0.595 | ||
| 35 | 1 | 0.966 | ||
| 42 | 1 | 0.742 | ||
| 49 | 1 | 0.571 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Xiang, X.; Song, K.; Li, Y.; Zhang, C.; Zhou, R.; Feng, Y.; You, J.; Wu, J.; Zhang, Y.; Jiang, C.; et al. Screening and Expression Analysis of POD Gene in POD-H2O2 Pathway on Bud Dormancy of Pear (Pyrus pyrifolia). Forests 2024, 15, 434. https://doi.org/10.3390/f15030434
Xiang X, Song K, Li Y, Zhang C, Zhou R, Feng Y, You J, Wu J, Zhang Y, Jiang C, et al. Screening and Expression Analysis of POD Gene in POD-H2O2 Pathway on Bud Dormancy of Pear (Pyrus pyrifolia). Forests. 2024; 15(3):434. https://doi.org/10.3390/f15030434
Chicago/Turabian StyleXiang, Xuwen, Keke Song, Yinyin Li, Chenyu Zhang, Ruiqi Zhou, Yu Feng, Jingnan You, Jingdong Wu, Yanhui Zhang, Cuicui Jiang, and et al. 2024. "Screening and Expression Analysis of POD Gene in POD-H2O2 Pathway on Bud Dormancy of Pear (Pyrus pyrifolia)" Forests 15, no. 3: 434. https://doi.org/10.3390/f15030434
APA StyleXiang, X., Song, K., Li, Y., Zhang, C., Zhou, R., Feng, Y., You, J., Wu, J., Zhang, Y., Jiang, C., & Li, Y. (2024). Screening and Expression Analysis of POD Gene in POD-H2O2 Pathway on Bud Dormancy of Pear (Pyrus pyrifolia). Forests, 15(3), 434. https://doi.org/10.3390/f15030434

