Next Article in Journal
Several Strategies for Tree Growths Under Different Abiotic Stresses
Previous Article in Journal
A Novel Workflow for Mapping Forest Canopy Height by Synergizing ICESat-2 and Multi-Sensor Data
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Stable Diversity but Distinct Metabolic Activity of Microbiome of Roots from Adult and Young Chinese Fir Trees

1
College of Forestry, Fujian Agriculture and Forestry University, Fuzhou 350002, China
2
Chinese Fir Engineering Research Center of National Forestry and Grassland Administration, Fuzhou 350002, China
*
Author to whom correspondence should be addressed.
These authors contributed equally to this work.
Forests 2024, 15(12), 2140; https://doi.org/10.3390/f15122140
Submission received: 18 October 2024 / Revised: 22 November 2024 / Accepted: 29 November 2024 / Published: 4 December 2024
(This article belongs to the Section Forest Biodiversity)

Abstract

The tree-associated microbiome is vital for both individual trees and the forest ecosystem. The microbiome is dynamic; however, it is influenced by the developmental stages and environmental stresses experienced by host trees. Chinese fir (Cunninghamia lanceolata) is an economically important tree species in the subtropical regions of China. This study investigated the diversity of microbial communities, including bacteria and fungi, in the roots and bulk soil of young (2 years old) and old (46 years old) Chinese fir. It specifically examined the functional characteristics of these microbial communities. Through a non-metric multidimensional scaling (NMDS) analysis, we examined differences in microbial community structures among root and soil samples of Chinese fir. Evaluations using α-diversity metrics (Chao1, Shannon, Pielou, etc.) confirmed significant differences in diversity and structure between soil and root samples but high similarity between young and old tree samples. A network analysis identified key bacterial and fungal genera, such as Burkholderia and Russula, which play pivotal roles in the microbiome structure. We also demonstrated significant variations in microbial metabolic functions, such as dioxin and benzoic acid degradation metabolic pathways, which might relate to stress alleviation for tree fitness. Additionally, for the detection of endophytic microorganisms in Chinese fir seeds, only small amounts (less than 10%) of fungal endophytes and bare bacterial endophytes were identified. In summary, this study revealed that the stable structure of the rhizosphere microbiome was established in the early stage of tree life in Chinese fir, which mostly originated from surrounding soil rather than seed endophytes. The associated microbial metabolic activity naturally decreased with tree aging, implicating the tree microbial dynamics and the need for the addition of an actively functional synthetic community for tree fitness.

1. Introduction

In the forest ecosystem, interactions between plants and microorganisms play important roles in maintaining forest health, improving forest productivity, and promoting nutrient cycling [1,2]. Microbes colonize different plant organs in various ways to support plant growth, and the interaction between plants and rhizosphere microbial communities will also promote them to cope with various biotic and abiotic stresses and enhance their viability [3]. Rhizosphere microbiota refers to the microorganisms that exist around the roots of plants. Studies have shown that the microorganisms in the rhizosphere community of plants can not only affect the growth of plants by regulating the absorption of nutrients and significantly enhancing disease resistance but also have a far-reaching impact on the biogeochemical cycle of carbon, nitrogen, and other elements [4]. Meanwhile, changes in the content of various elements in the environment will also affect the growth of microorganisms in the soil. For example, with the increase in nitrogen, the diversity of bacteria in the soil of a Chinese fir (Cunninghamia lanceolata) forest will decrease [5]. With the tree growth, root structure and physiological requirements change, and these factors may lead to dynamic changes in the rhizosphere microbial community of plants.
Chinese Fir has a vast planting area and high economic value in East Asia. The growth and health of Chinese fir are facing new challenges by virtue of soil nutrient limitation and climate change. The microbiome is a vital player in multiple processes of trees and forests [6,7,8]. Revealing the microbiome dynamics provides a novel perspective to understand the issues in forestry plantation. Forest succession changed the bacterial community and function dramatically in forestry soil [9]. Studies also showed that different growth stages of plants have a significant impact on the structure and function of their rhizosphere microbial communities. For instance, the complexity and stability of bacterial and fungal community network structures increase with forest age [10]. At the seedling stage, plants often release specific root exudates to attract beneficial microbes that help resist environmental stress and enhance defense mechanisms [11]. As trees mature, the composition of microbiota becomes more and more stable, with increased biomass and metabolic activity and more complex functions [12]. In addition, the microbial community changes of Chinese fir are not only related to forestry and ecology but also closely related to global environmental changes. Global climate change and rapid social development lead to changes in precipitation patterns, temperature, and humidity in a forest environment, and these factors also directly affect the composition and function of rhizosphere microorganisms. For example, drought stress will affect soil microbial respiration and have a negative impact on soil fertility and ecosystem function [13]. For instance, under the condition of reduced precipitation, microbial activities around the rhizosphere of oak trees will be affected due to enhanced soil respiration, thus affecting the soil nutrient cycle [14]. Studying the microbial communities of Chinese fir at different growth stages is crucial to understanding their ecological functions and adaptability. By comparing the microbial diversity and metabolic activity of young and adult trees, we can better understand the physiological needs of plants and the functions of microorganisms at different stages of development, thus providing important reference information for future forest management and plant protection.
Some studies have pointed out that the internal nutrient circulation of Chinese fir plantations with different forest ages is also different. With the increase in forest age, the nutrient absorption and nutrient utilization efficiency have increased [15]. However, the current research on the microbial community of Chinese fir at different growth stages is limited, especially in the difference of microbial diversity between Chinese fir seedlings and adult trees, which needs further exploration. Many other abiotic and biotic factors, such as fertilizer supply, invasive plants, and pathogens, influence the soil- and plant-associated microbiome [6,16,17,18], leading to an adjustment of microbiome structure and functions for plant fitness. The microbial communities in forest soils change with the age of the trees. Studies have shown that as the age of the plantations increases, the soil pH, cation exchange capacity, organic matter, and available phosphorus content significantly decline, while certain nutrients, such as alkaline hydrolyzed nitrogen, show an increase [19]. Microbial diversity responds differently across stands of varying ages, with bacterial communities being more sensitive to age gradients than fungal communities [20]. Furthermore, the physicochemical properties of the soil play a crucial role in shaping the composition and diversity of microbial communities [21]. However, research on how the microbial communities of the important forestry species, especially Chinese fir, change with age remains limited.
The purpose of this study is to analyze the microbial composition of Chinese fir at different ages by high-throughput amplicon sequencing. Chinese fir is an ideal model for this study due to the well-established cultivation system and its significant economic and ecological importance. As a widely planted species in China, Chinese fir is not only a major source of timber but also plays a crucial role in forest ecosystems, contributing to biodiversity and providing a habitat for various organisms. Understanding the microbial community associated with Chinese fir is essential. The microbial composition can influence tree health, growth, and nutrient uptake, which are vital for the productivity of forests. We expected to reveal the influence of age on tree microbiome and to reveal the dynamic changes of microbial community during plant growth. By comparing the rhizosphere microbial communities of Chinese fir seedlings and mature trees, we could better understand the physiological needs of plants at different development stages and the functions of microorganisms and provide important reference information for forest management and plant protection in the future.

2. Material and Methods

2.1. Root and Soil Sample Collection

Samples of young trees (2 years old) and old trees (46 years old) were collected from the field of Xiqin Educational Forest (118.116° N, 26.560° W), Agricultural and Forestry University, Yanping, Fujian, China. Young trees were the natural germinated seedlings of the old tree population. The collection was conducted in July 2022. Samples were harvested in the morning (8–10 a.m., 28–32 °C). Non-rhizosphere soil was collected from 20–40 cm deep from ground level. Roots at the same level of non-rhizosphere soil (bulk soil) were harvested, with large soil particles removed. Three sites (variation reduction for environmental factors) around the tree were set as collection sites, of which the samples were merged as one biological repeat. Each sample type selected contained three biological repeats for sequencing and analysis. Samples were kept in cool boxes with frozen ice bags and processed within 48 h to preserve microbial integrity. Seeds of Chinese fir were surface sterilized by washing five times in sterile water and soaking them well in 0.025% Silwet solution and were placed in a room temperature shaker at 80 rpm for 1 h, followed by a 1 min wash in 75% ethanol; then, they were immediately transferred to 10% (v/v) NaOCl for 5 min and finally washed at least three times in sterile water. Seeds were surface sterilized (1 min 75% ethanol, 5 min 10% NaOCl) before grinding into liquid solution.

2.2. DNA Extraction and 16S rDNA Amplicon Sequencing

The extraction of soil microbial DNA was achieved using the HiPure Soil DNA kit (Magen, Guangzhou, China), whereas the isolation of root microbial DNA was conducted with the HiPure Soil DNA kit (Magen, Guangzhou, China) in strict adherence to the protocols provided by the manufacturer. Briefly, DNA extraction was performed by adding 0.5 g of glass beads to a 2.0 mL centrifuge tube, followed by homogenization of 0.5 g of soil in 0.8 mL buffer SOL. Homogenization was conducted by vortexing at high speed for 5 min, followed by the addition of 80 µL buffer SDS and vortexing for 3 min. The mixture was incubated at 70 °C for 10 min (90 °C for challenging microorganisms) and centrifuged at 13,000× g for 1 min. The supernatant (600 µL) was transferred to a new tube, mixed with 150 µL buffer PS, and vortexed for 15 s. A 300 µL aliquot of the resulting solution was combined with 100 µL Absorber Solution, vortexed for 15 s, and centrifuged at 13,000× g for 5 min. The supernatant was transferred to a new tube, an equal volume of buffer GWP was added, and the mixture was applied to a DNA column in two steps, each centrifuged at 13,000× g for 30 s. The column was washed sequentially with 500 µL buffer DW1 and 600 µL buffer GW2, centrifuging after each step. DNA was eluted with preheated buffer AE and stored at −20 °C. Subsequently, the V5–V7 region (distinguished from plants’ sequences) of the 16S rDNA from the bacterial ribosomal RNA gene was targeted and amplified via polymerase chain reaction (PCR). The thermal cycling conditions set at 95 °C for an initial 5 min, followed by 30 cycles at 95 °C for 1 min, 60 °C for 1 min, and 72 °C for 1 min, culminating in a final extension at 72 °C for 7 min. This amplification process utilized the barcoded primers 799F (AACMGGATTAGATACCCKG) and 1193R (ACGTCATCCCCACCTTCC). For ITS region, barcoded primers ITS1-F (CTTGGTCATTTAGAGGAAGTAA) and ITS2 (GCTGCGTTCTTCATCGATGC) were used for fungal ITS1 region amplification. The cycling conditions were: 95 °C 5 min, 30 cycles of (95 °C for 1 min, 50 °C for 1 min, 72 °C for 1 min), and finally 72 °C for 7 min. Following amplification, the resultant 16S and ITS1 amplicons were recovered from 2% agarose gels and purified with the AxyPrep DNA Gel Extraction Kit (Axygen Biosciences, Union City, CA, USA). Qubit 3.0 was used to quantify the amplified sequences. The concentration of the purified amplicons was determined using the ABI Step One Plus Real-Time PCR System (Life Technologies, Foster City, CA, USA). Finally, the amplicons were consolidated in equimolar concentrations and subjected to paired-end sequencing (PE250) on an Illumina Novaseq 6000 sequencer, following the established protocol. The resultant raw sequence reads were archived in the NCBI Sequence Read Archive (SRA) database under the accession number 16S (SRR30863660-SRR30863671), ITS (SRR30863851-SRR30863862).

2.3. Amplicon Bioinformatics Analysis

Utilizing FASTP version 0.18.0 [22], raw reads containing adaptors or exhibiting poor quality (characterized by >10% unknown nucleotides or <50% of bases with a Q-value surpassing 20) were subjected to filtering. Subsequently, FLASH version 1.2.11 [23] was employed to merge the cleaned paired reads into raw tags, applying a minimum overlap of 10 bp and a mismatch error rate of 2%. Further refinement involved filtering out noisy sequences under specific criteria [24] to procure clean raw tags. These tags were then clustered into Operational Taxonomic Units (OTUs) with a similarity threshold of ≥97% using the UPARSE pipeline version 9.2.64 [25]. Chimeric tags were eliminated using UCHIME [26] to secure effective tags for subsequent analysis. Within each OTU, the most abundant tag sequence served as the representative sequence. Taxonomic annotation of these representative OTU sequences was conducted using a naive Bayesian model implemented in the RDP classifier [27], referencing the SILVA database [28] with a confidence threshold set at 0.8.
The abundance statistics were visualized through the application of Krona v2.6 [29]. A graphical representation of the community composition was generated using the ggplot2 package (version 2.2.1) within the R environment [30]. Rarefaction was performed to ensure that the bacterial and fungal community diversity analysis was not biased by uneven sequencing depth, as detailed in Supplementary Files S1 and S2. The Chao1, ACE, Shannon, and Simpson indices were computed within the QIIME framework [31]. Comparisons of alpha diversity indices across different groups were conducted using Tukey’s Honestly Significant Difference (HSD) test implemented in R, facilitated by the Vegan package (version 2.5.3) [32]. Non-metric multidimensional scaling (NMDS) based on Bray–Curtis distances were produced using the Vegan package (version 2.5.3) in R. The total Operational Taxonomic Units (OTUs) of 16S and ITS amplicon were listed in Supplementary File S3, and the statistics of the tags were detailed in Supplementary File S4. The statistics of multiple taxonomic assignment were listed in Supplementary File S5. The function prediction of ITS amplicon was performed for fungal functional profiles using PICRUSt version 2.1.4 [33]. The microbiome phenotypes of the bacteria, including potential pathogenicity, biofilm formation, and facultative anaerobiosis, were classified utilizing the BugBase database [34] to elucidate their ecological and functional attributes.
Genera with the top 10 high abundance were selected for connection analysis. Pearson correlation index was calculated with psych package (2.4.6.26) [35] in R 4.2.3. The p-values were calculated by Fish-Z transformation. Pairwise correlations with p-value less than 0.05 and absolute correlation value larger than 0.5 were shown. Correlation maps were produced with igraph [36].

3. Results

3.1. Bacterial Diversity and Community Composition in Soil and Roots of Old and Young Trees

To study whether age affects the diversity and structure of a microbiome in forest trees, we collected and analyzed the bacterial microbiome of the bulk soil and root of old and young Chinese fir (Figure 1A). Through a non-metric multidimensional scaling (NMDS) analysis of bacterial β-diversity (Figure 1B; stress value = 0.040), we obtained several intriguing and ecologically meaningful findings. Specifically, the Y-Root (young tree roots) and O-Root (old tree roots) exhibited significant differences in bacterial community diversity. This significant difference indicates that tree age was a crucial factor influencing the structure of rhizosphere bacterial communities. The potential reasons of this difference may include the following factors: First, tree age was closely related to changes in the composition of root exudates [37]. Younger trees and older trees may have secreted different types and quantities of carbon sources and signaling molecules, thereby affecting the colonization and abundance of rhizosphere microorganisms. Additionally, old trees and saplings had distinct nutrient demands and resource allocation strategies during their growth, which may lead to differences in the composition of rhizosphere microbial communities. On the other hand, microbial composition and metabolic activities were significantly influenced by different tree ages. Their structure gradually diversified and became more stable as forests transitioned from young to mature stages [12]. Competitive interactions and microbial dynamics likely exerted different influences on trees of different ages. The rhizosphere of younger trees may host more rapidly growing bacterial genera with strong resource competition abilities, while the rhizosphere of older trees may be dominated by stable, cooperative bacterial genera. This succession of microbial communities reflects the dynamic shaping of microbial niches by tree age.
Despite the significant influence of tree age on rhizosphere bacterial communities, the similarity between the O-Soil and Y-Soil bacterial communities is relatively high. This finding suggests that under specific conditions, external factors such as soil type and climatic conditions may have a more pronounced impact on soil bacterial community structure. When these external factors dominate, the bacterial community composition in soil samples of different tree ages may exhibit high similarity. This could be due to the fact that the Y-Soil and O-Soil are from the same sampling site, sharing similar soil parent material, texture, structure, and climatic characteristics. These similarities enable the soil bacterial community to remain relatively stable in the face of tree age changes, resulting in high community similarity. Furthermore, we speculate that the high similarity in bacterial communities between the Y-Soil and O-Soil may be related to plant interactions. Although the Y-Soil and O-Soil originate from young and old trees, respectively, the underground root network among trees may facilitate the exchange and mixing of soil microbial communities through the sharing of water and nutrients as well as the transfer of root exudates. This exchange and mixing may weaken the influence of tree age on soil bacterial community structure to some extent, leading to high similarity in bacterial communities between the Y-Soil and O-Soil.
The analysis of bacterial relative abundance (Figure 1C) revealed that Serratia was the most abundant genus in the O-Soil samples, whereas Bacillus dominated in the Y-Soil samples. Bacillus is a well-known PGPR (Plant Growth-Promoting Rhizobacterium) capable of producing various plant growth-regulating substances. These include antibiotics, auxins, and siderophores, which have positive effects on plant growth and health. For instance, they can promote root development, improve nutrient absorption efficiency, and enhance plant stress resistance [38]. The dominance of Bacillus may be related to the ability of young tree roots to recruit specific microbial communities.
Additionally, Bacillus, Lysinibacillus, and Burkholderia-Caballeronia-Paraburkholderia exhibited high relative abundances in both soil samples (Y-Soil and O-Soil). When the environment shifted from soil to rhizosphere (i.e., from the Y-Soil to the Y-Root and the O-Soil to the O-Root), we observed a significant increase in the relative abundance of Burkholderia-Caballeronia-Paraburkholderia in both rhizosphere samples, with the highest levels recorded in the Y-Root sample. This may indicate its strong response to the rhizosphere microenvironment and potential plant–microbe interactions. Furthermore, Acidothermus and Acidibacter showed significantly higher relative abundances in the Y-Root compared to other samples.
In this study, 2268 bacterial OTUs and 208 bacterial genera were identified (Figure 2). The Venn diagram analysis of bacterial OTUs revealed an overlap of 877 OTUs between the seedling soil sample Y-Soil (containing 1445 bacterial OTUs) and the adult tree soil sample O-Soil (containing 1449 bacterial OTUs). Furthermore, an overlap of 426 bacterial OTUs was observed between the seedling root sample Y-Root (containing 766 bacterial OTUs) and the adult tree root sample O-Root (containing 710 bacterial OTUs), which accounted for 60% of the bacterial OTUs in the O-Root group. Notably, the number of overlapping bacterial OTUs between the seedling soil sample Y-Soil and the seedling root sample Y-Root reached 595, representing 77.67% of the total bacterial OTUs in the seedling root sample. Similarly, the overlap between the adult tree soil sample O-Soil and the adult tree root sample O-Root was 551, accounting for 77.61% of the total bacterial OTUs in the adult tree root sample.
Through a Venn diagram analysis of bacterial genera (Figure 2), we found a high degree of similarity in species composition at the genus level between the two soil samples. Specifically, the seedling soil sample Y-Soil contained 172 bacterial genera, while the adult tree soil sample O-Soil contained 138 bacterial genera. The analysis revealed an overlap of 125 bacterial genera between the Y-Soil and O-Soil, which represented 90.58% of the total bacterial genera in the O-Soil sample. Similarly, in the comparison of rhizosphere samples, the seedling root sample Y-Root (containing 138 bacterial genera) and the adult tree root sample O-Root (containing 104 bacterial genera) also exhibited a high degree of similarity. The overlap between the Y-Root and O-Root was 92 bacterial genera, accounting for 88.46% of the total bacterial genera in the O-Root sample. However, it was noteworthy that there were still 46 bacterial genera that are unique to the Y-Root sample. Furthermore, there was a significant overlap between the Y-Soil and Y-Root, with a shared 120 bacterial genera, which constitutes 86.96% of the total bacterial genera in the Y-Root sample. Likewise, the overlap between the O-Soil and O-Root was also quite significant, with 92 bacterial genera shared, accounting for 88.46% of the total bacterial genera in the O-Root sample. It was worth mentioning that among the four sample groups studied, 85 bacterial genera were found to be distributed across all samples.
The high level of the overlap between soil samples (Y-Soil and O-Soil) suggested that despite differences in tree age, soil microbial communities may be influenced to some extent by common environmental factors, such as soil chemical properties and climatic conditions. This similarity aided in understanding the stable niches in soil and their tolerance to external changes. Similarly, in comparison to the rhizosphere samples, a high overlap rate was observed between the Y-Root (seedling root sample) and O-Root (adult tree root sample). This indicated that rhizosphere microbial communities may remain relatively stable throughout the tree’s life cycle. This stability might be related to the symbiotic needs of plants at different developmental stages, such as the similarity of root exudates and the maintenance of plant–microbe interactions. However, the presence of 46 bacterial genera uniquely found in the Y-Root samples could reflect the uniqueness of the rhizosphere environment of young trees and their ability to recruit specific microbial groups. The rhizosphere of young trees might provide richer nutrients and a more complex microenvironment, attracting a more diversified colonization of microorganisms. The significant overlap between the Y-Soil and Y-Root as well as between the O-Soil and O-Root further emphasized the close connection between soil and rhizosphere microbial communities. Soil serves as a “source reservoir” for rhizosphere microorganisms, providing abundant microbial resources to the rhizosphere. The rhizosphere, as a “hotspot” for plant–microbe interactions, selectively recruits and enriches specific microorganisms, forming a unique rhizosphere microbial community. The microbial exchange between soil and rhizosphere has significant impacts on plant growth and development, nutrient absorption, and stress adaptation [39]. Among the 85 bacterial genera distributed across all four samples, these widely distributed genera may constitute the “core microbiota” in forest ecosystems. They maintain high abundance and stability across different tree ages and ecological niches, playing a crucial role in maintaining the balance and stability of the entire ecosystem. This core microbiota may participate in key ecological processes such as soil nutrient cycling, organic matter decomposition, and plant health maintenance.
The evaluation using the Sob, Chao1, and Ptree indices (Figure 3A) revealed a consistent decline in bacterial diversity from soil to root surfaces, which might be attributed to the selective recruitment of specific microbial communities by plant roots. Although different soil samples and rhizosphere samples harbor distinct bacterial communities, there were no significant differences in α-diversity between the two soil samples. Similarly, the α-diversity between the two rhizosphere samples also showed no significant differences.
These findings highlighted the dynamic balance of microbial communities, indicating that the presence of core microbiota played a vital role in plant–microbe interactions and ecosystem stability. Understanding these similarities and differences aided in further research on plant health, the functions of forest ecosystems, and management strategies.

3.2. Fungal Diversity and Community Composition in Soil and Roots of Old and Young Trees

The NMDS analysis of fungal β-diversity revealed a significant difference in the fungal community β-diversity between the seedling soil sample Y-Soil and the seedling rhizosphere sample Y-Root, whereas the differences among the other samples were not pronounced (Figure 1B; stress = 0.000). The analysis of fungal relative abundance indicated that the seedling samples (Y-Soil and Y-Root) exhibited higher fungal abundance compared to the adult tree samples (O-Soil and O-Root). In the Y-Soil sample, the relative abundances of Penicillium, Saitozyma, and Russula were notably high; in the O-Soil sample, Saitozyma, Talaromyces, and Mortierella showed higher relative abundances; in the Y-Root sample, Russula, Nidulariopsis, and Pseudoplectania were relatively abundant; and in the O-Root sample, Delicatula demonstrated a clear dominance. Additionally, it was noteworthy that the fungal genus Delicatula had a certain relative abundance in the O-Soil sample but exhibited a marked dominance in the O-Root sample (Figure 1C). It is speculated that Delicatula may have a competitive advantage, inhibiting the growth of other microorganisms or being more adaptable to the rhizosphere environment than others. This competitive advantage may stem from antimicrobial substances or enzymes produced by the fungus, enabling it to gain more space and resources in plant roots. On the other hand, there may be a mutualistic relationship between Delicatula and its host plants. The plants attract and promote the growth of the fungus through root exudates in exchange for growth promotion or protection. This selective effect may inhibit the growth of other fungi, leading to a relative increase in the abundance of Delicatula. However, there is limited research on the ecological role, life habits, and physiological characteristics of the Delicatula genus, especially its potential as an endophyte, which requires further scientific exploration.
This study identified a total of 2234 fungal OTUs and 223 fungal genera (Figure 2). The Venn diagram analysis of fungal OTUs indicated that there were 528 overlapping OTUs between the seedling soil sample Y-Soil (containing 1547 fungal OTUs) and the adult tree soil sample O-Soil (containing 1175 fungal OTUs). Additionally, there were 231 overlapping fungal OTUs between the seedling rhizosphere sample Y-Root (472 fungal OTUs) and the adult tree rhizosphere sample O-Root (539 fungal OTUs). Specifically, there were 345 overlapping fungal OTUs between the Y-Soil (1547 fungal OTUs) and Y-Root (472 fungal OTUs), which accounted for 73.09% of the OTUs in the Y-Root sample. In the case of the O-Soil (1175 fungal OTUs) and O-Root (539 fungal OTUs), there were 425 overlapping fungal OTUs, constituting 78.85% of the OTUs in the O-Root sample.
The Venn diagram analysis of fungal genera further revealed that there were 109 overlapping genera between the Y-Soil sample (186 fungal genera) and the O-Soil sample (134 fungal genera), representing 81.34% of the fungal genera in the O-Soil sample. Moreover, there were 56 overlapping fungal genera between the Y-Root (89 fungal genera) and O-Root (83 fungal genera), which accounted for 67.47% of the fungal genera in the O-Root sample. Furthermore, 76 overlapping fungal genera were observed between the Y-Soil (186 fungal genera) and Y-Root (89 fungal genera), making up 85.39% of the fungal genera in the Y-Root sample. Lastly, there were 73 overlapping fungal genera between the O-Soil (134 fungal genera) and O-Root (83 fungal genera), constituting 87.95% of the fungal genera in the O-Root sample. Additionally, 50 fungal genera overlap among all four samples (Figure 2). The analyses of the Sob, Chao1, and Ptree indices indicated a continuous decline in fungal α-diversity from soil to root surfaces (Figure 3B). According to the Chao1 index, the Y-Soil sample exhibited the highest fungal species richness, followed by the O-Soil sample, while the O-Root sample showed a moderate level of richness, with the Y-Root sample exhibiting the lowest fungal species richness (Figure 3B).
The substantial overlap of OTUs and genera among soil samples and rhizosphere samples constitutes the core fungal communities in these ecosystems. These core fungi may play a crucial role in maintaining the stability of soil and rhizosphere microenvironments. Overlapping fungal OTUs and genera may have similar ecological functions, and this functional redundancy [40] contributes to maintaining ecosystem stability under environmental fluctuations or stress conditions. For example, when a certain fungus is inhibited or disappears, other fungi with similar functions can fill the gap, thereby maintaining the normal operation of the ecosystem. The high overlap ratios (such as 73.09% between the Y-Soil and Y-Root, and 78.85% between the O-Soil and O-Root) indicate that these fungal communities have relatively stable structures. This stability helps the ecosystem maintain the integrity of its structure and function in the face of external disturbances. Overlapping fungal communities may have stronger environmental adaptability, as they can survive and reproduce in different growth stages (seedlings versus adult trees) and different niches (soil versus rhizosphere). This adaptability helps fungal communities maintain their diversity and vitality in the face of environmental changes.

3.3. Microbial Functional Prediction in Soil Roots of Old and Young Trees

Functional difference analysis between the two groups was conducted using Welch’s T-test, with a confidence interval of 95% and a threshold of p-value < 0.05 (Figure 4). A comparison of the functional abundance of microbial communities in the rhizosphere samples of young and adult trees revealed that although the degree of abundance variation among microbes responsible for different community functions varied, the overall microbial functional abundance in the Y-Root group was generally higher than that in the O-Root group. Notably, the function of chloroalkane and chloroalkene degradation exhibited the highest abundance and statistical significance, being significantly greater in the young rhizosphere sample (Y-Root) compared to the adult rhizosphere sample (O-Root). Additionally, other metabolic pathways, including benzoate degradation, chlorocyclohexane, and chlorobenzene degradation and D-arginine and D-ornithine metabolism, also demonstrated an advantage in the Y-Root samples.
This may be related to the secretion characteristics of the root system of young Chinese fir trees. Specifically, the root secretion rate of young Chinese fir trees is relatively fast, releasing more carbohydrates and specific secondary metabolites such as quercetin [37]. These compounds provide abundant carbon sources and energy sources for rhizosphere microorganisms, contributing to the promotion of microbial growth and metabolic activities. As the tree age increases, the composition of root secretions of Chinese fir trees changes. The secretion of carbohydrates may decrease, while the secretion of metabolites such as lipids and salicylic acid may increase [37]. This change may affect the composition and functional activity of the rhizosphere microbial community, resulting in the overall microbial functional abundance of the Y-Root group of young trees being generally higher than that of the O-Root group of adult trees.
The functional abundance analysis of microbial communities comparing the young tree rhizosphere sample (Y-Root) and the young tree soil sample (Y-Soil) indicated that the abundance variations of different metabolic pathways differ based on their ecological niches. With the exception of certain pathways with relatively low abundance, such as tetracycline biosynthesis, the overall functional abundance in the Y-Root was generally higher than that in the Y-Soil. Notably, the function of the biosynthesis of ansamycins exhibited the highest abundance and statistical significance, with levels in the young rhizosphere sample (Y-Root) significantly surpassing those in the young soil sample (Y-Soil). Furthermore, functions such as glutathione metabolism, chloroalkane and chloroalkene degradation, and the metabolism of xenobiotics by cytochrome P450 also demonstrated higher abundances in the Y-Root compared to the Y-Soil.
The functional abundance analysis of microbial communities comparing the adult tree rhizosphere sample (O-Root) and the adult tree soil sample (O-Soil) also indicated that the overall functional abundance in the rhizosphere sample was significantly higher than that in the soil sample. Notably, functions such as benzoate degradation, chlorocyclohexane and chlorobenzene degradation, ascorbate and aldarate metabolism, fluorobenzoate degradation, dioxin degradation, and arachidonic acid metabolism exhibited significantly higher abundances in the O-Root compared to the O-Soil. It is worth noting that arachidonic acid metabolism demonstrated a particularly high abundance in the adult tree rhizosphere sample (O-Root), with a significant difference compared to the adult tree soil sample (O-Soil).
Both the rhizosphere samples from the seedling group and the adult group show a significant increase in overall functional abundance compared to the soil samples. The cause of this phenomenon lies in the abundance of root exudates in rhizosphere samples, which constitute an important nutrient source in the rhizosphere microecosystem. Specifically, root exudates contain various organic substances such as sugars, amino acids, and organic acids. These not only provide abundant carbon sources and energy for the microbial community in the rhizosphere but also promote the growth, reproduction, and metabolic activity of microorganisms [39]. In contrast, soil samples (Y-Soil), lacking these direct nutritional inputs from plant roots, have relatively limited carbon sources and energy available to their microbial communities, thereby restricting the increase in their overall functional abundance to some extent. Therefore, as an active interface for plant–soil–microbe interactions, the rhizosphere has crucial biochemical processes and material transformation capabilities that are essential for enhancing the functional diversity of soil microbial communities.
Through a comparative analysis of the relative abundance of microbial functional traits across four sample groups (Figure 5), we found that the function of aerobic respiration I (cytochrome c) was significantly abundant in all four samples, particularly in the young tree samples (Y-Soil and Y-Root), where its abundance was more pronounced compared to that in the adult tree samples (O-Soil and O-Root). Due to the faster growth rate and more active metabolism of young trees compared to adult trees, they require more energy support. The high abundance of the function of aerobic respiration I (cytochrome c) in young tree samples may reflect the higher energy demand of young trees. This observation is consistent with the ecological perspective that young trees need more energy to support their rapid growth compared to adult trees. Further analysis revealed no significant differences in microbial community functions between the adult tree soil sample (O-Soil) and the adult tree rhizosphere sample (O-Root), with aerobic respiration I (cytochrome c) predominating, followed by fatty acid β-oxidation I. Notably, the relative abundance of fatty acid β-oxidation I in the adult tree group was higher than that in the seedling group. This may be related to the previously mentioned increase in the secretion of metabolites such as lipids and salicylic acid as tree age increases. Fatty acid β-oxidation I is one of the core processes of lipid metabolism in organisms [41]. When organisms need energy or carry out other metabolic activities, these lipids are hydrolyzed into fatty acids and degraded through fatty acid β-oxidation I. In the seedling soil sample (Y-Soil), in addition to aerobic respiration I (cytochrome c), the relative abundances of aromatic biogenic amine degradation (bacteria) and glyoxylate cycle functions were also elevated, with these functions significantly surpassing those in other samples. Regarding the seedling rhizosphere sample (Y-Root), although the abundance of glyoxylate cycle function was lower than that in the seedling soil sample (Y-Soil), it still remained higher than that observed in the adult tree samples.

3.4. Microbial Correlation in Soil and Roots of Old and Young Trees

To delve into the intricate interaction patterns within microbial communities and identify whether different microbial species exhibited tendencies of co-occurrence or mutual exclusion in the same ecological environment, we employed the Spearman correlation analysis method to construct a microbial co-occurrence network map. Through the analysis of the bacterial co-occurrence network map (Figure 6A), we observed that Burkholderia-Caballeronia-Paraburkholderia dominated the network with significant abundance, forming the core component. Notably, Burkholderia-Caballeronia-Paraburkholderia exhibited marked negative correlations with species such as Bacillus, Serratia, Pseudomonas, and Candidatus-Solibacter, with the strongest negative correlation observed with Candidatus-Solibacter, suggesting potential resource competition or niche partitioning among these species. On the other hand, our analysis further uncovered positive correlations between Burkholderia-Caballeronia-Paraburkholderia and genera like Acidibacter, Acidothermus, Bradyrhizobium, and Rhodococcus. These positive correlations indicate that they may share similar niches or engage in mutualistic relationships. Notably, the positive correlations between Bradyrhizobium and Acidibacter as well as between Acidothermus and Rhodococcus were particularly prominent. Additionally, it is worth mentioning that Bacillus, Serratia, and Lysinibacillus exhibited primarily positive correlations only with Candidatus-Solibacter within the network while displaying negative correlations with most other bacterial species in the map. This finding hints at the unique ecological roles and possible adaptation strategies of these species within the community.
The analysis of the fungal co-occurrence network map (Figure 6B) revealed that the Russula genus dominates the community with significantly higher abundance than other species and exhibited a notable positive correlation with Nidulariopsis, suggesting a potential niche sharing of resources or symbiotic relationship between them. In contrast, Russula displayed strong negative correlations with Delicatula and Mortierella, which might reflect resource competition or niche partitioning. The Saitozyma genus, although less abundant than Russula, holds a significant position in the community. Saitozyma demonstrated robust positive correlations with Penicillium, Mortierella, and Trichoderma, indicating potential synergistic effects or shared ecological conditions among them. However, the strong negative correlations with Delicatula, Nidulariopsis, and Pseudoplectania revealed a repulsive or competitive relationship between Saitozyma and these fungi within the community. Notably, the Delicatula genus exhibited a unique pattern in the network map, demonstrating negative correlations with all other fungal species. As mentioned earlier, Delicatula exhibits a significant advantage in the O-Root samples. Therefore, it is speculated that Delicatula may possess some competitive advantage, inhibiting the growth of other microorganisms. This speculation is confirmed by the analysis of the co-occurrence network diagram. Furthermore, the correlation pattern of Nidulariopsis fungi was also noteworthy, as it displayed a strong positive correlation exclusively with Russula while generally exhibiting negative correlations with other fungal species in the network. As mentioned previously, in the Y-Root samples, Russula, Nidulariopsis, and Pseudoplectania are relatively abundant. In particular, Nidulariopsis and Pseudoplectania are not abundant in the Y-Soil but are abundant in the Y-Root samples, leading to the speculation that these two genera of fungi are selectively recruited by the seedling rhizosphere. They establish close symbiotic relationships with the host plants and may positively affect the host plants in various ways. Pseudoplectania has significant antibacterial activity, enhancing plant stress resistance and survival rates by producing antibacterial substances [42]. Nidulariopsis fungi may occupy a dominant position in the network by occupying specific ecological niches or producing antibacterial substances to inhibit the growth and reproduction of other fungi. Currently, there is limited research on Nidulariopsis, and further studies are needed to investigate its specific mechanisms in the future.

3.5. Most of the Chinese Fir Root Bacterial Endophytes Originated from Soil

To investigate the origin of endophytic bacteria in the rhizosphere of Chinese fir, we expanded our research scope to include a comparison between samples and the endomicrobial communities within Chinese fir seeds. Through a detailed exploration of Chinese fir seeds using ITS rRNA gene amplicon sequencing technology (Figure 7A), we identified the presence of a certain number of endophytic fungi. However, under the same detection conditions, utilizing 16S rRNA gene amplicon sequencing technology (Figure 7B), we did not detect significant endogenous bacteria within the Chinese fir seeds. This result implies that the endogenous bacteria in Chinese fir seeds may be extremely scarce, with their numbers potentially falling below the sensitivity threshold of current detection techniques.

4. Discussion

4.1. Similarity and Difference in Microbiome of Young and Old Trees

In this study, we noticed a significant enrichment of Burkholderia-Caballeronia-Paraburkholderia in rhizosphere samples in comparison to soil samples. This enrichment was found in the rhizosphere of both young and old trees, which suggested the active recruitment of potential beneficial microbes by root of Chinese fir. The genera of Burkholderia and Paraburkholderia contain multiple plant beneficial bacterial species and have close relation with plant health status [43,44,45]. These genera include strains with nitrogen-fixing and biocontrol functions that can enhance nutrient uptake efficiency and stress tolerance in host plants. Studies have shown that bacteria of the genus Burkholderia have potential for bioremediation and can colonize contaminated soils [46], further highlighting their importance in maintaining plant health. Soil microbes play a pivotal role in forest ecosystems, extensively participating in various ecological processes such as nutrient cycling, organic matter decomposition, and plant health maintenance [47,48,49]. Specifically, the soil microbiome provides multifaceted ecological services to plants by promoting plant growth, supporting efficient nutrient absorption, and enhancing plant tolerance to abiotic stresses [49]. Meanwhile, the composition and activity of the soil microbiome are also influenced by plant growth conditions and defense mechanisms, indicating a close and complex interplay between the two [47,50,51]. The stability of microbial communities helps plants maintain normal physiological functions under environmental stresses, such as promoting nutrient absorption and improving disease resistance, indicating a close link between stable microbial communities and the healthy growth of Chinese fir. The enrichment status of Burkholderia-Caballeronia-Paraburkholderia was similar in root samples of both young and old trees, highlighting the importance of those microbes for Chinese fir throughout tree life. This phenomenon also provided evidence for the fact that stable bacterial structure was already established in an early stage for Chinese fir.
Chinese fir is one of the important tree species for afforestation in Asia [52,53]. As forest age increases, the growth environment and physicochemical properties of the soil of Chinese fir change, which may affect the composition and activity of soil microbial communities [52]. The stability of microbial communities is one of the important indicators of ecosystem health, as it can signal the capacity of an ecosystem to withstand and recover from environmental stresses [54]. This study investigated the stability of microbial communities after Chinese fir colonization in forests by comparing the α-diversity of microbial communities in the rhizosphere and surrounding soil of Chinese fir trees of different ages. The results showed that there were no significant differences in the α-diversity of bacterial and fungal communities between healthy 46-year-old and 2-year-old Chinese fir trees in both bulk soil and rhizosphere (endosphere and rhizosphere) samples, suggesting that the microbial communities of Chinese fir can remain relatively stable after colonization in forests. It was not surprising to observe the high similarity, both diversity and functional prediction, of the microbiome in bulk soil samples for young and old trees. However, the microbial structure in the rhizosphere of young and old trees was divergent, as evidenced by the β-diversity analysis. This divergence may be related to metabolic demands, changes in microenvironmental conditions, and competitive relationships among microbes resulting from differences in tree age. This study highlights the stability of microbial communities in the rhizosphere of Chinese fir at different forest ages, which is closely related to ecosystem resilience. Stable microbial communities enhance ecosystem resilience, allowing plants to better respond to environmental changes.

4.2. Differences in Bacterial Metabolic Activities of Young and Old Trees

Although no significant α-diversity differences were observed, distinct differences in bacterial metabolic activity were observed. Specifically, the root systems of young Chinese fir exhibited higher metabolic activity than those of mature trees. Furthermore, compared to the surrounding soil, the roots of young Chinese fir also demonstrated higher bacterial metabolic activity. These metabolic functions play an important role in enhancing plant stress resistance. Additionally, studies have shown that Aspergillus flavus strain KRP1 exhibits high tolerance and removal efficiency (up to 98%) under Hg(II) contamination, suggesting that certain rhizosphere fungi in forest soils may have potential bioremediation capabilities and environmental adaptability in heavy metal-polluted environments [55]. For instance, the antimicrobial activities (dioxin degradation, novobiocin biosynthesis, etc.) inhibited significant differences among samples.
The activity of microbial dioxin degradation was divergent in multiple samples in our study. Dioxin is an organic toxin to human, plants, and environment [56,57]. Interestingly, the Burkholderia strain has been shown its ability to effectively degrade dioxins [58], which might be explained by the enrichment of the Burkholderia genus in the root sample than the soil sample in both old trees and young trees. Additionally, young tree root had a higher activity of dioxin degradation than old tree root, suggesting that the microbiome recruited by young tree root was more efficient in stress alleviation for Chinese fir. Aromatic compounds are widely distributed in the environment as pollutants or plant components. Benzoate degradation could be achieved by bacteria such as Pseudomonas and Bacillus species [59,60], which were detected in both soil and root samples. The activity of benzoate degradation has the same pattern with dioxin degradation, which provided evidence for a greater ability in stress tolerance for the host plant. These degradation processes not only mitigate environmental pollution but may also indirectly enhance plant tolerance to stressful environments, thereby increasing the resilience of forest ecosystems. Novobiocin is an antibiotic compound that inhibits Gram-positive bacteria [61]. Novobiocin biosynthesis was significantly more active in young tree root than old tree root, showing a higher antibiotic ability that might result in anti-pathogen or microbial competition outcomes.
This divergence in metabolic activity might closely relate to the following multiple factors. (1) Physiological demand differences are the first; young Chinese fir in rapid growth stages experience a significant increase in demand for nutrients and water [12]. To meet this demand, their rhizosphere bacteria exhibit higher metabolic activity, thereby accelerating the processes of nutrient absorption and conversion. In contrast, the root systems of mature Chinese fir are relatively mature and stable [62], with their growth rates gradually slowing down. At this stage, the metabolic activities of the root systems of mature Chinese fir also decrease accordingly, in order to maintain a stable nutrient absorption and water balance. (2) Differences in root exudates are the second; root exudates are believed as the primary determinant for rhizosphere microbiome [63,64,65]. The root systems of Chinese fir at different ages exhibit significant differences in exudation rates, metabolite composition, and microbial attraction. For example, young Chinese fir have faster root exudation rates and produce more metabolites such as carbohydrates and quercetins [55,59]. This indicates that young Chinese fir adopts a root metabolic strategy to attract microbial groups that enhance nutrient absorption, thereby meeting the demands of rapid growth. Root exudates provide a carbon source for soil microorganisms and play a guiding role in microbial recruitment in the root zone. Additionally, ectomycorrhizal hyphae release oxalic acid and various enzymes into the soil, which help to mobilize inorganic and organic phosphorus, thereby supporting nutrient acquisition by the plant [37,66]. Although the roots of mature Chinese fir also secrete various metabolites, the types and concentrations of these exudates may change as the trees age. Studies have shown that as forest age increases, the carbohydrates secreted by the roots of Chinese fir may decrease, while the contents of metabolites such as lipids and salicylic acid may increase [66]. These changes may be closely related to the growth strategies and defense mechanisms of mature Chinese fir [66]. (3) Soil environmental differences are the third; although no significant differences were observed at the level of α-diversity, subtle changes may exist within the soil environment itself [67]. For instance, the soil surrounding mature Chinese fir may accumulate more organic matter and nutrients due to the accumulation of tree root exudates and litter residues [53], which provide favorable growth conditions for bacteria in the soil and subsequently enhance their metabolic activity. However, it is noteworthy that further in-depth research is required to investigate how these differences in soil environments affect bacterial metabolic activity.

4.3. Seeds Contain Limited Microbial Endophyte of Chinese Fir

In this study, the rhizosphere and soil microbial communities of Chinese fir seeds, seedlings, and adult trees were compared and analyzed. It was found that the microbial communities of Chinese fir roots mainly came from the surrounding soil rather than the microorganisms of Chinese fir seeds themselves. Plants, fungi, and bacteria form a complex, symbiotic community within the soil environment [68]. Previous research indicates that arbuscular mycorrhizal fungi (AMF), which facilitate root–soil interactions, are the most abundant in the rhizosphere soil [69]. These findings enhance our understanding of how plants acquire microbial resources through interactions with their environment.
We observed that the microbial diversity in sterilized Chinese fir seeds was extremely limited, with bacteria barely detected. This finding suggested that the seeds themselves carry limited microbial resources, consistent with earlier studies. For example, previous research showed that endophytic fungi in barley seeds do not play a major role in the overall rhizosphere microbiome, whereas soil microbes significantly influence the rhizosphere microbiome [70]. This underscores the importance of soil as the primary microbial source, and the diversity and function of soil microbes may play a crucial role in the growth of Chinese fir seedlings. Therefore, understanding the structure of soil microbial communities is critical for the future cultivation and forest management of Chinese fir. However, the seed bacteriome in rice has been proposed with microhabitat-dependent dynamics [71] and provides disease resistance [72].
Although the microbial diversity in sterilized Chinese fir seeds was limited, a small number of fungal communities were detected. This phenomenon might be related to the characteristics of endophytic fungi, which are known to help seeds resist pathogens during early plant growth [73]. This characteristic may explain why fungi can maintain their community structure even after sterilization. In addition, studies also highlighted the important role of seed endophytes in providing plant resistance and fitness [71,72,74]. In conclusion, this study emphasized that the stable rhizosphere microbiome of Chinese fir was established at a rather young age (2 years old) in the rhizosphere environment. The multiple metabolic activity of the microbiome, however, decreased from young to old (46 year) trees. Additionally, we concluded that the vertical transmitted microbes from seed to root systems were limited, with much less fungal species and bare bacterial species detected from seeds. Thus, we proposed the crucial role of bulk soil in supplying microbial communities to Chinese fir roots and highlighted the importance of fungi in seeds, especially their survival ability under environmental stress.
Future research should prioritize advancing technological methods [75,76] to deeply explore the diversity, functionality, and ecological adaptability of microorganisms within the Chinese fir ecosystem. Given the current challenges in detecting bacterial endophytes in Chinese fir seeds, efforts can focus on improving DNA extraction and amplicon sequencing techniques. Enhanced detection sensitivity would allow researchers to more comprehensively explore endophyte diversity and ecological roles. This would deepen the understanding of the potential functions and adaptability of bacterial endophytes in Chinese fir seeds. After identifying microbial metabolic potential, studies should integrate metagenomics, transcriptomes, and metabolomics for the experimental validation of key functions. Exploring biochemical pathways involving microorganisms will clarify their relationship with the functions of the Chinese fir ecosystem. This approach will lead to a better understanding of their ecological roles. It is crucial to systematically study the impact of environmental variables like soil type, moisture, and nutrient availability on microbial community structure and function. This can be achieved through controlled experimental design and long-term field observations. Such methods allow for a detailed analysis of the environmental factors driving microbial communities for the utmost purpose to control forestry health with a biocontrol approach [77].

5. Conclusions

This study provides valuable insights into the dynamics of the microbiome associated with Chinese fir at different life stages. It highlights the significant role of microbial communities in tree health and forest ecosystems. Our findings indicate that the rhizosphere microbiome of Chinese fir is established early in the tree’s life. This microbiome is primarily sourced from the surrounding soil rather than from seed endophytes. This suggests that the initial microbial colonization is heavily influenced by environmental factors and soil microbial communities. Despite the similarities in microbial diversity between young (2 years old) and old (46 years old) trees, we observed distinct differences in metabolic activity. Younger trees exhibited higher metabolic functions related to stress alleviation. This enhanced metabolic activity in young trees can be attributed to their physiological demands during rapid growth. Additionally, the composition of root exudates attracts beneficial microbes. In contrast, the metabolic activity of the rhizosphere microbiome decreased with tree aging. This indicates a shift in microbial function and interaction dynamics as the trees mature. Furthermore, our research underscores the limited presence of endophytic bacteria in Chinese fir seeds. Only a small number of fungal endophytes were detected. This finding emphasizes the critical role of the surrounding soil in providing microbial resources that are essential for the growth and health of Chinese fir seedlings.

Supplementary Materials

The following supporting information can be downloaded at https://www.mdpi.com/article/10.3390/f15122140/s1.

Author Contributions

K.W. conceived the study. K.W., Q.W., Z.W. and W.D. collected the samples, performed the experiments, and analyzed the data. Q.W., Z.W., W.D., L.H., Y.L. and K.W. wrote the manuscript. P.W. and X.M. discussed and edited the manuscript. All authors proof read the manuscript. All authors have read and agreed to the published version of the manuscript.

Funding

We acknowledge funding from Cross-Strait Collaborative Innovation Center of Soil and Water Conservation, Fuzhou 350002, China (K80ND8003); the Youth Program of Natural Science of Fujian Province, China (2023J05026 to Wang Kai); Visiting Grant to Haixia Joint Center FAFU (KFXH23016 to Wang Kai); and the 14th Five-Year National Key Research and Development Project, China (2021YFD2201304-05).

Data Availability Statement

Raw reads were deposited into the NCBI Sequence Read Archive (SRA) database with accession numbers (16S amplicon: SRR30863660-SRR30863671) and (ITS amplicon: SRR30863851-SRR30863862).

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Hong, L.; Wang, Q.; Zhang, J.; Chen, X.; Liu, Y.; Asiegbu, F.O.; Wu, P.; Ma, X.; Wang, K. Advances in the beneficial endophytic fungi for the growth and health of woody plants. For. Res. 2024, 4, e028. [Google Scholar] [CrossRef] [PubMed]
  2. Fang, X.; Yang, D.; Deng, L.; Zhang, Y.; Lin, Z.; Zhou, J.; Chen, Z.; Ma, X.; Guo, M.; Lu, Z.; et al. Phosphorus uptake, transport, and signaling in woody and model plants. For. Res. 2024, 4, e017. [Google Scholar] [CrossRef] [PubMed]
  3. Li, J.-H.; Aslam, M.M.; Gao, Y.-Y.; Dai, L.; Hao, G.-F.; Wei, Z.; Chen, M.-X.; Dini-Andreote, F. Microbiome-mediated signal transduction within the plant holobiont. Trends Microbiol. 2023, 31, 616–628. [Google Scholar] [CrossRef] [PubMed]
  4. Ping, X.; Khan, R.A.A.; Chen, S.; Jiao, Y.; Zhuang, X.; Jiang, L.; Song, L.; Yang, Y.; Zhao, J.; Li, Y.; et al. Deciphering the role of rhizosphere microbiota in modulating disease resistance in cabbage varieties. Microbiome 2024, 12, 160. [Google Scholar] [CrossRef]
  5. Wu, J.; Liu, W.; Zhang, W.; Shao, Y.; Duan, H.; Chen, B.; Wei, X.; Fan, H. Long-term nitrogen addition changes soil microbial community and litter decomposition rate in a subtropical forest. Appl. Soil Ecol. 2019, 142, 43–51. [Google Scholar] [CrossRef]
  6. Yu, L.; Zi, H.; Zhu, H.; Liao, Y.; Xu, X.; Li, X. Rhizosphere microbiome of forest trees is connected to their resistance to soil-borne pathogens. Plant Soil 2022, 479, 143–158. [Google Scholar] [CrossRef]
  7. Xie, J.; Ma, Y.; Li, X.; Wu, J.; Martin, F.; Zhang, D. Multifeature analysis of age-related microbiome structures reveals defense mechanisms of Populus tomentosa trees. New Phytol. 2023, 238, 1636–1650. [Google Scholar] [CrossRef]
  8. Terhonen, E.; Blumenstein, K.; Kovalchuk, A.; Asiegbu, F.O. Forest tree microbiomes and associated fungal endophytes: Functional roles and impact on forest health. Forests 2019, 10, 42. [Google Scholar] [CrossRef]
  9. Qu, Z.L.; Liu, B.; Ma, Y.; Xu, J.; Sun, H. The response of the soil bacterial community and function to forest succession caused by forest disease. Funct. Ecol. 2020, 34, 2548–2559. [Google Scholar] [CrossRef]
  10. Chen, Q.; Li, D.; Luo, N.; Yang, J. Differences in Juniperus przewalskii rhizosphere microbiomes across age classes: Community diversity and assembly. Microorganisms 2023, 11, 2094. [Google Scholar] [CrossRef]
  11. Zhalnina, K.; Louie, K.B.; Hao, Z.; Mansoori, N.; da Rocha, U.N.; Shi, S.; Cho, H.; Karaoz, U.; Loqué, D.; Bowen, B.P.; et al. Dynamic root exudate chemistry and microbial substrate preferences drive patterns in rhizosphere microbial community assembly. Nat. Microbiol. 2018, 3, 470–480. [Google Scholar] [CrossRef] [PubMed]
  12. Ma, F.; Liu, Y.; Qi, Y.; Deng, N.; Xiang, H.; Qi, C.; Peng, P.; Jia, L.; Zhang, X. Tree age affects carbon sequestration potential via altering soil bacterial community composition and function. Front. Microbiol. 2024, 15, 1379409. [Google Scholar] [CrossRef] [PubMed]
  13. Amarasinghe, A.; Chen, C.; Van Zwieten, L.; Rashti, M.R. The role of edaphic variables and management practices in regulating soil microbial resilience to drought—A meta-analysis. Sci. Total Environ. 2024, 912, 169544. [Google Scholar] [CrossRef] [PubMed]
  14. Raczka, N.C.; Carrara, J.E.; Brzostek, E.R. Plant-microbial responses to reduced precipitation depend on tree species in a temperate forest. Glob. Chang. Biol. 2022, 28, 5820–5830. [Google Scholar] [CrossRef] [PubMed]
  15. Ma, X.; Heal, K.V.; Liu, A.; Jarvis, P.G. Nutrient cycling and distribution in different-aged plantations of Chinese fir in southern China. For. Ecol. Manag. 2007, 243, 61–74. [Google Scholar] [CrossRef]
  16. Li, S.; Xie, D.; Ge, X.; Dong, W.; Luan, J. Altered diversity and functioning of soil and root-associated microbiomes by an invasive native plant. Plant Soil 2022, 473, 235–249. [Google Scholar] [CrossRef]
  17. Tang, S.; Zhou, J.; Pan, W.; Tang, R.; Ma, Q.; Xu, M.; Qi, T.; Ma, Z.; Fu, H.; Wu, L. Impact of N application rate on tea (Camellia sinensis) growth and soil bacterial and fungi communities. Plant Soil 2022, 475, 343–359. [Google Scholar] [CrossRef]
  18. Mendes, R.; Kruijt, M.; de Bruijn, I.; Dekkers, E.; van der Voort, M.; Schneider, J.H.M.; Piceno, Y.M.; DeSantis, T.Z.; Andersen, G.L.; Bakker, P.A.H.M.; et al. Deciphering the rhizosphere microbiome for disease-suppressive bacteria. Science 2011, 332, 1097–1100. [Google Scholar] [CrossRef]
  19. Zhang, Y.; Zhu, K.; Zhuang, S.; Wang, H.; Cao, J. Soil Nutrient, Enzyme Activity, and Microbial Community Characteristics of E. urophylla × E. grandis Plantations in a Chronosequence. Forests 2024, 15, 688. [Google Scholar] [CrossRef]
  20. Sun, D.; Huang, Y.; Wang, Z.; Tang, X.; Ye, W.; Cao, H.; Shen, H. Soil microbial community structure, function and network along a mangrove forest restoration chronosequence. Sci. Total Environ. 2024, 913, 169704. [Google Scholar] [CrossRef]
  21. Bin, H.; Qing, L.; Shun, Z.; Xiaolong, B.; Wangjun, L.; Yang, C. Dynamic Changes of Soil Microbial Communities During the Afforestation of Pinus Armandii in a Karst Region of Southwest China. Microb. Ecol. 2024, 87, 36. [Google Scholar]
  22. Chen, S.; Zhou, Y.; Chen, Y.; Gu, J. fastp: An ultra-fast all-in-one FASTQ preprocessor. Bioinformatics 2018, 34, i884–i890. [Google Scholar] [CrossRef] [PubMed]
  23. Magoč, T.; Salzberg, S.L. FLASH: Fast length adjustment of short reads to improve genome assemblies. Bioinformatics 2011, 27, 2957–2963. [Google Scholar] [CrossRef] [PubMed]
  24. Bokulich, N.A.; Subramanian, S.; Faith, J.J.; Gevers, D.; Gordon, J.I.; Knight, R.; Mills, D.A.; Caporaso, J.G. Quality-filtering vastly improves diversity estimates from Illumina amplicon sequencing. Nat. Methods 2013, 10, 57–59. [Google Scholar] [CrossRef]
  25. Edgar, R.C. UPARSE: Highly accurate OTU sequences from microbial amplicon reads. Nat. Methods 2013, 10, 996–998. [Google Scholar] [CrossRef]
  26. Edgar, R.C.; Haas, B.J.; Clemente, J.C.; Quince, C.; Knight, R. UCHIME improves sensitivity and speed of chimera detection. Bioinformatics. 2011, 27, 2194–2200. [Google Scholar] [CrossRef]
  27. Wang, Q.; Garrity, G.M.; Tiedje, J.M.; Cole, J.R. Naive Bayesian classifier for rapid assignment of rRNA sequences into the new bacterial taxonomy. Appl. Env. Environ. Microbiol. 2007, 73, 5261–5267. [Google Scholar] [CrossRef]
  28. Quast, C.; Pruesse, E.; Yilmaz, P.; Gerken, J.; Schweer, T.; Yarza, P.; Peplies, J.; Glöckner, F.O. The SILVA ribosomal RNA gene database project: Improved data processing and web-based tools. Nucleic Acids Res. 2012, 41, D590–D596. [Google Scholar] [CrossRef]
  29. Ondov, B.D.; Bergman, N.H.; Phillippy, A.M. Interactive metagenomic visualization in a Web browser. BMC Bioinform. 2011, 12, 385. [Google Scholar] [CrossRef]
  30. Wickham, H. ggplot2. Wiley Interdiscip. Rev. Comput. Stat. 2011, 3, 180–185. [Google Scholar] [CrossRef]
  31. Caporaso, J.G.; Kuczynski, J.; Stombaugh, J.; Bittinger, K.; Bushman, F.D.; Costello, E.K.; Fierer, N.; Gonzalez Peña, A.; Goodrich, J.K.; Gordon, J.I.; et al. QIIME allows analysis of high-throughput community sequencing data. Nat. Methods 2010, 7, 335–336. [Google Scholar] [CrossRef] [PubMed]
  32. Oksanen, J.A.I.; Blanchet, F.G.; Kindt, R.; Legendre, P.; O‘Hara, R.; Simpson, G.; Solymos, P.; Stevens, H.; Wagner, H. (Eds.) Vegan: Community Ecology Package, R Package Version 1.8-52007. Available online: https://cran.r-project.org/web/packages/vegan/vegan.pdf (accessed on 18 October 2024).
  33. Douglas, G.M.; Maffei, V.J.; Zaneveld, J.; Yurgel, S.N.; Brown, J.R.; Taylor, C.M.; Huttenhower, C.; Langille, M.G. PICRUSt2: An improved and customizable approach for metagenome inference. bioRxiv 2020, 672295. [Google Scholar]
  34. Ward, T.; Larson, J.; Meulemans, J.; Hillmann, B.; Lynch, J.; Sidiropoulos, D.; Spear, J.R.; Caporaso, G.; Blekhman, R.; Knight, R.; et al. BugBase predicts organism-level microbiome phenotypes. bioRxiv 2017, 133462. [Google Scholar]
  35. William, R. Psych: Procedures for Psychological, Psychometric, and Personality Research, R package version 2.4.6; Northwestern University: Evanston, IL, USA, 2024. [Google Scholar]
  36. Csardi, G.; Nepusz, T. The Igraph Software Package for Complex Network Research. InterJournal 2005. [Google Scholar]
  37. Chen, M.; Yao, X.; Cheng, H.; Fan, A.; Lin, R.; Wang, X.; Yang, Y.; Chen, G. Changes in Chinese fir plantations root exudation strategies seasonally and as tree age. For. Ecol. Manag. 2023, 545, 121239. [Google Scholar] [CrossRef]
  38. Medeiros, C.A.A.; Bettiol, W. Multifaceted intervention of Bacillus spp. against salinity stress and Fusarium wilt in tomato. J. Appl. Microbiol. 2021, 131, 2387–2401. [Google Scholar] [CrossRef]
  39. Afridi, M.S.; Kumar, A.; Javed, M.A.; Dubey, A.; de Medeiros, F.H.V.; Santoyo, G. Harnessing root exudates for plant microbiome engineering and stress resistance in plants. Microbiol. Res. 2024, 279, 127564. [Google Scholar] [CrossRef]
  40. Durán, P.; Thiergart, T.; Garrido-Oter, R.; Agler, M.; Kemen, E.; Schulze-Lefert, P.; Hacquard, S. Microbial interkingdom interactions in roots promote arabidopsis survival. Cell 2018, 175, 973–983.e914. [Google Scholar] [CrossRef]
  41. Goepfert, S.; Poirier, Y. Beta-oxidation in fatty acid degradation and beyond. Curr. Opin. Plant Biol. 2007, 10, 245–251. [Google Scholar] [CrossRef]
  42. Wan, J.; Li, Y.; Chen, D.; Yu, B.; Zheng, P.; Mao, X.; Yu, J.; He, J. Expression of a tandemly arrayed plectasin gene from pseudoplectania nigrella in pichia pastoris and its antimicrobial activity. J. Microbiol. Biotechnol. 2016, 26, 461–468. [Google Scholar] [CrossRef]
  43. Wang, K.; Wu, Y.; Ye, M.; Yang, Y.; Asiegbu, F.O.; Overmyer, K.; Liu, S.; Cui, F. Comparative genomics reveals potential mechanisms of plant beneficial effects of a novel bamboo-endophytic bacterial isolate Paraburkholderia sacchari Suichang626. Front. Microbiol. 2021, 12, 686998. [Google Scholar] [CrossRef] [PubMed]
  44. Carrión, V.J.; Cordovez, V.; Tyc, O.; Etalo, D.W.; de Bruijn, I.; de Jager, V.C.L.; Medema, M.H.; Eberl, L.; Raaijmakers, J.M. Involvement of Burkholderiaceae and sulfurous volatiles in disease-suppressive soils. ISME J. 2018, 12, 2307–2321. [Google Scholar] [CrossRef] [PubMed]
  45. Prihatna, C.; Pramudito, T.E.; Arifin, A.R.; Nguyen, T.K.N.; Purnamasari, M.I.; Suwanto, A. Antifungal peptides from a Burkholderia strain suppress basal stem rot disease of oil palm. Phytopathology 2021, 112, 238–248. [Google Scholar] [CrossRef]
  46. Lv, J.; Huo, C.; Zhang, J.; Huang, Y.; Su, Y.; Lv, Y.; Xie, X.; Chen, Z. Host genotype and age shape the microbial community in the rhizosphere soils of Camellia forests. Front. Microbiol. 2024, 15, 1440255. [Google Scholar] [CrossRef] [PubMed]
  47. Korenblum, E.; Massalha, H.; Aharoni, A. Plant–microbe interactions in the rhizosphere via a circular metabolic economy. Plant Cell. 2022, 34, 3168–3182. [Google Scholar] [CrossRef]
  48. Compant, S.; Cassan, F.; Kostić, T.; Johnson, L.; Brader, G.; Trognitz, F.; Sessitsch, A. Harnessing the plant microbiome for sustainable crop production. Nat. Rev. Microbiol. 2024, 22, 1–15. [Google Scholar] [CrossRef]
  49. Averill, C.; Anthony, M.A.; Baldrian, P.; Finkbeiner, F.; Hoogen, J.v.D.; Kiers, T.; Kohout, P.; Hirt, E.; Smith, G.R.; Crowther, T.W. Defending Earth’s terrestrial microbiome. Nat. Microbiol. 2022, 7, 1717–1725. [Google Scholar] [CrossRef]
  50. Pan, J.; Dong, Q.; Wen, H.; Liu, Y.; Wang, X.; Liu, Y.; Zhang, X.; Shi, C.; Zhao, D.; Lu, X. Composition and diversity of endophytic rhizosphere microbiota in apple tree with different ages. Mol. Biotechnol. 2024, 66, 2219–2229. [Google Scholar] [CrossRef]
  51. Cordovez, V.; Dini-Andreote, F.; Carrión, V.J.; Raaijmakers, J.M. Ecology and evolution of plant microbiomes. Annu. Rev. Microbiol. 2019, 73, 69–88. [Google Scholar] [CrossRef]
  52. Hu, Y.; Zhang, X.; Chen, H.; Jiang, Y.; Zhang, J. Effects of forest age and season on soil microbial communities in Chinese fir plantations. Microbiol. Spectr. 2024, 12, e0407523. [Google Scholar] [CrossRef]
  53. Liao, Z.; Ye, S.; Wang, S. Soil bacterial community structure as affected by stand age in Chinese fir plantations: Insights at the aggregate scale. Land. Degrad. Dev. 2023, 34, 389–402. [Google Scholar] [CrossRef]
  54. Bhaduri, D.; Sihi, D.; Bhowmik, A.; Verma, B.C.; Munda, S.; Dari, B. A review on effective soil health bio-indicators for ecosystem restoration and sustainability. Front. Microbiol. 2022, 13, 938481. [Google Scholar] [CrossRef] [PubMed]
  55. Kurniati, E.; Arfarita, N.; Imai, T.; Higuchi, T.; Kanno, A.; Yamamoto, K.; Sekine, M. Potential bioremediation of mercury-contaminated substrate using filamentous fungi isolated from forest soil. J. Environ. Sci. 2014, 26, 1223–1231. [Google Scholar] [CrossRef] [PubMed]
  56. Hanano, A.; Almousally, I.; Shaban, M. Phytotoxicity effects and biological responses of Arabidopsis thaliana to 2,3,7,8-tetrachlorinated dibenzo-p-dioxin exposure. Chemosphere 2014, 104, 76–84. [Google Scholar] [CrossRef]
  57. Nhung, N.T.H.; Nguyen, X.T.; Long, V.D.; Wei, Y.; Fujita, T. A review of soil contaminated with dioxins and biodegradation technologies: Current status and future prospects. Toxics 2022, 10, 278. [Google Scholar] [CrossRef] [PubMed]
  58. Nguyen, B.-A.T.; Hsieh, J.-L.; Lo, S.-C.; Wang, S.-Y.; Hung, C.-H.; Huang, E.; Hung, S.-H.; Chin, W.-C.; Huang, C.-C. Biodegradation of dioxins by Burkholderia cenocepacia strain 869T2: Role of 2-haloacid dehalogenase. J. Hazard. Mater. 2021, 401, 123347. [Google Scholar] [CrossRef]
  59. Loh, K.-C.; Chua, S.-S. Ortho pathway of benzoate degradation in Pseudomonas putida: Induction of meta pathway at high substrate concentrations. Enzym. Microb. Technol. 2002, 30, 620–626. [Google Scholar] [CrossRef]
  60. Zaar, A.; Eisenreich, W.; Bacher, A.; Fuchs, G. A novel pathway of aerobic benzoate catabolism in the bacteria Azoarcus evansii and Bacillus stearothermophilus. J. Biol. Chem. 2001, 276, 24997–25004. [Google Scholar] [CrossRef]
  61. May, J.M.; Owens, T.W.; Mandler, M.D.; Simpson, B.W.; Lazarus, M.B.; Sherman, D.J.; Davis, R.M.; Okuda, S.; Massefski, W.; Ruiz, N.; et al. The antibiotic novobiocin binds and activates the atpase that powers lipopolysaccharide transport. J. Am. Chem. Soc. 2017, 139, 17221–17224. [Google Scholar] [CrossRef]
  62. Xiang, W.; Li, L.; Ouyang, S.; Xiao, W.; Zeng, L.; Chen, L.; Lei, P.; Deng, X.; Zeng, Y.; Fang, J.; et al. Effects of stand age on tree biomass partitioning and allometric equations in Chinese fir (Cunninghamia lanceolata) plantations. Eur. J. For. Res. 2021, 140, 317–332. [Google Scholar] [CrossRef]
  63. Jin, X.; Jia, H.; Ran, L.; Wu, F.; Liu, J.; Schlaeppi, K.; Dini-Andreote, F.; Wei, Z.; Zhou, X. Fusaric acid mediates the assembly of disease-suppressive rhizosphere microbiota via induced shifts in plant root exudates. Nat. Commun. 2024, 15, 5125. [Google Scholar] [CrossRef] [PubMed]
  64. Wang, S.; Duan, S.; George, T.S.; Feng, G.; Zhang, L. Adding plant metabolites improve plant phosphorus uptake by altering the rhizosphere bacterial community structure. Plant Soil 2023, 497, 503–522. [Google Scholar] [CrossRef]
  65. Yang, K.; Fu, R.; Feng, H.; Jiang, G.; Finkel, O.; Sun, T.; Liu, M.; Huang, B.; Li, S.; Wang, X.; et al. RIN enhances plant disease resistance via root exudate-mediated assembly of disease-suppressive rhizosphere microbiota. Mol. Plant. 2023, 16, 1379–1395. [Google Scholar] [CrossRef]
  66. Sasse, J.; Martinoia, E.; Northen, T. Feed Your Friends: Do Plant Exudates Shape the Root Microbiome? Trends Plant Sci. 2018, 23, 25–41. [Google Scholar] [CrossRef]
  67. Liao, X.; Chen, Y.; Huang, H.; Zhang, H.; Su, Y.; Zheng, D.; Jin, S. Response of soil microbial community in different forest management stages of Chinese fir plantation. Forests 2024, 15, 1107. [Google Scholar] [CrossRef]
  68. Shinde, S.; Zerbs, S.; Collart, F.R.; Cumming, J.R.; Noirot, P.; Larsen, P.E. Pseudomonas fluorescens increases mycorrhization and modulates expression of antifungal defense response genes in roots of aspen seedlings. BMC Plant Biol. 2019, 19, 4. [Google Scholar] [CrossRef] [PubMed]
  69. Cao, Y.; Li, N.; Lin, J.; Zhang, Y.; Ma, X.; Wu, P. Root system-rhizosphere soil-bulk soil interactions in different Chinese fir clones based on fungi community diversity change. Front. Ecol. Evol. 2022, 10, 1028686. [Google Scholar] [CrossRef]
  70. Bziuk, N.; Maccario, L.; Straube, B.; Wehner, G.; Sørensen, S.J.; Schikora, A.; Smalla, K. The treasure inside barley seeds: Microbial diversity and plant beneficial bacteria. Environ. Microbiome 2021, 16, 20. [Google Scholar] [CrossRef]
  71. Zhang, X.; Ma, Y.-N.; Wang, X.; Liao, K.; He, S.; Zhao, X.; Guo, H.; Zhao, D.; Wei, H.-L. Dynamics of rice microbiomes reveal core vertically transmitted seed endophytes. Microbiome 2022, 10, 216. [Google Scholar] [CrossRef]
  72. Matsumoto, H.; Fan, X.; Wang, Y.; Kusstatscher, P.; Duan, J.; Wu, S.; Chen, S.; Qiao, K.; Wang, Y.; Ma, B.; et al. Bacterial seed endophyte shapes disease resistance in rice. Nat. Plants 2021, 7, 60–72. [Google Scholar] [CrossRef]
  73. Nelson, E.B. The seed microbiome: Origins, interactions, and impacts. Plant Soil 2018, 422, 7–34. [Google Scholar] [CrossRef]
  74. Liu, C.; Jiang, M.; Yuan, M.M.; Wang, E.; Bai, Y.; Crowther, T.W.; Zhou, J.; Ma, Z.; Zhang, L.; Wang, Y.; et al. Root microbiota confers rice resistance to aluminium toxicity and phosphorus deficiency in acidic soils. Nat. Food 2023, 4, 912–924. [Google Scholar] [CrossRef] [PubMed]
  75. Zhang, J.; Liu, Y.-X.; Guo, X.; Qin, Y.; Garrido-Oter, R.; Schulze-Lefert, P.; Bai, Y. High-throughput cultivation and identification of bacteria from the plant root microbiota. Nat. Protoc. 2021, 16, 988–1012. [Google Scholar] [CrossRef] [PubMed]
  76. Wang, X.; Wang, M.; Xie, X.; Guo, S.; Zhou, Y.; Zhang, X.; Yu, N.; Wang, E. An amplification-selection model for quantified rhizosphere microbiota assembly. Sci. Bull. 2020, 65, 2095–9281. [Google Scholar] [CrossRef]
  77. Berg, G.; Köberl, M.; Rybakova, D.; Müller, H.; Grosch, R.; Smalla, K. Plant microbial diversity is suggested as the key to future biocontrol and health trends. FEMS Microbiol. Ecol. 2017, 93, fix050. [Google Scholar] [CrossRef]
Figure 1. Sample collection, NMDS analysis, and relative abundance of bacteriome and mycobiome from below-ground tissues of Chinese fir for young and old trees. (A) Sampling sites for old and young trees. (B) NMDS (non-metric multidimensional scaling) analysis of bacterial and fungal β-diversity of all samples, NMDS stress = 0.077/0.000. (C) Relative abundance of bacterial and fungal genera of all samples from amplicon analysis. O-Soil: Non-rhizosphere soil of old trees. Y-Soil: Non-rhizosphere soil of young trees. Y-Root: Root of young trees. O-Root: Root of old trees.
Figure 1. Sample collection, NMDS analysis, and relative abundance of bacteriome and mycobiome from below-ground tissues of Chinese fir for young and old trees. (A) Sampling sites for old and young trees. (B) NMDS (non-metric multidimensional scaling) analysis of bacterial and fungal β-diversity of all samples, NMDS stress = 0.077/0.000. (C) Relative abundance of bacterial and fungal genera of all samples from amplicon analysis. O-Soil: Non-rhizosphere soil of old trees. Y-Soil: Non-rhizosphere soil of young trees. Y-Root: Root of young trees. O-Root: Root of old trees.
Forests 15 02140 g001
Figure 2. Venn diagrams of OTU and genus grouping of bacterial and fungal biota. O-Soil: Non-rhizosphere soil of old trees. Y-Soil: Non-rhizosphere soil of young trees. Y-Root: Root of young trees. O-Root: Root of old trees.
Figure 2. Venn diagrams of OTU and genus grouping of bacterial and fungal biota. O-Soil: Non-rhizosphere soil of old trees. Y-Soil: Non-rhizosphere soil of young trees. Y-Root: Root of young trees. O-Root: Root of old trees.
Forests 15 02140 g002
Figure 3. The indices of the α-diversity of bacterial and fungal communities in four different groups of samples. Tukey’s Honestly Significant Difference (HSD) test was implemented to calculate the difference among indices. (A) Diversity analysis of bacterial communities in non-rhizosphere soil and root samples, including Y-Soil (non-rhizosphere soil of young trees), O-Soil (non-rhizosphere soil of old trees), Y-Root (root of young trees), and O-Root (root of old trees). (B) Diversity analysis of fungal communities in the same sample groups. O-Soil: Non-rhizosphere soil of old trees. Y-Soil: Non-rhizosphere soil of young trees. Y-Root: Root of young trees. O-Root: Root of old trees. Different letter on top of bars indicate significant difference.
Figure 3. The indices of the α-diversity of bacterial and fungal communities in four different groups of samples. Tukey’s Honestly Significant Difference (HSD) test was implemented to calculate the difference among indices. (A) Diversity analysis of bacterial communities in non-rhizosphere soil and root samples, including Y-Soil (non-rhizosphere soil of young trees), O-Soil (non-rhizosphere soil of old trees), Y-Root (root of young trees), and O-Root (root of old trees). (B) Diversity analysis of fungal communities in the same sample groups. O-Soil: Non-rhizosphere soil of old trees. Y-Soil: Non-rhizosphere soil of young trees. Y-Root: Root of young trees. O-Root: Root of old trees. Different letter on top of bars indicate significant difference.
Forests 15 02140 g003
Figure 4. A pairwise comparison of the metabolic activity of bacterial functions. Function prediction of the ITS amplicon was performed using PICRUSt 2.1.4. Welch’s t-test was applied to the pairwise comparison of metabolic activity from the KEGG database (level 3). Functional predictions of microbial communities based on KEGG pathway analysis. (A) Predicted pathways of bacterial communities in O-Root and Y-Root. (B) Predicted pathways of bacterial communities in Y-Root and Y-Soil. (C) Predicted pathways of bacterial communities in O-Root and O-Soil. The bar plots show the mean abundance of KEGG pathways, while the dot plots show differences in mean abundance with 95% confidence intervals. Pathways with significant differences (p < 0.05) are highlighted. O-Soil: Non-rhizosphere soil of old trees. Y-Soil: Non-rhizosphere soil of young trees. Y-Root: Root of young trees. O-Root: Root of old trees.
Figure 4. A pairwise comparison of the metabolic activity of bacterial functions. Function prediction of the ITS amplicon was performed using PICRUSt 2.1.4. Welch’s t-test was applied to the pairwise comparison of metabolic activity from the KEGG database (level 3). Functional predictions of microbial communities based on KEGG pathway analysis. (A) Predicted pathways of bacterial communities in O-Root and Y-Root. (B) Predicted pathways of bacterial communities in Y-Root and Y-Soil. (C) Predicted pathways of bacterial communities in O-Root and O-Soil. The bar plots show the mean abundance of KEGG pathways, while the dot plots show differences in mean abundance with 95% confidence intervals. Pathways with significant differences (p < 0.05) are highlighted. O-Soil: Non-rhizosphere soil of old trees. Y-Soil: Non-rhizosphere soil of young trees. Y-Root: Root of young trees. O-Root: Root of old trees.
Forests 15 02140 g004
Figure 5. The relative abundance of the predicted functions of fungal communities. Function prediction of the ITS amplicon was performed using PICRUSt 2.1.4, with the top 10 abundance shown. The predicted functions involved aromatic biogenic amine degradation, glyoxylate cycle, GDP-mannose biosynthesis, and tRNA charging among four different group of samples. O-Soil: Non-rhizosphere soil of old trees. Y-Soil: Non-rhizosphere soil of young trees. Y-Root: Root of young trees. O-Root: Root of old trees.
Figure 5. The relative abundance of the predicted functions of fungal communities. Function prediction of the ITS amplicon was performed using PICRUSt 2.1.4, with the top 10 abundance shown. The predicted functions involved aromatic biogenic amine degradation, glyoxylate cycle, GDP-mannose biosynthesis, and tRNA charging among four different group of samples. O-Soil: Non-rhizosphere soil of old trees. Y-Soil: Non-rhizosphere soil of young trees. Y-Root: Root of young trees. O-Root: Root of old trees.
Forests 15 02140 g005
Figure 6. Genus-level abundance correlations of different (A) bacteria and (B) fungi within four different groups of samples. The area of the circular pattern indicates the abundance of the genus in the sample. Red lines indicate positive effects, and blue lines indicate negative effects. Names of the keystone genus were in bold.
Figure 6. Genus-level abundance correlations of different (A) bacteria and (B) fungi within four different groups of samples. The area of the circular pattern indicates the abundance of the genus in the sample. Red lines indicate positive effects, and blue lines indicate negative effects. Names of the keystone genus were in bold.
Forests 15 02140 g006
Figure 7. The number of observed species with the increase in tags of (A) fungi and (B) bacteria in Chinese fir seeds and four below ground groups. O-Soil: Non-rhizosphere soil of old trees. Y-Soil: Non-rhizosphere soil of young trees. Y-Root: Root of young trees. O-Root: Root of old trees. The information of the seed was highlighted in red and thick lines.
Figure 7. The number of observed species with the increase in tags of (A) fungi and (B) bacteria in Chinese fir seeds and four below ground groups. O-Soil: Non-rhizosphere soil of old trees. Y-Soil: Non-rhizosphere soil of young trees. Y-Root: Root of young trees. O-Root: Root of old trees. The information of the seed was highlighted in red and thick lines.
Forests 15 02140 g007
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Wang, Q.; Wang, Z.; Du, W.; Liu, Y.; Hong, L.; Wu, P.; Ma, X.; Wang, K. Stable Diversity but Distinct Metabolic Activity of Microbiome of Roots from Adult and Young Chinese Fir Trees. Forests 2024, 15, 2140. https://doi.org/10.3390/f15122140

AMA Style

Wang Q, Wang Z, Du W, Liu Y, Hong L, Wu P, Ma X, Wang K. Stable Diversity but Distinct Metabolic Activity of Microbiome of Roots from Adult and Young Chinese Fir Trees. Forests. 2024; 15(12):2140. https://doi.org/10.3390/f15122140

Chicago/Turabian Style

Wang, Qingao, Zhanling Wang, Wenjun Du, Yuxin Liu, Liang Hong, Pengfei Wu, Xiangqing Ma, and Kai Wang. 2024. "Stable Diversity but Distinct Metabolic Activity of Microbiome of Roots from Adult and Young Chinese Fir Trees" Forests 15, no. 12: 2140. https://doi.org/10.3390/f15122140

APA Style

Wang, Q., Wang, Z., Du, W., Liu, Y., Hong, L., Wu, P., Ma, X., & Wang, K. (2024). Stable Diversity but Distinct Metabolic Activity of Microbiome of Roots from Adult and Young Chinese Fir Trees. Forests, 15(12), 2140. https://doi.org/10.3390/f15122140

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop