Next Article in Journal
Carbon Sequestration at Different Stages of Succession During Pine (Pinus sylvestris) Afforestation of Abandoned Lands
Next Article in Special Issue
Diagnostic Sensitivity of Phytophthora ×alni from Environmental Samples Using Conventional and Real-Time PCR
Previous Article in Journal
Thicker or Shorter Bark Fragments of Eucalypt Tree Species Make More Densely Packed Fuel Beds, Which Slow Down Fire Spread
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Differential Photosynthetic and Proteomics Responses Between Male and Female Populus deltoides W. Bartram ex Marshall Infected by Alternaria alternata (Fr.) Keissler

1
School of Tropical Agricultural and Forest, Hainan University, Haikou 570228, China
2
Center for Eco-Environment Restoration Engineering of Hainan Province, School of Ecology, Hainan University, Haikou 570228, China
*
Author to whom correspondence should be addressed.
Forests 2024, 15(12), 2093; https://doi.org/10.3390/f15122093
Submission received: 15 October 2024 / Revised: 20 November 2024 / Accepted: 24 November 2024 / Published: 26 November 2024
(This article belongs to the Special Issue Application of Molecular Genetic Tools for Forest Pathology)

Abstract

Alternaria alternata (Fr.) Keissler is a widespread leaf blight pathogen that disrupts many plants; including poplars. Despite its broad impact, the sex-specific responses of male and female plants to this pathogen remain poorly studied. This study investigated sex differences in the morphological; photosynthetic; and proteomic responses between male and female Populus deltoides W. Bartram ex Marshall infected with A. alternata. The results showed that the female plants had a faster onset of infection and more inhibited growth in comparison to males. In terms of photosynthetic parameters, the infected females were more severely affected, with 2 subunits in the photosynthetic electron transport chain expressed at higher levels and 12 subunits expressed at lower levels than in the infected males. Regarding the antioxidant system; the infected female plants exhibited higher reactive oxygen species (ROS) contents but lower antioxidant activities, with significantly lower expressions of 2 superoxide dismutases (SODs); 2 peroxidases (PODs); 2 ascorbate peroxidases (APXs); 2 glutathione peroxidases; and 4 glutathione S-transferases compared to the infected males. In the phenylpropanoid biosynthesis pathway, the expressions of shikimate O-hydroxycinnamoyl transferase and ferulate-5-hydroxylase were upregulated in both male and female plants after infection. However, the expression of shikimate O-hydroxycinnamoyl transferase in female plants was consistently higher, while the expression of caffeic acid 3-O-methyltransferase was lower in females compared to males. These indicate that A. alternata infection induces significant alterations in the photosynthetic capacity; antioxidant system; and phenylpropanoid biosynthetic pathway in both male and female poplars. Moreover, bimodal regulation was observed, with male poplars demonstrating greater stability in both photosynthetic and antioxidant systems.

1. Introduction

There are 15,600 species of dioecious angiosperms distributed across 987 genera and 175 families [1]. In dioecious plants, male and female sex functions are separate at the individual level [2]. The female plant produces only female flowers, exerting the female sexual function, while the male plant produces only male flowers, exerting the male sexual function. Due to dioecy, plants are not only different in the reproductive organs as the primary sexual characteristics but also in the morphological, physiological, and life history traits as secondary sexual characteristics, resulting in sexual dimorphism [3]. When male and female plants are exposed to different environmental conditions, they would develop alternative resource allocation mechanisms as a part of adapting the process to the environment. Especially in the case of scarce resources, there is a clear difference in reproductive investment between the two sexes. The principle of resource allocation shows that when resources are limited, the demands for nutrients from the three aspects of reproduction, growth, and defense are directly competing, and the more nutrients available for one function, the less available for other ones [4].
There are gender differences in plant physiology and biochemistry and strategies for resource allocation among vegetative growth, reproductive growth, and defense responses are also different between female and male plants. Therefore, dioecious plants often exhibit varying responses to the same environmental stress. For instance, studies on natural populations of the dioecious plant Rumex thyrsiflorus have demonstrated a gender-dependent content of certain phenolic compounds, with callus tissue derived from the hypocotyls of female plants exhibiting lower sensitivity to salt stress compared to that of male plants [5]. Male Silene latifolia growing in Cd-contaminated soil suffer greater negative effects in terms of growth and reproductive traits [6]. The infection rate of the symbiotic Arbuscular mycorrhizal (AM) fungi in Hippophae rhamnoides demonstrates a gender-specific response to heavy metal stress. In comparison to the control group, under Pb stress, the infection rate in female plants significantly elevated and exceeded that of male plants. In contrast, under zinc (Zn) stress, the infection rate in female plants significantly declined and was lower than that in male plants [7]. Understanding these gender differences can offer valuable insights for selective cultivation and breeding in various environments. Currently, there is research available on abiotic stress in dioecious plants, but the study of biotic stress is relatively more limited. Furthermore, due to the complexity of sex-specific responses in dioecious plants, a case-by-case analysis is required.
Poplars are common woody plants used in our daily life, containing a variety of compounds, with high economic and ecological values. Because of its dioecious biological characteristics and simple vegetative propagation methods, poplar is often used as a model tree for studying dioecy [8]. Like other trees, poplars face various biotic factors such as the threat of fungi, bacteria, viruses, and pests, resulting in wood quality decline, yield reduction, and even death. Poplar leaf blight, caused by Alternaria alternata (Fr.) Keissler, often affects the leaves and branches of plants. A. alternata, a filamentous Ascomycete, occurs on plants as a pathogen and endophyte and in soil as a saprophyte [9]. Due to its wide distribution and pathogenicity to many hosts, A. alternata is considered to be a worldwide pathogen [10,11]. The spores of A. alternata like humidity and high temperature. The ideal temperature for germination is 26–28 °C, with relative humidity above 90%, a gley period of 2 days, and a pH of 5–6. The disease usually starts from the edge and tip of the leaf, the lesion is mostly prototype, oval, and generally 1–5 mm in diameter. The initial grayish-brown edge turns grayish-white in the later stage, the center of the lesion turns black mold due to conidia and conidia stalk, and then the lesion is connected to a large spot; the disease gradually spreads to the whole plant, and the leaves finally wither and die.
With the development of omics technologies such as the genome and transcriptome, the application of proteome is becoming more extensive. Since proteins are the agents of an organism’s function and are a direct manifestation of the phenotype, this has become one of the most popular research methods [12]. Proteomics can be employed to analyze plant stress responses and to enrich the functions of related proteins. For example, proteomic analysis of poplar with iron deficiency showed that female plants with iron deficiency had greater changes in photosynthesis, carbon (C) and energy metabolism, redox system, and stress response protein, indicating that female plants were more sensitive to iron deficiency [13]. Similarly, the proteins of cell wall synthesis and energy production were reduced in poplar under cold stress [14]. After Botryosphaeria dothidea infects both resistant varieties and susceptible varieties, the induced proteins associated with plant defense are observed, with 22 proteins being highly upregulated in resistant genotypes but down-regulated in susceptible genotypes [15]. Poplar trees inoculated with Phytophthora (P. cactorum and P. plurivora) provide a subset of candidate markers for phytophthora tolerance by influencing some ribosomal proteins, growth hormone metabolizing enzymes, dioxygenase, polyphenol oxidase, trehalose phosphate synthetase, mannose-1-phosphate guanylyl transferase, and rhamnose-biosynthetase [16]. Under drought stress, the adverse effects of female poplar plants were higher than male ones, and the expression of photosynthesis-related proteins, homeostasis, and stress-response-related proteins was linked with sex [17]. By comparing plants with periodic water shortage and plants with acute water shortage, about 8199 proteins were identified to respond to drought stress, and RD26 transcription factor (TFs) was found to be a key and universal drought marker for poplar species, which is regulated at both transcriptional and protein levels [18].
This study used quantitative proteomics to compare female and male Populus deltoides W. Bartram ex Marshall under control (CK) and infected leaf blight conditions, analyzing the differential expression of proteins associated with photosynthesis, antioxidant activity, and phenylpropanoid biosynthesis. The study further explored the molecular regulatory mechanism of P. deltoides in response to biological stress and the response mechanisms of sexual differences between females and males, aiming to provide valuable insights for the selection of gender in poplar varieties suitable for different environmental backgrounds.

2. Materials and Methods

2.1. Plant Materials and Experimental Design

Male and female cuttings of P. deltoides were collected from 25 different trees, including 12 males and 13 females, in a riparian habitat (Qianjiang, 30°09′ N, 121°30′ E) in the Hubei province, China. The cuttings were planted in the Wuhan Botanical Garden, Chinese Academy of Sciences, Wuhan, China. The average annual rainfall and mean annual temperature in the area are 1261 mm and 16.9 °C, respectively. After sprouting and growing for about 2 months, 76 healthy disease- and pest-free cuttings with roughly equivalent crown size and uniform height were selected for the experimental procedure. A. alternata was isolated from diseased P. deltoides plants. Infected plant leaves were collected and surface-disinfected with 70% ethanol. Sections from the diseased lesions were then placed on a PDA medium supplemented with antibiotics and incubated at 25 °C. Dark brown single colonies were selectively picked and transferred to a new PDA medium for purification culture. After approximately 20 days of incubation, conidia were produced. The morphology of the conidia was observed under a microscope, and an ITS sequence analysis was conducted, which identified the fungus as A. alternata. After producing a sufficient number of spores, they were placed in sterile water for elution and then filtered. The spores were collected and kept in a dry atmosphere at 1 °C. Before the plants needed to be inoculated, they were placed in water-agar (0.05 g/L) and the concentration was adjusted to 1 × 105 per mL. The concentration of water agar was set at 0.05 g/L, resulting in a reduction in the solution’s fluidity to facilitate the maximum adhesion of spores to the leaf surface and the 1 × 105 per mL spore concentration is the appropriate level for ensuring plant susceptibility. The experimental layout was completely randomized with two main factors, sex and infected status. Four treatment groups were established and labeled as follows: control females (FC), infected females (FI), control males (MC), and infected males (MI). Each treatment had 36 plants, with 6 replicates and 6 cuttings per replicate to minimize random error. After the cuttings had grown to a height of about 60 cm, suspended A. alternata spores in water-agar were sprayed over the surface of the fourth and fifth fully expanded leaves from the top of the plants, whereas the CK treatment received water-agar. After inoculation, each plant was covered separately with a clean plastic bag to keep it moist for 24 h, and then the plastic bags were removed. All of the plants were watered every day.

2.2. Gas-Exchange Measurements

The gaseous exchange measurements were taken using a LI-COR 6400 (LI-COR, Lincoln, NE, USA) portable photosynthesis system from 8:30 to 11:30 a.m. by using fourth and fifth mature leaves from the top. The parameters recorded included the net photosynthetic rate (A), stomatal conductance (gs), intercellular CO2 concentration (Ci), and vapor pressure deficit (Vpdl) under a light intensity of 1200 μmol m−2 s−1. Instantaneous water use efficiency (WUEi) was calculated as A/E.

2.3. Chlorophyll Fluorescence Measurements

Following the method described by [19,20], a PAM 2100 chlorophyll fluorescence meter (PAM 2100, Walz, Effeltrich, Germany) was used from 8:00 to 10:00 a.m. to measure the non-photochemical quenching coefficient (qN) and photochemical quenching coefficient (qP) following a 30-min dark adaptation and subsequent light pulses.

2.4. Determination of ROS and GSH

A total of 2 g fresh leaf samples were ground with liquid nitrogen and then homogenized in an extraction buffer (40 mL 50 mM sodium phosphate buffer, pH 7.8). Following centrifugation at 12,000 rpm for 30 min at 4 °C, the supernatant was quantified by the [21] method. The supernatant was then used for the determination of reactive oxygen species (ROS) and following antioxidant enzyme activities. The determination of ROS including superoxide anion radical (O2·−), hydrogen peroxide (H2O2), and hydroxyl radical (OH·), was conducted according to the methodologies described [19,20]. The glutathione (GSH) content was measured using the GSH detection kit (A006-1, Jiancheng, Nanjing, China), following the method described by the manufacturer.

2.5. Antioxidant Enzyme Activity

The male and female plant leaves that developed symptoms 5 days post-inoculation with the pathogenic fungus were collected, and the enzyme activities of Superoxide Dismutase (SOD), Peroxidase (POD), and Ascorbate Peroxidase (APX) were measured within the same day [19,20].
The reaction mixture for the SOD assay contained 50 mM Tris–HCl buffer (pH 7.8), 0.1 mM EDTA, and 13.37 mM methionine. To this 5.7 mL of reaction mixture, 0.1 mL of enzyme extract and 200 μL of 0.1 mM riboflavin were added. The mixture was exposed to 4000 Lux fluorescent light for 15 min, after which the absorbance at 560 nm was measured. One enzyme activity unit is defined as the amount of enzyme required to inhibit NBT photoreduction by 50%. SOD Activity (U·g−1·min−1) = (V × 1000)/(B × FW × t), where V is the total volume of the enzyme extract, B is the volume of enzyme solution corresponding to one enzyme activity unit, FW is the fresh weight of the sample, and t is the reaction time.
The reaction mixture for the POD assay comprised 50 mM Tris–HCl (pH 7.0), 0.1 mM EDTA, 10 mM guaiacol, and 5 mM H2O2. Fifty microliters of the extract solution were added to the reaction mixture, totaling 3 mL. The change in absorbance at 470 nm for the brown guaiacol was recorded between 0.5 and 3.5 min. The enzyme activity was quantified as the amount of enzyme required to cause a change in absorbance at 470 nm of 0.01 per minute. POD Activity (U·g−1·min−1) = (∆A470 × V1)/(FW × V2 × 0.01 × t), where ∆A470 is the change in absorbance during the reaction, V1 is the total volume of the enzyme extract, V2 is the volume of enzyme solution used for the assay, t is the reaction time, and FW is the fresh weight of the sample.
The reaction mixture for the APX assay consisted of 50 mM Tris-HCl buffer (pH 7.0), 0.1 mM EDTA, and 0.1 mM H2O2. In a total volume of 2.93 mL of reaction mixture, 50 μL of crude enzyme extract and 20 μL of 30 mM AsA were added. The activity of APX was defined as the amount of enzyme required to decrease the absorbance at 290 nm by 0.01 within 1 min. APX Activity (U·g−1·min−1) = ∆A290 × V1/(0.01 × V2 × t × FW), where ∆A290 is the change in absorbance during the reaction, V1 is the total volume of the enzyme extract, V2 is the volume of enzyme solution used for the assay, t is the reaction time, and FW is the fresh weight of the sample.

2.6. The Isobaric Tags for Relative and Absolute Quantitation (iTRAQ) Proteomics Analysis

Adopting the method described [22], the samples were pulverized into powder using liquid nitrogen and then extracted with a lysis buffer containing 1 mM PMSF and 2 mM EDTA. The addition of 10 mM DTT and 55 mM IAM at final concentrations was used to open disulfide bonds and alkylate to close, followed by ultracentrifugation to obtain the supernatant, which was then mixed with cold acetone to precipitate the proteins. This process was repeated once to obtain the precipitate dissolved in 0.5 M TEAB. The protein concentration was quantified using the [21] method.
From each sample, 100 μg of protein was taken and digested twice with Trypsin at a protein: Trypsin ratio of 2:1 at 37 °C. After drying, the peptides were reconstituted in 0.5 M TEAB. The peptides were labeled according to the instructions for iTRAQ and then mixed and subjected to SCX liquid chromatography separation. The SCX chromatography was performed using an LC-20AB HPLC pump system (Shimadzu, Kyoto, Japan). Peptides were eluted through a SCX column (Phenomenex, Torrance, CA, USA) and then fractionated and vacuum-dried. Each fraction was processed using a C18 capture column before being analyzed by LC-20AD nano HPLC (Shimadzu) and the TripleTOF 5600 system (AB SCIEX, Concord, ON, Canada) for mass spectrometry analysis and data acquisition.

2.7. Protein Identification

The raw MS/MS file data were converted from (*.wiff) to *.mgf format and then the MASCOT search (Matrix Science, London, UK; Version 2.3.02) in poplar database Ptrichocarpa_210 (64059sequences) Alternaria (1349seq) was used (https://phytozome-next.jgi.doe.gov/info/Ptrichocarpa_v3_0 (accessed on 16 June 2015)). Protein quantitation requires that a protein have at least two unique spectra. The quantitative protein ratios were weighted and normalized in Mascot by using the median ratio. For the protein classification, the proteins were statistically analyzed, and the classification requirements of differential expression protein (DEP) were as follows: Fold Change ≥ 1.2, p-value < 0.05 as up-regulated protein, Fold Change ≤ 0.83, p-value < 0.05 as a down-regulated protein.

2.8. Statistic Analysis

The physiological parameters were analyzed for the impact of infection, gender, and the interaction between male and female plants using Two-Way ANOVA (SPSS 16.0.). A p-value < 0.05 was considered statistically significant. The determination of differentially expressed proteins was analyzed using a t-test, and proteins with a p-value < 0.05 and a fold change > 1.2 were considered differentially expressed.

2.9. Bioinformatics Analysis

The Blast2GO program was used to check the non-redundant protein database (NR; NCBI), using the Kyoto Encyclopedia of Genes and Genomes (KEGG) and Gene ontology (GO) for the identification of protein sorting and grouping.

3. Results

3.1. Results of the Poplar Infected by Leaf Blight Disease

Five days after inoculation with A. alternata, the majority of brown lesions could be found on the leaves of both male and female plants (Figure S1). Annual cuttings that had been growing for 2 months showed a higher incidence rate of disease in female plants, and the lesion area on the female leaves was larger than that on the male plants, 5 days after inoculation with the pathogen. The incidence of disease was higher in female plants, and the lesion area of female leaves was also larger compared with males. As the disease progresses, the spots on leaves merge, leading to widespread wilting and necrosis, eventually causing the entire leaf to fall off. Female plants shed the majority of their leaves around 7 days, but males shed for nearly 9 days, indicating a longer course of disease in males. By comparing the infection and disease progression of females and males, it was discovered that females have a lower defense ability to A. alternata than males.

3.2. Gas Exchange Parameters and Chlorophyll Fluorescence Parameters

The gas exchange parameters indicated that A, Vpdl, gs, Ci, and WUEi were significantly influenced by gender and infection status (Figure 1). Among these, A, Vpdl, and WUEi were significantly reduced in both female and male plants after infection, with the reduction being higher in female plants. Similarly, both gs and Ci increased in female and male plants after infection; however, the increase was higher in females compared to male plants. Compared to CK, significant differences in gs and Ci were observed in the diseased female plants, while no significant differences were found in gs and Ci in the diseased male plants. The levels of qP and qN were influenced by gender factors and also by the interaction between gender and infection status. The qP rose after infection in both female and male plants, reaching significance in infected female plants. The qN was increased in female and male plants, but no significant differences were found compared to CK. Overall, the photosynthetic parameters of female plants were more substantially affected.

3.3. The ROS Content and Antioxidant Activities

The common ROS, including hydrogen peroxide, superoxide anion, and hydroxyl radical, were significantly affected by the single factor of infection and were also influenced by the interaction between sex and infection (Table 1). There were no significant differences in hydrogen peroxide and hydroxyl radical contents between CK female and male plants. However, after infection, the contents of hydrogen peroxide and hydroxyl radical significantly increased compared to their CK. The infected females showed a greater magnitude of increase than the infected males. The superoxide anions content was similar between CK female and male plants but increased significantly in females after infection compared to CK females. Overall, the ROS content in female plants significantly increased post-infection, with the magnitude of increase surpassing that observed in males.
The antioxidant activities (POD, SOD, and APX) were significantly influenced by the interaction between gender and disease susceptibility in both female and male plants, with no significant differences observed in the activities of these three enzymes between female and male CK plants (Figure 2). The activities of POD and SOD increased in both infected females and males, with the increase in SOD activity in infected males reaching significance. The APX activity decreased in infected females but significantly increased in infected males. In general, the activities of these three enzymes increased post-infection in both females and males, and the magnitude of the increase was greater in males than in female plants.
The glutathione content was also influenced by both gender and infection factors. There were no significant differences in glutathione content between the CK female and male plants, nor between the infected female and male plants. However, when compared to their respective CK treatments, the glutathione content in both the infected female and male plants was significantly increased, with the infected males exhibiting a higher glutathione content than the infected females.

3.4. Different Protein Expression Patterns of Male and Female Poplar Plants After Leaf Blight Infection

Changes in protein expression between male and female P. deltoides after the infection of different protein groups were labeled with different iTRAQ tags and detected by mass spectrometry. From 27,430 matched spectra, 10,705 peptide segments were analyzed according to the unique peptide spectra information, and 3481 proteins were identified based on the unique peptide (Table 2). The number of DEPs in the CK males and females was the least (130) (Figure 3, Tables S1 and S2), and the number of DEPs in the infected females and males was also less (215) (Tables S3 and S4), indicating that the protein expression patterns between the plants were less different under similar health conditions. There were more DEPs between CK and infected females (255) (Tables S5 and S6) and between CK males and infected males (345) (Tables S7 and S8). These results indicate that a series of regulatory processes occurred in male and female plants after they were infected with the disease, resulting in changes in protein expression.
The abundance of all differentially expressed proteins was made into a heat map (Figure 4). It could be seen from the FC-FI and MC-MI groups that the expression patterns of proteins between the two sexes showed different or the same trend after the plant was infected. The different trend is that the proteins up-regulated in infected females are down-regulated or unchanged in infected males, and the down-regulated proteins in infected females are up-regulated or unchanged in infected males. This part of the proteins indicates the different response patterns of infected females and males. The same trend was observed in both female and male plants, where proteins were upregulated, indicating a common response to pathogens in both sexes. The comparison group of FC-MC and FI-MI also showed that the abundance of protein expressions was different between female and male plants.

3.5. GO Functional Analysis of DEPs

Distinct proteins associated with plant resistance were identified and classified based on their respective GO annotations (Figure 5). The annotations were systematically categorized into three primary groups, including cellular localization, molecular function, and biological process. When comparing CK female to CK male plants, the localization of differentially expressed proteins was mainly observed in chloroplasts and membrane tissues, with biological process differences centered on the pentose phosphate pathway, redox processes, and photosynthesis. This suggested that the functional differences between female and male plants primarily arose from these processes. Upon infection in dioecious Populus plants, the majority of differentially expressed proteins were predominantly localized in chloroplasts and membrane tissues, indicating that these compartments were significantly affected following pathogen attack. These tissues responded robustly, leading to differential protein expression associated with photosynthesis, response to stimulus, defense response, and the oxidation–reduction process in female and male plants. Protein enrichment in molecular functions such as flavonoid 3′,5′-hydroxylase activity, oxidoreductase activity, tetrapyrrole binding, and peroxidase activity were observed in both sexes post-infection.

3.6. KEGG Pathway Analysis of DEPs

Comparing the DEPs between male and female CK, a significant enrichment phenomenon was observed, involving the biosynthesis of secondary metabolites, ribosome, phenylpropanoid biosynthesis, lysine degradation, fatty acid metabolism, glyoxylate and dicarboxylate metabolism, stilbenoid, diarylheptanoid, gingerol biosynthesis, and other metabolic pathways (Figure 6). This indicates that there are gender differences in the physiological metabolism of poplar.
Compared to the response to pathogen infection between female and male plants, both similarities and differences in their reaction to pathogen invasion were found. At post-infection, the differential proteins were enriched in phenylpropanoid biosynthesis, metabolic pathways, biosynthesis of secondary metabolites and alanine, aspartate, glutamate metabolism, and other pathways in both males and females. However, at the same time, the metabolic pathways such as photosynthesis, glyoxylate and dicarboxylate metabolism and glycine, serine, threonine metabolism significantly enriched in male plants after pathogen infection. In contrast, female plants exhibit significant changes in pathways such as glutathione metabolism, cutin, suberine and wax biosynthesis, and carotenoid biosynthesis following pathogen infection. Furthermore, upon comparing male and female plants post-infection with the pathogen, it was observed that differences were not only present in the aforementioned pathways of photosynthesis, phenylpropanoid biosynthesis, and glutathione metabolism, but also in those of isoflavone biosynthesis, α-linolenic acid metabolism, and peroxisome function. The findings indicated that male and female plants employed gender-specific strategies in response to pathogen infection.

3.7. Photosynthesis Exhibits Sexual Dimorphism in the Defense Responses of Male and Female Poplar

The heat map of differentially expressed proteins in photosynthesis indicated that the majority of proteins in the CK male and female plants show no significant differences. In the infected male plants, the abundances of proteins such as A9PE75 (chlorophyll a-b binding protein 3) and A4GYU0 (Photosystem II reaction center protein H) were higher than in the infected female plants (Figure 7, Table S9). After infection, the protein abundances from B9IQM7 (ATP synthase delta chain) to A4GYU0 (photosystem II reaction center protein H) in the female plants showed a decreasing trend, while in the male plants, the differences were not significant. In the infected male plants, A9PJR0 (ATP synthase subunit b) through to A4GYU0 (photosystem II reaction center protein H) showed a significant increase in expression, and the expressions from B9HES1 (photosystem I reaction center subunit N) to B9N576 (chlorophyll a-b binding protein 13) also significantly increased.
The DEPs involved in photosynthesis were aggregated to their corresponding KO nodes (Figure 8 and Figure 9). Nodes containing only upregulated proteins were highlighted in red color, nodes containing only down-regulated proteins were shown as green, and KO nodes containing both upregulated and downregulated proteins were depicted as half red and half green. In the CK female and male plants, only two proteins differed, but among the infected female and male plants, there were eight proteins with differential expression (Figure 8). Among these, PsbH (A4GYU0), PsbO (A9PHA9, A9PHI5), PsbQ (A9PFR3, A9PF82), PetD (B9NJ16), the delta subunit (B9IQM7) of ATP synthase, and the b subunit (A9PJR0, A9PE72, B9HAF4) of ATP synthase were all less abundant in the infected female plants compared to the infected male plants. However, only PsbR (A9PHU8) and Psb27 (A9PK58) were more abundant in the infected female plants than in the infected male plants. In the infected female plants, the expressions of PsbQ (A9PFR3, A9PF82), PetD (B9NJ16), and PetC (B9I6H7) were lower than in the CK female plants, while PsbR (A9PHU8) and PsbH (A4GYU0) were more abundant. After infection, the expressions of PsbC (B9NAT1), PsbP (B9HTN1), and PetH (B9MXF5) decreased in male infected plants, but PsbH (A4GYU0), PsbO (A9PHA9, A9PHI5), PsbQ (A9PFR3, A9PF82), PsaN (B9HES1), and PetD (B9NJ16) all increased compared to the CK male plants. In CK female plants, the abundances of Lhcb4 (B9HHN0, B9HCM1, B9IG87) in the light-harvesting complex were lower than in the CK male plants (Figure 9). After infection, the abundances of Lhca3 (B9N576), Lhcb1 (B9I107, A9PEI5), Lhcb2 (A9PFW7), Lhcb3 (B9N576), and Lhcb5 (A9PGZ3) in the light-harvesting complex were higher in the male plants than in the female plants. Furthermore, after infection, the expression of Lhcb6 in the light-harvesting complex was downregulated in the female plants. In the male plants, following infection, the expressions of Lhca3 (A9PE75), Lhcb1 (B9I107, A9PEI5), Lhcb2 (A9PFW7), Lhcb3 (B9N576), and Lhcb5 (A9PGZ3) were all upregulated. In summary, under CK conditions, there were few differences in the protein subunits of transmembrane proteins involved in photosynthesis between female and male plants. However, after infection, many proteins in the infected female plants showed lower expression abundances compared to the infected male plants.

3.8. ROS and the Antioxidant System Exhibit Sexual Dimorphism in the Defense Responses of Male and Female Poplar

The proteomic analysis identified three DEPs as SOD, six as POD, four as APX, and two as phospholipid hydroperoxide glutathione peroxidase (Figure 10). The expression levels of SOD, APX, phospholipid hydroperoxide glutathione peroxidase, and four PODs were all higher in infected male plants compared to infected female plants. The DEPs of the glutathione metabolism pathway in four comparison groups were plotted in a heatmap, where in the FC-MC group, most of the proteins in the female plants were slightly lower than those in the male plants, but there was no significant difference (Table S10). Similarly, in the FI-MI comparison group, the abundance of most proteins (A9PBD6-B9GWI2) in the male plants was higher than that in the female plants. Comparison between the infected and CK female plants revealed a decrease in the abundance of many proteins (A9PBD6-B9GWI2) in the infected plants, while the expressions of A9PHH6-A9P9R8 showed an up-regulation trend. In the comparison between infected male plants and CK male plants, the expression of proteins in B9HM36-B9PA81 was downregulated, while only one protein in B9H192-A9P9R8 showed a minimal difference, and others were upregulated.
The abundances of 6-phosphogluconate dehydrogenases (EC:1.1.1.44, B9H3V6, B9N1W3) and L-ascorbate peroxidases (EC:1.11.1.11, Q6ZXH7, B9H7G1, B9GU24, B9H192) in the CK female plants were higher than in the CK male plants after summing up the DEPs of glutathione metabolism to the corresponding KO nodes (Figure 11). Moreover, in the infected male plants, the abundances of glutathione peroxidases (EC:1.11.1.9, A9PK73, A9PI44) and L-ascorbate peroxidases (EC:1.11.1.11, Q6ZXH7, B9H7G1, B9GU24, B9H192) were higher than that in the infected female plants. The glutathione peroxidases (EC:1.11.1.9, A9PK73, A9PI44) were upregulated in both female and male plants after infection, while L-ascorbate peroxidases (EC:1.11.1.11, Q6ZXH7, B9H7G1, B9GU24, B9H192) were downregulated. The glutamate–cysteine ligase catalytic subunit (EC:6.3.2.2, B9GWI2) and 6-phosphogluconate dehydrogenases (EC:1.1.1.44, B9H3V6, B9N1W3) in the infected female plants showed a down-regulation trend, and the glutathione reductase (EC:1.8.1.7, A9PHY8) in the infected male plants also showed a down-regulation trend.

3.9. Phenylpropanoid Biosynthesis Plays an Important Role in Plant Defense Response

Significant differences in the phenylpropanoid metabolic pathway were observed between male and female plants prior to infection (Figure 12A). After infection, the protein expression pattern in this pathway underwent substantial changes. Proteins such as cytochrome P450 71A1, flavonoid 3′-monooxygenase, beta-glucosidase 44, and probable cinnamyl alcohol dehydrogenase 6 showed marked increases in both infected male and female plants (Table S11). Conversely, putative beta-glucosidase 9, phenylalanine ammonia-lyase G4, cyanogenic beta-glucosidase, caffeic acid 3-O-methyltransferase 1, peroxidase 52, caffeoyl-CoA O-methyltransferase 2, trans-cinnamate 4-monooxygenase, probable cinnamyl alcohol dehydrogenase, aldehyde dehydrogenase family 2 member C4, peroxidase 4, cinnamoyl-CoA reductase 1, and peroxidase exhibited significant reductions in expression in both infected sexes. The expression of phenylalanine ammonia-lyases was similar between FC-MC and FI-MI, but significantly lower in infected females compared to CK. Peroxidase 3 significantly increased in infected females but decreased in infected males, leading to a significant up-regulation when comparing FI to MI. The abundance of peroxidase 51 increased in infected females and decreased in infected males, reaching a significant level of difference when comparing the two sexes post-infection. These opposite expression patterns indicated that there were inherent differences in the response mechanisms to A. alternata between male and female plants.
An interaction network between the differentially expressed proteins was obtained by searching the STRING database (Figure 12B, Table S12). The core proteins in this network were organized using the Cytoscape application, with these proteins positioned at the center of concentric circles displaying larger areas and deeper colors. Three pivotal proteins are identified, which are F1CYW2 (caffeic acid 3-O-methyltransferase 1), B9ILK3 (aldehyde dehydrogenase family 2 member C4), and B2Z6Q2 (cinnamoyl-CoA reductase 1). However, these three proteins were significantly decreased in infected females and in infected males, which showed that the phenylpropane pathway of poplar was highly affected.
The DEPs were summarized to their corresponding KO nodes (Figure 13). In the FC-MC and FI-MI groups, the abundances of shikimate O-hydroxycinnamoyl transferases (EC: 2.3.1.133, B9GWR1, B9N4F7, B9IDB6) were higher in females, while males showed higher abundances of caffeic acid 3-O-methyltransferases (EC: 2.1.1.68, F1CYW2, B9MTJ6) and caffeoyl-CoA O-methyltransferase (EC: 2.1.1.104, Q8GV07). Following pathogen infection, the expressions of shikimate O-hydroxycinnamoyl transferases (EC: 2.3.1.133, B9GWR1, B9N4F7, B9IDB6) and ferulate-5-hydroxylases (EC: 1.14., B9GW08, B9GW07) were upregulated compared to the respective CK males and females. Similarly, the expressions of phenylalanine ammonia lyases (EC: 4.3.1.24, B2Z6R1, B2Z6R3), cinnamoyl-CoA reductases (EC: 1.2.1.44, B9HNY0, B2Z6Q2), caffeic acid 3-O-methyltransferases (EC: 2.1.1.68, F1CYW2, B9MTJ6), and caffeoyl-CoA O-methyltransferase (EC: 2.1.1.104, Q8GV07) were downregulated in both female and male plants post-infection. The abundance of trans-cinnamate 4-monooxygenase (EC: 1.14.13.11, A9PBZ7) and coniferyl-aldehyde dehydrogenase (EC: 1.2.1.68, B9ILK3) decreased significantly in infected males, and coniferyl-aldehyde dehydrogenase (EC: 1.2.1.68, B9ILK3) decreased in infected females compared to the respective CK.

4. Discussion

4.1. The Photosynthetic System Is More Stable in the Males Compared to the Females After Infection with A. alternata

The key regulatory mechanism in photosynthesis is the proton electrochemical gradient (proton motive force) [23]. This proton motive force is generated by the concentration difference of protons and the electric field resulting from electron transfer, which can drive the ATP synthase in chloroplasts to convert ADP and inorganic phosphate into ATP [24,25]. During photosynthesis, photosystem II (PSII) and photosystem I (PSI) absorb light energy, with photons from sunlight transferring their energy through the electron transport chain to transfer electrons across the thylakoid membrane. Water acts as an electron donor, being oxidized by PSII to produce O2 and 4H+, with electrons being sequentially passed through electron carriers, while creating a transmembrane proton gradient. The electrons transferred to cytochrome b6f can further be passed to PSI, generating reducing power in the form of NADPH and participating in CO2 assimilation, alongside the synthesized ATP, to produce photosynthetic products [26].
PSII is a large membrane protein complex located in the thylakoid of many organisms, consisting of approximately 25–30 subunits [27]. PSII is an enzyme that catalyzes the light-driven oxidation of water to plastoquinone [28,29] and is composed of the light-harvesting complex II (LHCII) along with the PSII core complex. The PSII core complex includes peripheral light-harvesting (antenna) pigment-protein complexes (such as CP43 and CP47), the reaction center pigment-protein complex (PSII-RC), and manganese clusters, as well as peripheral proteins like 33 kDa and 17 kDa, primarily responsible for the splitting of water into oxygen, protons, and electrons [30].
The accumulation of ROS within the chloroplasts significantly inhibits the D1 protein encoded by PsbA, thereby disrupting the functionality of PSII. The function of the PsbR protein is not yet fully understood; however, it is known to optimize electron transfer and water oxidation, which may enhance oxygen evolution and repair the PSII system [31]. The release of PsbO from the PSII core may facilitate the degradation of photodamaged D1 protein, thereby playing a crucial role in the PSII repair process [32]. PsbQ is the most variable exogenous protein in higher plant PSII and is a target of various stresses; the intact PsbQ protein plays a crucial role in maintaining photosynthesis, and its removal slows down the electron transfer from QA to QB [33]. Supplementing with low concentrations of selenium upregulates essential genes such as PsbQ, PsbO, PsaG, and PetH, boosting the energy metabolism in photosystem I and II of rice seedlings. Simultaneously, the increased expression of the LHCA and LHCB families, along with C4H1, PRX, and atp6 genes, enhances the plant’s ability to capture photons and bind heavy metal ions, mitigating the toxic impact of cadmium stress on the seedlings [34]. Cold stress has been shown to elevate ROS production, damaging the photosystems, yet overexpressing the tomato LHC protein gene (LeLhcb2) in transgenic tobacco plants can confer improved cold tolerance [35].
When comparing the CK female and CK male plants, there was no significant difference found between the female and male plants, except that the expression of PetD subunit in the cytochrome b6f complex of the CK female plants was higher than that of the male plants. However, after the infection, the PetD of the female plants decreased, while that of the male plants increased, and the PetD of the infected male plants was significantly higher than that of the female plants. The expressions of three subunits were down-regulated (PsbQ, PetD, PetC) and two subunits were up-regulated (PsbR, PsaH) after female infection. In contrast, three subunits were down-regulated (PsbC, PsbP, PetH) and five subunits were up-regulated (PsbH, PsbO, PsbQ, PsaN, PetH) after male infection. The results indicated that the photosynthesis of females and males affected by the regulation of stress response was inconsistent. The abundances of PsbH, PsbO, PsbQ, PetD, delta, and b subunits in infected males were higher than that of infected female plants, and only two subunits were lower than that of infected female plants, which indicated that the photosynthetic apparatuses of infected male plants were more stable and photosynthetic efficiency was higher than that of infected female plants.
The comparison of the light-trapping complex showed that there was no significant difference between CK males and CK females except Lhcb4. After female plants were infected, only Lhcb6 showed down-regulated expression, and there were no changes in other subunits. However, the expressions of Lhca3, Lhcb1, Lhcb2, Lhcb3, and Lhcb5 subunits were upregulated in the infected male plants, and the abundances of Lhca4, Lhcb1, Lhcb2, Lhcb3, Lhcb4 and Lhcb6 in the light-trapping complex of the infected male plants were higher than that of the infected female plants, indicating that the light-trapping system of the male plants was more active in response to pathogen infection.
The measured photosynthetic parameters were also consistent with the aforementioned proteomic analysis findings. Compared to the male infected plants, the female plants exhibited a greater decrease in leaf A, Vpdl, and WUEi, as well as a greater increase in gs and Ci. These phenomena suggested that the photosynthetic function of female plants was more severely affected by the pathogen, which was consistent with the findings of [36] in their study on Populus cathayana infected with poplar leaf rust. The changes in chlorophyll fluorescence parameters reflected the degree of impact on the plant’s photosystem II [37]. The qN represents a mechanism by which excess light energy absorbed by LHCII is dissipated as heat to mitigate damage [38,39]. The qP reflects the ability of the PSII antenna system to capture light energy and effectively transfer it to the reaction center [40,41]. After infection, female plants showed a decrease in qN and an increase in qP, whereas male plants experienced increases in both qN and qP, which may reflect different regulatory strategies between female and male plants.

4.2. The Antioxidant System Is More Stable in the Males Compared to the Females After Infection with A. alternata

In the process of the co-evolution of plants and pathogens, plants have evolved specialized immune systems to invade disease-resistant agents, and ROS are important parts of plant immune response to pathogens [42]. The ROS, including superoxide radicals, hydrogen peroxide, and hydroxyl radicals, are molecules produced during normal cellular metabolism and are rapidly metabolized in vivo through antioxidant enzymes and non-enzymatic pathways such as antioxidant vitamins, proteins, and non-protein thiols [43]. When plants respond to stress, ROS will burst out in large quantities, and the accumulation of ROS in a short time will activate the plant defense response [44]. If these ROS cannot be effectively metabolized, they will rapidly oxidize and destroy cell macromolecules such as cell membranes, proteins, and DNA, resulting in the destruction of cell function and death [45]. To prevent these potentially damaging effects, cells possess a variety of antioxidant enzymes, such as superoxide dismutase (which reduces O2·− to H2O2), catalase, and glutathione peroxidase (which reduces H2O2 to H2O) [46]. In this study, the levels of hydrogen peroxide, superoxide anion, and hydroxyl radical increased in both female and male plants following infection, with a greater increase observed in the female plants, indicating that the females had more severe oxidative damage. Three out of three SODs, four out of six PODs, three out of four APXs, and two out of two phospholipid hydroperoxide glutathione peroxidases were identified to have lower expressions in infected females compared to the infected males, with two SODs, two PODs, two APXs, and two phospholipid hydroperoxide glutathione peroxidases reaching significant levels. At the same time, the activities of POD and SOD increased in both male and female plants infected by the pathogen. However, while APX activity significantly increased in male plants, it decreased in female plants. The expression levels of POD, SOD, and APX activities in infected male plants were found to be higher than those in infected female plants, suggesting that the antioxidant enzymatic systems in male plants are more effective in clearing ROS.
Glutathione is a tripeptide composed of glutamate, cysteine, and glycine. It plays a crucial role in antioxidant defense within cells, binding to various electrophilic substances to generate oxidized glutathione [47]. This oxidized form is then converted back to reduced glutathione by glutathione reductase, thereby maintaining the cellular glutathione levels and protecting cells from oxidative stress [48]. The expression of glutathione reductase significantly decreased in both female and male plants after infection, with a lower expression in the infected female plants compared to the infected male plants, suggesting that the protein is more susceptible to pathogen impact and that female plants are more sensitive to biotic stress. Glutathione levels significantly increased after infection, while glutathione reductase levels significantly decreased, suggesting that glutathione reductase may have been over-consumed. Glutathione S-transferase (GST) transfers the thiol group of glutathione to ROS or other electrophilic substances, forming glutathione conjugates, which can then be cleared through other cellular mechanisms [49]. GSTs have been indicated to be essential for disease resistance by regulating ROS homeostasis. For example, a genome-wide association study identified the GaGSTF9 gene in Chinese Gossypium arboreum as a positive key regulator of resistance against Verticillium dahlia infection [50]. Transgenic Arabidopsis thaliana plants overexpressing GaGSTF9 showed significantly lower H2O2 levels than wild-type plants [49]. Among the identified 12 GSTs, the expression levels of 5 GST showed significant differences between infected female and male plants, with 4 GST being significantly lower and 1 GST significantly higher in the infected females compared to the infected males. All this evidence indicated that the overall antioxidant mechanism in the male plants was more effective than those in female plants in response to A. alternata.

4.3. Phenylpropanoid Biosynthesis in Poplar Exhibits Sexual Dimorphism After Infection with A. alternata

Extensive research has demonstrated that the phenylpropanoid pathway can be activated under elicitor stress and plays a role in stress responses. The phenylpropanoid metabolic pathway of plants is important for the production of secondary metabolic substances in plants [51]. The metabolic pathway of phenylpropane is mainly from shikimic acid (SA) via phenylalanine ammonia-lyase (PAL), trans-cinnamic acid 4-monooxygenase (C4H), and 4-coumarate: CoA ligase (4CL) to produce p-coumaryl-CoA, and then to lignin and flavonoids [52]. PAL, as a key enzyme in this pathway, has been widely studied [53]. When the plant is attacked by pathogens, PAL activity increases dramatically in the early stage and decreases in the later stage. Based on this characteristic, PAL can be regarded as a marker of plant disease resistance [54,55]. In the present study, PAL protein abundance decreased in both infected female and male plants, and C4H also decreased after the plants were infected, indicating that the infection of the disease had entered the late stage. The shikimate O-hydroxycinnamoyl transferase is considered a key factor controlling the metabolic trend of downstream phenolic compounds. It belongs to the BAHD family of acyltransferases and is involved in the production of lignin under the catalytic reactions of cinnamoyl-CoA reductase (CCR) and cinnamyl-alcohol dehydrogenase (CAD) [56].
Hyperoxia stress can positively regulate the activity and genes of ROS metabolic modification enzymes and activate the phenylpropanoid pathway, thereby inducing stress resistance to maintain the storage quality of mushrooms [57]. Under the influence of the plant growth regulator 6-BA, the activation of phenylpropanoid pathway enzymes PAL and 4CL, as well as the increase in transcription levels of TaPAL and Ta4CL, reduces the negative impact of flooding stress on yield [58]. Another growth regulator (B2) activates drought-responsive transcription factors (AP2/ERF-ERF, WRKY, and mTERF), resulting in significant upregulation of genes related to phenylpropanoid biosynthesis, including shikimate O-hydroxycinnamoyl transferase (HCT) genes, POD genes, and caffeic acid 3-O-methyltransferase (COMT) genes, which collectively enhance drought resistance [59]. Additionally, the cytochrome P450-dependent monooxygenase ferulic acid 5-hydroxylase (F5H) is a crucial enzyme in the phenylpropanoid pathway, responsible for hydroxylating the G-lignin monomer precursor to synthesize S-lignin monomers. Studies in Arabidopsis have revealed that enhanced expression of FAH1 can induce higher F5H activity and subsequent sinapate accumulation, which can reduce the penetration of ultraviolet radiation into photosynthetic tissues [60].
In the present study, in both CK and infected treatments, the abundance of shikimate O-hydroxycinnamoyl transferase was higher in females than in males, whereas the abundance of caffeic acid 3-O-methyltransferase was lower in females compared to males. These results indicated that there were high differences in the phenylpropane pathway between males and females. After infection, the levels of the shikimate O-hydroxycinnamoyl transferase and ferulate-5-hydroxylase were risen in both male and female plants. This increase illustrated that these two enzymes played important roles in plant resistance to pathogens, particularly in the later stages of infection.

5. Conclusions

Alternaria alternata negatively affected both male and female Populus plants. However, the female plants exhibited a lower response to the infection compared to the male plants. The gas exchange parameters of male and female Populus species significantly changed following infection, with distinct gender differences observed in the chlorophyll fluorescence parameters (qN and qP). The expressions of numerous protein subunits (PsbH, PsbO, PsbQ, PetD, delta and b subunits, Lhca4, Lhcb1, Lhcb2, Lhcb3, Lhcb4, and Lhcb6) were markedly lower in the infected female plants compared to the infected male plants. Furthermore, the infected female plants exhibited higher levels of ROS content and weaker antioxidant activity than the infected male plants. The protein identification revealed that the expressions of 2 SODs, 2 PODs, 2 phospholipid hydroperoxide glutathione peroxidases, and 2 APXs were lower in the infected females than in the infected males under leaf blight pathogens. In the phenylpropanoid biosynthesis pathway, the expressions of shikimate O-hydroxycinnamoyl transferase and ferulate-5-hydroxylase were upregulated in both male and female plants after infection. In addition, the expression of shikimate O-hydroxycinnamoyl transferase in females was consistently higher than in males, while the expression of caffeic acid 3-O-methyltransferase was lower in females compared to males. The results of physiological and proteomic analysis showed that there was the same regulation process between male and female plants in response to leaf blight pathogens, and there was also complex dimorphic regulation. Overall, the male plants showed higher tolerance to leaf blight pathogens, with a more stable photosynthetic and antioxidant system compared to the female plants.

Supplementary Materials

The following supporting information can be downloaded at: www.mdpi.com/article/10.3390/f15122093/s1, Table S1. Proteins that exhibit significantly down-regulated expression in the FC-FI comparison group. (Fold change ≤ 0.83, p-value < 0.05). Table S2. Proteins that exhibit significantly up-regulated expression in the FC-FI comparison group. (Fold change ≥ 1.2, p-value < 0.05). Table S3. Proteins that exhibit significantly down-regulated in the MC-MI comparison group. (Fold change ≤ 0.83, p-value < 0.05). Table S4. Proteins that exhibit significantly up-regulated in the MC-MI comparison group. (Fold change ≥ 1.2, p-value < 0.05). Table S5. Proteins that exhibit significantly down-regulated in the FC-MC comparison group. (Fold change ≤ 0.83, p-value < 0.05). Table S6. Proteins that exhibit significantly up-regulated in the FC-MC comparison group. (Fold change ≥ 1.2, p-value < 0.05). Table S7. Proteins that exhibit significantly down-regulated in the FI-MI comparison group. (Fold change ≤ 0.83, p-value < 0.05). Table S8. Proteins that exhibit significantly up-regulated in the FI-MI comparison group. (Fold change ≥ 1.2, p-value < 0.05). Table S9. The DEPs function as photosynthesis in the infected poplars with A. alternata. Table S10. The DEPs function as antioxidant system in the infected poplars with A. alternata. Table S11. The DEPs function as phenylpropanoid biosynthesis in the infected poplars with A. alternata. Table S12. The interaction network of DEPs in the phenylpropanoid pathway. Figure S1. The symptoms of infected male and female P. deltoides after 5 days of inoculation with A. a alternata. (A): Infected male plants; (B): Infected female plants. These figures show the condition of a one-year-old cutting that has grown for two months and has been inoculated with the pathogen for 5 days. Figure S2. A. alternata ITS sequence amplification plot and sequence alignment result graph. ITS sequences: (ITS1 primer)5’-TCCTCCGCTTATTGATATGCTTAAGTTCAGCGGGTATCCCTACCTGATCCGAGGTCAAAAGTTGAAAAAAAGGCTTAATGGATGCTAGACCTTTGCTGATAGAGAGTGCGACTTGTGCTGCGCTCCGAAACCAGTAGGCCGGCTGCCAATTACTTTAAGGCGAGTCTCCAGCAAAGCTAGAGACAAGACGCCCAACACCAAGCAAAGCTTGAGGGTACAAATGACGCTCGAACAGGCATGCCCTTTGGAATACCAAAGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACACTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCCAGAACCAAGAGATCCGTTGTTGAAAGTTGTAATTATTAATTTGTTACTGACGCTGATTGCAATTACAAAAGGTTTATGTTTGTCCTAGTGGTGGGCGAACCCACCAAGGAAACAAGAAGTACGCAAAAGACAAGGGTGAATAATTCAGCAAGGCTGTAACCCCGAGAGGTTCCAGCCCGCCTTCATATTTGTGTAATGATCCCTCCGCAGGTTCACCTACGGA-3’(ITS4 primer).

Author Contributions

H.T. analyzed the data and wrote the draft manuscript, and Y.K. revised the draft manuscript. L.M. and F.Y. designed and experimented, provided funding, and revised the final manuscript. All authors have read and agreed to the published version of the manuscript.

Funding

The experiments were financially supported by the National Science Foundation of China (No. 32460255 and 31270449).

Data Availability Statement

Data are contained within the article and Supplementary Materials.

Conflicts of Interest

We declare that we have no financial and personal relationships with other people or organizations that can inappropriately influence our work.

References

  1. Renner, S.S. The relative and absolute frequencies of angiosperm sexual systems: Dioecy, monoecy, gynodioecy, and an updated online database. Am. J. Bot. 2014, 101, 1588–1596. [Google Scholar] [PubMed]
  2. Käfer, J.; Marais, G.A.B.; Pannell, J.R. On the rarity of dioecy in flowering plants. Mol. Ecol. 2017, 26, 1225–1241. [Google Scholar] [PubMed]
  3. Liu, M.; Korpelainen, H.; Li, C. Sexual differences and sex ratios of dioecious plants under stressful environments. J. Plant Ecol. 2021, 14, 920–933. [Google Scholar]
  4. Huot, B.; Yao, J.; Montgomery, B.L.; He, S.Y. Growth–defense tradeoffs in plants: A balancing act to optimize fitness. Mol. Plant 2014, 7, 1267–1287. [Google Scholar]
  5. Gozdur, K.; Szopa, A.; Ślesak, H. Effect of salt stress on growth and phenolic compounds production in callus suspension culture of the dioecious species thyrse sorrel (Rumex thyrsiflorus Fingerh.). Plant Cell Tissue Organ Cult. 2024, 158, 54. [Google Scholar]
  6. Vilas, J.S.; Campoy, J.; Retuerto, R. Sex and heavy metals: Study of sexual dimorphism in response to soil pollution. Environ. Exp. Bot. 2016, 126, 68–75. [Google Scholar]
  7. Fang, L.; Zeng, Z.; Jia, Q.; Lin, Y.; Chen, H.; He, Y.; Chen, J. Physiological response and phytoremediation potential of dioecious Hippophae rhamnoides inoculated with Arbuscular mycorrhizal fungi to Pb and Zn pollution. Front. Plant Sci. 2024, 14, 1321885. [Google Scholar]
  8. Douglas, C.J. Populus as a Model Tree. In Comparative and Evolutionary Genomics of Angiosperm Trees; Springer: Cham, Switzerland, 2017; Volume 21, pp. 61–84. [Google Scholar]
  9. Thomma, B.P.H.J. Alternaria spp.: From general saprophyte to specific parasite. Mol. Plant Pathol. 2003, 4, 225–236. [Google Scholar] [CrossRef]
  10. Woudenberg, J.H.C.; Seidl, M.F.; Groenewald, J.Z.; De Vries, M.; Stielow, J.B.; Thomma, B.P.H.J.; Crous, P.W. Alternaria section Alternaria: Species, formae speciales or pathotypes? Stud. Mycol. 2015, 82, 1–21. [Google Scholar] [CrossRef]
  11. El Gobashy, S.F.; Mikhail, W.Z.A.; Ismail, A.M.; Zekry, A.; Moretti, A.; Susca, A.; Soliman, A.S. Phylogenetic, toxigenic and virulence profiles of Alternaria species causing leaf blight of tomato in Egypt. Mycol. Prog. 2018, 17, 1269–1282. [Google Scholar] [CrossRef]
  12. Jarosz, D.F.; Taipale, M.; Lindquist, S. Protein homeostasis and the phenotypic manifestation of genetic diversity: Principles and mechanisms. Annu. Rev. Genet. 2010, 44, 189–216. [Google Scholar] [CrossRef] [PubMed]
  13. Zhang, S.; Zhang, Y.; Cao, Y.; Lei, Y.; Jiang, H. Quantitative proteomic analysis reveals Populus cathayana females are more sensitive and respond more sophisticatedly to iron deficiency than males. J. Proteome Res. 2016, 15, 840–850. [Google Scholar] [CrossRef] [PubMed]
  14. Renaut, J.; Lutts, S.; Hoffmann, L.; Hausman, J.F. Responses of Poplar to Chilling Temperatures: Proteomic and Physiological Aspects. Plant Biol. 2004, 7, 81–90. [Google Scholar] [CrossRef] [PubMed]
  15. Li, Y.; Feng, Y.; Lü, Q.; Yan, D.; Liu, Z.; Zhang, X. Comparative proteomic analysis of plant–pathogen interactions in resistant and susceptible poplar ecotypes infected with Botryosphaeria dothidea. Phytopathology 2019, 109, 2009–2021. [Google Scholar] [CrossRef]
  16. Cerny, M.; Berka, M.; Dvořák, M.; Milenković, I.; Saiz-Fernández, I.; Brzobohatý, B.; Ďurkovič, J. Defense mechanisms promoting tolerance to aggressive Phytophthora species in hybrid poplar. Front. Plant Sci. 2022, 13, 1018272. [Google Scholar] [CrossRef]
  17. Zhang, S.; Chen, F.; Peng, S.; Ma, W.; Korpelainen, H.; Li, C. Comparative physiological, ultrastructural and proteomic analyses reveal sexual differences in the responses of Populus cathayana under drought stress. Proteomics 2010, 10, 2661–2677. [Google Scholar] [CrossRef]
  18. Abraham, P.E.; Garcia, B.J.; Gunter, L.E.; Jawdy, S.S.; Engle, N.; Yang, X.; Jacobson, D.A.; Hettich, R.L.; Tuskan, G.A.; Tschaplinski, T.J. Quantitative proteome profile of water deficit stress responses in eastern cottonwood (Populus deltoides) leaves. PLoS ONE 2018, 13, e0190019. [Google Scholar] [CrossRef]
  19. Yang, F.; Wang, Y.; Wang, J.; Deng, W.; Liao, L.; Li, M. Different eco-physiological responses between male and female Populus deltoides clones to waterlogging stress. For. Ecol. Manag. 2011, 262, 1963–1971. [Google Scholar] [CrossRef]
  20. Yang, F.; Han, C.; Li, Z.; Guo, Y.; Chan, Z. Dissecting tissue-and species-specific responses of two Plantago species to waterlogging stress at physiological level. Environ. Exp. Bot. 2015, 109, 177–185. [Google Scholar] [CrossRef]
  21. Bradford, M.M. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 1976, 72, 248–254. [Google Scholar] [CrossRef]
  22. Gan, C.S.; Chong, P.K.; Pham, T.K.; Wright, P.C. Technical, experimental, and biological variations in isobaric tags for relative and absolute quantitation (iTRAQ). J. Proteome Res. 2007, 6, 821–827. [Google Scholar] [CrossRef] [PubMed]
  23. Strand, D.D.; Kramer, D.M. Control of Non-Photochemical Exciton Quenching by the Proton Circuit of Photosynthesis. In Non-Photochemical Quenching and Energy Dissipation in Plants, Algae and Cyanobacteria; Demmig-Adams, B., Garab, G., Adams Iii, W., Govindjee, Eds.; Springer: Dordrecht, The Netherlands, 2014; Volume 40, pp. 387–408. [Google Scholar]
  24. Avenson, T.J.; Cruz, J.A.; Kramer, D.M. Modulation of energy-dependent quenching of excitons in antennae of higher plants. Proc. Natl. Acad. Sci. USA 2004, 101, 5530–5535. [Google Scholar] [CrossRef] [PubMed]
  25. Allen, J.F. Cyclic, pseudocyclic and noncyclic photophosphorylation: New links in the chain. Trends Plant Sci. 2003, 8, 15–19. [Google Scholar] [CrossRef] [PubMed]
  26. Chitnis, P.R. Photosystem I. Plant Physiol. 1996, 111, 661–669. [Google Scholar] [CrossRef] [PubMed]
  27. Landi, M.; Guidi, L. Effects of abiotic stress on photosystem II proteins. Photosynthetica 2023, 61, 148–156. [Google Scholar] [CrossRef]
  28. Barber, J. Photosystem II: The engine of life. Q. Rev. Biophys. 2003, 36, 71–89. [Google Scholar] [CrossRef]
  29. Bricker, T.M.; Roose, J.L.; Fagerlund, R.D.; Frankel, L.K.; Eaton Rye, J.J. The extrinsic proteins of photosystem II. Biochim. Biophys. Acta Bioenerg. 2012, 1817, 121–142. [Google Scholar] [CrossRef]
  30. Nelson, N.; Junge, W. Structure and energy transfer in photosystems of oxygenic photosynthesis. Annu. Rev. Biochem. 2015, 84, 659–683. [Google Scholar] [CrossRef] [PubMed]
  31. Liu, H.; Jiao, Q.; Fan, L.; Jiang, Y.; Alyemeni, M.N.; Ahmad, P.; Chen, Y.; Zhu, M.; Liu, H.; Zhao, Y. Integrated physio-biochemical and transcriptomic analysis revealed mechanism underlying of Si-mediated alleviation to cadmium toxicity in wheat. J. Hazard. Mater. 2023, 452, 131366. [Google Scholar] [CrossRef]
  32. Li, A.; You, T.; Pang, X.; Wang, Y.; Tian, L.; Li, X.; Liu, Z. Structural basis for an early stage of the photosystem II repair cycle in Chlamydomonas reinhardtii. Nat. Commun. 2024, 15, 5211. [Google Scholar] [CrossRef]
  33. Zhou, F.; Feng, X.; Jiang, A.; Zhu, P. Mutations in the BoPQL2 gene enhance the sensitivity to low temperature and affect the leaf margin coloration in ornamental kale. Sci. Hortic. 2024, 323, 112540. [Google Scholar] [CrossRef]
  34. Zhu, S.; Sun, S.; Zhao, W.; Yang, X.; Mao, H.; Sheng, L.; Chen, Z. Utilizing transcriptomics and proteomics to unravel key genes and proteins of Oryza sativa seedlings mediated by selenium in response to cadmium stress. BMC Plant Biol. 2024, 24, 360. [Google Scholar] [CrossRef] [PubMed]
  35. Deng, Y.S.; Kong, F.Y.; Zhou, B.; Zhang, S.; Yue, M.-M.; Meng, Q.W. Heterology expression of the tomato LeLhcb2 gene confers elevated tolerance to chilling stress in transgenic tobacco. Plant Physiol. Biochem. 2014, 80, 318–327. [Google Scholar] [CrossRef] [PubMed]
  36. Zhang, S.; Lu, S.; Xu, X.; Korpelainen, H.; Li, C. Changes in antioxidant enzyme activities and isozyme profiles in leaves of male and female Populus cathayana infected with Melampsora larici-populina. Tree Physiol. 2010, 30, 116–128. [Google Scholar] [CrossRef] [PubMed]
  37. Xu, X.; Peng, G.; Wu, C.; Korpelainen, H.; Li, C. Drought inhibits photosynthetic capacity more in females than in males of Populus cathayana. Tree Physiol. 2008, 28, 1751–1759. [Google Scholar] [CrossRef] [PubMed]
  38. Ruban, A.V.; Murchie, E.H. Assessing the photoprotective effectiveness of non-photochemical chlorophyll fluorescence quenching: A new approach. Biochim. Biophys. Acta Bioenerg. 2012, 1817, 977–982. [Google Scholar] [CrossRef]
  39. Tietz, S.; Hall, C.C.; Cruz, J.A.; Kramer, D.M. NPQ(T): A chlorophyll fluorescence parameter for rapid estimation and imaging of non-photochemical quenching of excitons in photosystem-II-associated antenna complexes. Plant Cell Environ. 2017, 40, 1243–1255. [Google Scholar] [CrossRef]
  40. Johnson, G.; Young, A.; Scholes, J.; Horton, P. The dissipation of excess excitation energy in British plant species. Plant Cell Environ. 1993, 16, 673–679. [Google Scholar] [CrossRef]
  41. Zhang, Y.Z.; Li, K.; Qin, B.Y.; Guo, J.P.; Zhang, Q.B.; Zhao, D.L.; Chen, X.L.; Gao, J.; Liu, L.N.; Zhao, L.S. Structure of cryptophyte photosystem II–light-harvesting antennae supercomplex. Nat. Commun. 2024, 15, 4999. [Google Scholar] [CrossRef]
  42. Wang, N.; Fan, X.; He, M.; Hu, Z.; Tang, C.; Zhang, S.; Lin, D.; Gan, P.; Wang, J.; Huang, X.; et al. Transcriptional repression of TaNOX10 by TaWRKY19 compromises ROS generation and enhances wheat susceptibility to stripe rust. Plant Cell 2022, 34, 1784–1803. [Google Scholar] [CrossRef]
  43. Wang, G.; Wang, X.; Li, D.; Yang, X.; Hu, T.; Fu, J. Comparative proteomics in tall fescue to reveal underlying mechanisms for improving photosystem II thermotolerance during heat stress memory. BMC Genom. 2024, 25, 683. [Google Scholar] [CrossRef] [PubMed]
  44. Heller, J.; Tudzynski, P. Reactive oxygen species in phytopathogenic fungi: Signaling, development, and disease. Annu. Rev. Phytopathol. 2011, 49, 369–390. [Google Scholar] [CrossRef] [PubMed]
  45. Segal, L.M.; Wilson, R.A. Reactive oxygen species metabolism and plant-fungal interactions. Fungal Genet. Biol. 2018, 110, 1–9. [Google Scholar] [CrossRef]
  46. Thannickal, V.J.; Fanburg, B.L. Reactive oxygen species in cell signaling. Am. J. Physiol. 2000, 279, L1005–L1028. [Google Scholar] [CrossRef]
  47. Forman, H.J.; Zhang, H.; Rinna, A. Glutathione: Overview of its protective roles, measurement, and biosynthesis. Mol. Aspects Med. 2009, 30, 1–12. [Google Scholar] [CrossRef] [PubMed]
  48. Alscher, R.G. Biosynthesis and antioxidant function of glutathione in plants. Physiol. Plant. 2010, 77, 457–464. [Google Scholar] [CrossRef]
  49. Gullner, G.; Komives, T.; Király, L.; Schröder, P. Glutathione S-transferase enzymes in plant-pathogen interactions. Front. Plant Sci. 2018, 9, 1836. [Google Scholar] [CrossRef] [PubMed]
  50. Gong, Q.; Yang, Z.; Chen, E.; Sun, G.; He, S.; Butt, H.I.; Zhang, C.; Zhang, X.; Yang, Z.; Du, X. A phi-class glutathione S-transferase gene for Verticillium wilt resistance in Gossypium arboreum identified in a genome-wide association study. Plant Cell Physiol. 2018, 59, 275–289. [Google Scholar] [CrossRef]
  51. Cheynier, V.; Comte, G.; Davies, K.; Lattanzio, V.; Martens, S. Plant phenolics: Recent advances on their biosynthesis, genetics, and ecophysiology. Plant Physiol. Biochem. 2013, 72, 1–20. [Google Scholar] [CrossRef]
  52. Bonawitz, N.D.; Chapple, C. The genetics of lignin biosynthesis: Connecting genotype to phenotype. Annu. Rev. Genet. 2010, 44, 337–363. [Google Scholar] [CrossRef]
  53. Singh, R.; Rastogi, S.; Dwivedi, U.N. Phenylpropanoid metabolism in ripening fruits. Compr. Rev. Food Sci. Food Saf. 2010, 9, 398–416. [Google Scholar] [CrossRef] [PubMed]
  54. Kim, D.S.; Hwang, B.K. An important role of the pepper phenylalanine ammonia-lyase gene (PAL1) in salicylic acid-dependent signalling of the defence response to microbial pathogens. J. Exp. Bot. 2014, 65, 2295–2306. [Google Scholar] [CrossRef] [PubMed]
  55. MacDonald, M.J.; D’Cunha, G.B. A modern view of phenylalanine ammonia lyase. Biochem. Cell Biol. 2007, 85, 273–282. [Google Scholar] [CrossRef]
  56. Kim, B.G.; Kim, I.A.; Ahn, J.H. Characterization of hydroxycinnamoyl-coenzyme a Shikimate hydroxycinnamoyl transferase from Populus euramericana. J. Korean Soc. Appl. Biol. Chem. 2011, 54, 817–821. [Google Scholar] [CrossRef]
  57. Du, M.; Lian, L.; Zhang, Y.; Lin, H.; Wang, J. Roles of ROS metabolism and phenylpropanoid pathway in quality maintenance of postharvest Pleurotus eryngii under hyperoxia stress. Postharvest Biol. Technol. 2024, 207, 112617. [Google Scholar] [CrossRef]
  58. Gulzar, F.; Yang, H.; Chen, J.; Hassan, B.; Huang, X.; Qiong, F. 6-BA reduced yield loss under waterlogging stress by regulating the phenylpropanoid pathway in wheat. Plants 2024, 13, 1991. [Google Scholar] [CrossRef] [PubMed]
  59. Shi, J.; Wang, Y.; Fan, X.; Li, R.; Yu, C.; Peng, Z.; Gao, Y.; Liu, Z.; Duan, L. A novel plant growth regulator B2 mediates drought resistance by regulating reactive oxygen species, phytohormone signaling, phenylpropanoid biosynthesis, and starch metabolism pathways in Carex breviculmis. Plant Physiol. Biochem. 2024, 213, 108860. [Google Scholar] [CrossRef]
  60. Leonardelli, M.; Tissot, N.; Podolec, R.; Ares-Orpel, F.; Glauser, G.; Ulm, R.; Demarsy, E. Photoreceptor-induced sinapate synthesis contributes to photoprotection in Arabidopsis. Plant Physiol. 2024, 196, 1518–1533. [Google Scholar] [CrossRef]
Figure 1. Gas exchange parameters and chlorophyll fluorescence parameters of female and male Populus deltoides W. Bartram ex Marshall after inoculation with Alternaria alternata (Fr.) Keissler. FC, control female; MC, control male; FI, infected female; MI, infected male. Fs, sex effect; Fin, infected effect; Fs×in, sex and infected interaction effect. Values are means ± SE (n = 6), and different lowercase letters indicate significant differences between different treatments (p < 0.05).
Figure 1. Gas exchange parameters and chlorophyll fluorescence parameters of female and male Populus deltoides W. Bartram ex Marshall after inoculation with Alternaria alternata (Fr.) Keissler. FC, control female; MC, control male; FI, infected female; MI, infected male. Fs, sex effect; Fin, infected effect; Fs×in, sex and infected interaction effect. Values are means ± SE (n = 6), and different lowercase letters indicate significant differences between different treatments (p < 0.05).
Forests 15 02093 g001
Figure 2. The antioxidant enzymatic activities and GSH contents in female and male P. deltoides after inoculation with A. alternata. Fs, sex effect; Fin, infected effect; Fs×in, sex, and infected interaction effect. Values are means ± SE (n = 6), and different lowercase letters indicate significant differences between different treatments (p < 0.05).
Figure 2. The antioxidant enzymatic activities and GSH contents in female and male P. deltoides after inoculation with A. alternata. Fs, sex effect; Fin, infected effect; Fs×in, sex, and infected interaction effect. Values are means ± SE (n = 6), and different lowercase letters indicate significant differences between different treatments (p < 0.05).
Forests 15 02093 g002
Figure 3. The number of upregulated DEPs, the number of down-regulated DEPs, and the total number of DEPs in the four comparison groups. FC, control female; MC, control male; FI, infected female; MI, infected male. FC-MC, comparison group between control female and control male; FC-FI, comparison group between control female and infected female; MC-MI, comparison group between control male and infected male; FI-MI, comparison group between infected female and infected male.
Figure 3. The number of upregulated DEPs, the number of down-regulated DEPs, and the total number of DEPs in the four comparison groups. FC, control female; MC, control male; FI, infected female; MI, infected male. FC-MC, comparison group between control female and control male; FC-FI, comparison group between control female and infected female; MC-MI, comparison group between control male and infected male; FI-MI, comparison group between infected female and infected male.
Forests 15 02093 g003
Figure 4. The clustering heat map of DEPs. FC, control female; MC, control male; FI, infected female; MI, infected male. FC-MC, comparison group between control female and control male; FC-FI, comparison group between control female and infected female; MC-MI, comparison group between control male and infected male; FI-MI, comparison group between infected female and infected male.
Figure 4. The clustering heat map of DEPs. FC, control female; MC, control male; FI, infected female; MI, infected male. FC-MC, comparison group between control female and control male; FC-FI, comparison group between control female and infected female; MC-MI, comparison group between control male and infected male; FI-MI, comparison group between infected female and infected male.
Forests 15 02093 g004
Figure 5. The GO function annotation results of DEPs in both male and female plants under CK and A. alternata condition (A) FC-FI comparison group. (B) MC-MI comparison group. (C) FC-MC comparison group. (D) FI-MI comparison group. Different classes are shown for biological processes, cellular components, and molecular functions.
Figure 5. The GO function annotation results of DEPs in both male and female plants under CK and A. alternata condition (A) FC-FI comparison group. (B) MC-MI comparison group. (C) FC-MC comparison group. (D) FI-MI comparison group. Different classes are shown for biological processes, cellular components, and molecular functions.
Forests 15 02093 g005
Figure 6. The annotated map of the DEP-enriched KEGG metabolic pathway. The pathway names are provided on the vertical axis. The rich factor in the horizontal axis is the size of the point, which represents the number of DEGs, and the color of the dot represents the p-value.
Figure 6. The annotated map of the DEP-enriched KEGG metabolic pathway. The pathway names are provided on the vertical axis. The rich factor in the horizontal axis is the size of the point, which represents the number of DEGs, and the color of the dot represents the p-value.
Forests 15 02093 g006
Figure 7. The clustering heat map of DEPs in photosynthesis. Different colors represent up- and down-regulated DEPs. FC, control female; MC, control male; FI, infected female; MI, infected male. FC-MC: comparison group between control female and control male, FC-FI: comparison group between control female and infected female, MC-MI: comparison group between control male and infected male, FI-MI: comparison group between infected female and infected male.
Figure 7. The clustering heat map of DEPs in photosynthesis. Different colors represent up- and down-regulated DEPs. FC, control female; MC, control male; FI, infected female; MI, infected male. FC-MC: comparison group between control female and control male, FC-FI: comparison group between control female and infected female, MC-MI: comparison group between control male and infected male, FI-MI: comparison group between infected female and infected male.
Forests 15 02093 g007
Figure 8. Changes across four groups and KEGG schematic of the photosynthesis pathways for the four comparison groups. (A) FC-FI comparison group. (B) MC-MI comparison group. (C) FC-MC comparison group. (D) FI-MI comparison group. Nodes containing only upregulated proteins were highlighted in red box, nodes con-taining only down-regulated proteins were shown as green, and KO nodes containing both upregulated and downregulated proteins were depicted as half red and half green.
Figure 8. Changes across four groups and KEGG schematic of the photosynthesis pathways for the four comparison groups. (A) FC-FI comparison group. (B) MC-MI comparison group. (C) FC-MC comparison group. (D) FI-MI comparison group. Nodes containing only upregulated proteins were highlighted in red box, nodes con-taining only down-regulated proteins were shown as green, and KO nodes containing both upregulated and downregulated proteins were depicted as half red and half green.
Forests 15 02093 g008
Figure 9. Changes across four groups and KEGG schematic of photosynthesis-antenna proteins for the four comparison groups. (A) FC-FI comparison group. (B) MC-MI comparison group. (C) FC-MC comparison group. (D) FI-MI comparison group. Nodes containing only upregulated proteins were highlighted in red box, nodes con-taining only down-regulated proteins were shown as green, and KO nodes containing both upregulated and downregulated proteins were depicted as half red and half green.
Figure 9. Changes across four groups and KEGG schematic of photosynthesis-antenna proteins for the four comparison groups. (A) FC-FI comparison group. (B) MC-MI comparison group. (C) FC-MC comparison group. (D) FI-MI comparison group. Nodes containing only upregulated proteins were highlighted in red box, nodes con-taining only down-regulated proteins were shown as green, and KO nodes containing both upregulated and downregulated proteins were depicted as half red and half green.
Forests 15 02093 g009
Figure 10. The heat map of DEPs in the antioxidant system. (A): The expression of DEPs of the glutathione metabolism pathway in four comparison groups; (B): The expression of DEPs related to SOD and POD. Different colors represent up- and down-regulated DEPs. FC, control female; MC, control male; FI, infected female; MI, infected male. FC-MC: comparison group between control female and control male, FC-FI: comparison group between control female and infected female, MC-MI: comparison group between control male and infected male, FI-MI: comparison group between infected female and infected male.
Figure 10. The heat map of DEPs in the antioxidant system. (A): The expression of DEPs of the glutathione metabolism pathway in four comparison groups; (B): The expression of DEPs related to SOD and POD. Different colors represent up- and down-regulated DEPs. FC, control female; MC, control male; FI, infected female; MI, infected male. FC-MC: comparison group between control female and control male, FC-FI: comparison group between control female and infected female, MC-MI: comparison group between control male and infected male, FI-MI: comparison group between infected female and infected male.
Forests 15 02093 g010
Figure 11. The KEGG schematic of glutathione metabolism for the four comparison groups. (A) FC-FI comparison group. (B) MC-MI comparison group. (C) FC-MC comparison group. (D) FI-MI comparison group. Nodes containing only upregulated proteins were highlighted in red box, nodes con-taining only down-regulated proteins were shown as green, and KO nodes containing both upregulated and downregulated proteins were depicted as half red and half green.
Figure 11. The KEGG schematic of glutathione metabolism for the four comparison groups. (A) FC-FI comparison group. (B) MC-MI comparison group. (C) FC-MC comparison group. (D) FI-MI comparison group. Nodes containing only upregulated proteins were highlighted in red box, nodes con-taining only down-regulated proteins were shown as green, and KO nodes containing both upregulated and downregulated proteins were depicted as half red and half green.
Forests 15 02093 g011
Figure 12. The clustering heat map and protein interaction network map of DEPs in phenylpropanoid biosynthesis pathway. (A) represent up and downregulated DEPs; (B) represent the interaction of DEPs in phenylpropanoid biosynthesis pathways. FC, control female; MC, control male; FI, infected female; MI, infected male. FC-MC, comparison group between control female and control male; FC-FI, comparison group between control female and infected female; MC-MI, comparison group between control male and infected male; FI-MI, comparison group between infected female and infected male.
Figure 12. The clustering heat map and protein interaction network map of DEPs in phenylpropanoid biosynthesis pathway. (A) represent up and downregulated DEPs; (B) represent the interaction of DEPs in phenylpropanoid biosynthesis pathways. FC, control female; MC, control male; FI, infected female; MI, infected male. FC-MC, comparison group between control female and control male; FC-FI, comparison group between control female and infected female; MC-MI, comparison group between control male and infected male; FI-MI, comparison group between infected female and infected male.
Forests 15 02093 g012
Figure 13. The KEGG schematic of phenylpropanoid biosynthetic pathways for the four comparison groups. (A) FC-FI comparison group. (B) MC-MI comparison group. (C) FC-MC comparison group. (D) FI-MI comparison group. FC, control female; MC, control male; FI, infected female; MI, infected male. FC-MC: comparison group between control female and control male, FC-FI: comparison group between control female and infected female, MC-MI: comparison group between control male and infected male, FI-MI: comparison group between infected female and infected male. Nodes containing only upregulated proteins were highlighted in red box, nodes con-taining only down-regulated proteins were shown as green, and KO nodes containing both upregulated and downregulated proteins were depicted as half red and half green.
Figure 13. The KEGG schematic of phenylpropanoid biosynthetic pathways for the four comparison groups. (A) FC-FI comparison group. (B) MC-MI comparison group. (C) FC-MC comparison group. (D) FI-MI comparison group. FC, control female; MC, control male; FI, infected female; MI, infected male. FC-MC: comparison group between control female and control male, FC-FI: comparison group between control female and infected female, MC-MI: comparison group between control male and infected male, FI-MI: comparison group between infected female and infected male. Nodes containing only upregulated proteins were highlighted in red box, nodes con-taining only down-regulated proteins were shown as green, and KO nodes containing both upregulated and downregulated proteins were depicted as half red and half green.
Forests 15 02093 g013
Table 1. The ROS contents in female and male Populus deltoides W. Bartram ex Marshall after inoculation with Alternaria alternata (Fr.) Keissler. Fs, sex effect; Fin, infected effect; Fs×in, sex, and infected interaction effect. Values are means ± SE (n = 6), and different lowercase letters indicate significant differences between different treatments (p < 0.05).
Table 1. The ROS contents in female and male Populus deltoides W. Bartram ex Marshall after inoculation with Alternaria alternata (Fr.) Keissler. Fs, sex effect; Fin, infected effect; Fs×in, sex, and infected interaction effect. Values are means ± SE (n = 6), and different lowercase letters indicate significant differences between different treatments (p < 0.05).
ROSH2O2 (μmol/g·FW)O2•− (ng/10g·FW)OH· (ng/g·FW)
Control females5.360 ± 0.121 bc4.615 ± 0.198 b23.09 ± 1.662 bc
Infected females11.259 ± 1.401 a10.206 ± 1.529 a34.156 ± 2.833 a
Control males4.172 ± 0.137 c4.763 ± 1.283 b19.13 ± 0.688 c
Infected males8.407 ± 1.148 ab6.974 ± 1.154 ab28.499 ± 2.800 ab
Fs0.1570.1920.144
Fin0.0010.0170.003
Fs×in0.0040.0310.008
Table 2. The overall LC−MS/MS identification results of P. deltoides after inoculation with A. alternata.
Table 2. The overall LC−MS/MS identification results of P. deltoides after inoculation with A. alternata.
Group NameTotal SpectraSpectraUnique SpectraPeptideUnique PeptideProtein
Populus334,35027,43020,48410,70588033481
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Tian, H.; Khan, Y.; Miao, L.; Yang, F. Differential Photosynthetic and Proteomics Responses Between Male and Female Populus deltoides W. Bartram ex Marshall Infected by Alternaria alternata (Fr.) Keissler. Forests 2024, 15, 2093. https://doi.org/10.3390/f15122093

AMA Style

Tian H, Khan Y, Miao L, Yang F. Differential Photosynthetic and Proteomics Responses Between Male and Female Populus deltoides W. Bartram ex Marshall Infected by Alternaria alternata (Fr.) Keissler. Forests. 2024; 15(12):2093. https://doi.org/10.3390/f15122093

Chicago/Turabian Style

Tian, Huimin, Yaseen Khan, Lingfeng Miao, and Fan Yang. 2024. "Differential Photosynthetic and Proteomics Responses Between Male and Female Populus deltoides W. Bartram ex Marshall Infected by Alternaria alternata (Fr.) Keissler" Forests 15, no. 12: 2093. https://doi.org/10.3390/f15122093

APA Style

Tian, H., Khan, Y., Miao, L., & Yang, F. (2024). Differential Photosynthetic and Proteomics Responses Between Male and Female Populus deltoides W. Bartram ex Marshall Infected by Alternaria alternata (Fr.) Keissler. Forests, 15(12), 2093. https://doi.org/10.3390/f15122093

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop