Next Article in Journal
Genome-Wide Identification and Expression Analysis of the NF-Y Transcription Factor Family in Prunus armeniaca
Previous Article in Journal
The Impact of Bamboo (Phyllostachys edulis) Expansion on the Water Use Patterns of Broadleaf Trees
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Nitrogen Addition Increased the Greenhouse Gas Emissions of Permafrost Peatland Due to the Abundance of Soil Microbial Functional Genes Increasing in the Great Khingan Mountains, Northeast China

1
Heilongjiang Province Key Laboratory of Geographical Environment Monitoring and Spatial Information Service in Cold Regions, Harbin Normal University, Harbin 150025, China
2
School of Management, Heilongjiang University of Science and Technology, Harbin 150022, China
3
Cryosphere Research Station on the Qinghai-Tibet Plateau, State Key Laboratory of Cryospheric Science, Northwest Institute of Eco-Environment and Resources, Chinese Academy of Sciences, Lanzhou 730000, China
4
School of Geography and Planning, Nanning Normal University, Nanning 530001, China
5
Key Laboratory of Environment Change and Resources Use in Beibu Gulf, Ministry of Education, Nanning Normal University, Nanning 530001, China
6
Guangxi Key Laboratory of Earth Surface Processes and Intelligent Simulation, Nanning Normal University, Nanning 530001, China
*
Author to whom correspondence should be addressed.
Forests 2024, 15(11), 1985; https://doi.org/10.3390/f15111985
Submission received: 3 October 2024 / Revised: 6 November 2024 / Accepted: 8 November 2024 / Published: 10 November 2024
(This article belongs to the Section Forest Soil)

Abstract

:
Permafrost peatlands are sensitive to changes in nitrogen levels because they are largely nitrogen-limited ecosystems. However, the microbial mechanisms by which the addition of nitrogen increases the emission of greenhouse gasses from permafrost peatlands remain unclear. This study was conducted to decipher the relationship between greenhouse gas emissions and soil microorganisms under nitrogen addition. Here, we performed a 154-day experimental investigation in order to assess the release of greenhouse gasses such as CO2, CH4, and N2O from the soils. Additionally, we examined the correlation between the rates of these gas emissions and the presence of crucial microbial functional genes in the soil. The results showed that the addition of low (0.01 g kg−1), medium (0.02 g kg−1), and high (0.04 g kg−1) levels of nitrogen increased the cumulative CO2 emissions by 2.35%–90.42%, respectively. The cumulative emissions of CH4 increased by 17.29%, 25.55% and 21.77%, respectively. The cumulative emissions of N2O increased 2.97, 7.49 and 7.72-fold. The addition of nitrogen increased the abundance of functional genes in the bacteria, fungi, methanogens, denitrifying bacteria, and nitrogen-fixing bacteria in soil by modifying abiotic soil variables and providing sufficient substrates for microorganisms. The results indicated that the addition of nitrogen can significantly promote the emission of greenhouse gasses by increasing the abundance of functional microbial genes in the soil of permafrost peatlands. These findings highlight the importance of considering nitrogen deposition and the nitrogen released from thawing permafrost when predicting the future greenhouse gasses emitted from permafrost peatlands.

1. Introduction

Regions characterized by permafrost cover approximately 22% of the Northern Hemisphere’s terrestrial area [1]. These areas are currently experiencing swift deterioration as a consequence of global warming [2]. The thawing of permafrost can lead to the decomposition of organic materials that have been stored in the soil for extended periods, subsequently releasing various greenhouse gasses such as CO2, CH4, and N2O into the atmosphere. This process contributes to a self-reinforcing loop that exacerbates climate change [3]. In 2023, global greenhouse gas emissions reached a record high of 57.1 billion tons of CO2 Eq [4]. According to the latest data on greenhouse gas release from the permafrost of the Northern Hemisphere, with global warming, permafrost regions have experienced significant warming, with rates 2 to 4 times higher than the global average [5].
The release of greenhouse gasses (GHGs) from permafrost regions essentially results from the microbial utilization of organic matter, and this process is mainly affected by the substrate supply and microbial communities [6]. In areas with a high prevalence of permafrost, the soil’s organic matter has been accumulating gradually over a long period, leading to a nutrient-deficient soil profile. This results in a high carbon-to-nitrogen ratio, which in turn restricts microbial activity during the decomposition of organic matter due to a lack of nitrogen [7]. Consequently, the addition of nitrogen often enhances the breakdown of the soil organic matter (SOM) [8,9,10,11]. An illustrative case is the application of nitrogen fertilizers to an alpine meadow on the northern edge of the Qinghai–Tibet Plateau; this was observed to boost soil microbial activity and elevate CO2 concentrations. However, there was no significant impact on the absorption of CH4 or the emission of N2O [12]. However, it was also found that the high concentration of nitrogen added (6 g nitrogen m−2 a−1) inhibited the emission of CH4 in the boreal peatlands of northeast China [13].
Nitrogen deposition controls greenhouse gas emission processes by regulating the quantity, function, and structure of soil microorganisms [14]. Oligotrophic bacteria have a strong metabolic capacity for refractory organic matter. These species can survive in nutrient-poor environments (high carbon-to-nitrogen ratio) but grow slowly in nutrient-rich conditions in the short term. Eutrophic bacteria tend to utilize readily available organic carbon and have a high nitrogen requirement [15]. Therefore, it is hypothesized that nitrogen deposition can alleviate nitrogen limitations for microorganisms; thus, the relative abundance of eutrophic bacteria declines [16].
The introduction of nitrogen can influence the flux of CO2 by boosting plant growth, which in turn enhances the nutritional composition of plant debris and mitigates the constraints on microbial metabolism caused by nitrogen scarcity [17,18]. In peatland ecosystems, the primary agents responsible for the decomposition of organic matter are bacteria and fungi [19,20]. After the input of nitrogen, soil microorganisms retain more NH4+, and plants mainly use NO3. Both of these processes increase the size of the soil microbial community and plant root activity, respectively, increasing the emission of CO2 [21].
CH4 is produced by methanogens under anaerobic conditions [22,23]. The introduction of nitrogen can influence the metabolic processes of methanogenic microorganisms [24] and further affect the production of CH4 [25,26]. Previous findings suggest that the addition of nitrogen can inhibit the absorption of CH4 [27] and increase the emission of CH4 [28]. The input of nitrogen can reduce the capacity of soils to absorb methane, primarily by changing the quantity and variety of methanotrophs and methanogens, as well as their community composition. Moreover, a decrease in the soil pH, which is often associated with increased levels of nitrogen, plays a significant role in governing the diversity and composition of these microbial communities [29].
Enhanced emissions of N2O have been linked to elevated rates of nitrification and denitrification. The addition of nitrogen to soil has been shown to boost the emission of N2O, likely due to the proliferation of bacteria responsible for these processes [30,31,32,33]. Nitrobacter, which plays a key role in ecosystem denitrification, facilitates this process, thereby contributing to the greater release of N2O [34].
Various critical genes involved in the biogeochemical cycles of carbon and nitrogen are frequently utilized to evaluate the population and variety of microbes in soil, encompassing those that are vital for soil respiration processes (bacteria and fungi) [35,36], CH4 generation (mcrA), CH4 oxidation (pmoA) [37,38], N2O production (nirS and nirK) [39,40], and nitrogen fixation (nifH) [41,42]. Although these genes have been recognized, their abundance and relationship with greenhouse gas emissions largely remain unclear; this is because many physiochemical variables can also affect greenhouse gas emissions [43]. Overall, nitrogen addition influences greenhouse gas emission patterns by affecting soil microorganisms. Nitrogen application at different levels (low, medium, and high) may have varying impacts on greenhouse gas emissions. Therefore, it is of great significance to study the changes in soil microbial functional genes under different nitrogen application levels and their relationship with greenhouse gas emissions, which may benefit the prediction of emission patterns in the context of future increases in atmospheric nitrogen deposition.
Prolonged cold and wet conditions in northern peatlands have led to the sequestration of over 875 Pg of carbon [44]. The carbon stored in permafrost peatlands accounts for 1/3 of the soil carbon pool in the global terrestrial ecosystem [45,46]. Permafrost peatlands are nutrient-poor, limited by nitrogen, and sensitive to changes in nitrogen levels [47]. The continuous increase in nitrogen deposition and global warming could exacerbate the volume of GHGs emitted from thawing permafrost [48]. In this research, soil samples were procured from a peatland in the Greater Khingan Mountains, Northeast China. Using laboratory incubation experiments, we assessed the impact of nitrogen supplementation on the release of greenhouse gasses and the underlying microbial processes. We propose the following hypotheses: (1) Nitrogen addition will stimulate the emission of CO2 by accelerating the decomposition of soil organic matter. (2) Nitrogen addition will enhance the abundance of methane-producing bacteria by providing more nitrogen substrates, thereby facilitating the production of CH4. (3) Nitrogen addition will promote the emission of N2O by intensifying the rate at which nitrification and denitrification processes are performed. The primary aim of this study was to explore the variations in the emission of CO2, CH4, and N2O from permafrost peatlands, as well as reveal the potential microbial processes driving these changes. This study provides a valuable reference for future predictions of soil carbon and nitrogen cycling responses to atmospheric nitrogen deposition in permafrost regions.

2. Materials and Methods

2.1. Study Area

Samples were obtained from the Mohe National Observation and Research Station, which is situated within the forest ecosystems of the Greater Khingan Range (53°28.2247′ N, 122°20.4478′ E; altitude 292 m a.s.l.). Characterized by a cool temperate monsoon climate, this region experiences warm and damp summers, contrasted with extended, chilly winters (Figure 1). The area’s mean annual temperature is approximately −2.19 °C, with the average yearly precipitation totaling 549.9 mm and predominantly occurring from June to August [49]. During the winter months, the snow depth typically ranges from 30 to 50 cm, and the period without frost lasts for 90 to 110 days annually [50]. The sampling sites were located in permafrost peatlands, with the land cover type being Larix gmelini-Sphagnum peatland [51].

2.2. Soil Sampling

This study was performed on a Larix gmelini-Sphagnum peatland (soil type: peat soil) within the study area in late September 2021. To minimize spatial heterogeneity, three random points were chosen within a 20 m × 20 m sampling plot in the studied peatland. By using a soil auger spiral drill with a 50 mm inner diameter, soils were sampled from a depth of 0–10 cm at each point after the removal of surface vegetation and humus. In terms of the reason for sampling surface soil, the microbial abundance and community structure in the surface layer (0–10 cm) of peatlands are highly sensitive to environmental changes, and the surface soil is also the major pool of carbon stock and release [38,52]. Then, the three soil samples collected were thoroughly mixed to obtain a single composite soil sample, which was sealed in a plastic bag with the headspace removed and transported back to the laboratory within 10 h. In the laboratory, visible plant roots and stones were manually removed from the composite soil sample first for indoor incubation experiments, followed by microbial functional gene analysis. Before starting the indoor incubation experiment, a portion of the soil sample was tested for basic physicochemical properties. The results showed that the soil organic carbon (SOC) content was 165.6 g kg−1, dissolved organic carbon (DOC) content was 390.7 mg kg−1, total nitrogen (TN) content was 7.76 g kg−1, and total phosphorus (TP) content was 3.49 g kg−1. Detailed experimental methods are described in Section 2.4 of this paper.

2.3. Incubation Experiment

The atmospheric nitrogen deposition rate in the study area is approximately 2.5 g nitrogen m−2 a−1 [53]. According to the atmospheric nitrogen deposition rate in China and the increase expected, the nitrogen addition concentration was set to 1, 2, and 4 times that of the current nitrogen deposition rate [54]. The experiment used four treatment groups, including a control and three nitrogen gradient levels identified as N0, N1, N2, and N4, with each level having three replicates. First, a fresh soil sample (equivalent to 20 g of dry soil) was weighed and placed in a 100 mL sealed incubation bottle. These vessels were then sealed with rubber bungs. The soil’s water content was modified to achieve 70% of its maximum water-holding capacity using deionized water. These incubation bottles were preincubated for 7 days (Thermo, Waltham, MA, USA) at 15 °C to restore the soil microbial activity. Second, according to the soil bulk density (0.64 g cm−3), 0, 0.01, 0.02, and 0.04 g kg−1 of NH4NO3 were added according to the four nitrogen gradients in order to simulate the future increases in nitrogen deposition [51]. All the treated samples were placed in a constant-temperature incubator at 15 °C for 154 days, and three blank bottles were used as controls [49]. The selection of the laboratory incubation period of 154 days was based on two primary reasons. Firstly, during the initial phase of laboratory incubation, the soil’s greenhouse gas emission rates can vary greatly, which fails to accurately reflect the true pattern of greenhouse gas emissions, thus impacting the validity of the conclusions. Secondly, the influence of nitrogen on soil microorganisms is a prolonged process. Under the sustained effects of nitrogen, there will be significant changes in soil properties and the abundance and composition of microbial communities. These alterations could potentially lead to changes in microbial activities associated with soil carbon cycling [55]. The incubation vessels were weighed at weekly intervals, and deionized water was supplemented as needed to preserve the soil’s moisture content. Prior to gas sampling, the vessels were opened for a 10 min period to enable the exchange of air, ensuring equilibrium between the internal and external gas concentrations. This was achieved by drawing and expelling air through the vessels with a syringe multiple times. Subsequently, the three-way valve was secured, and the vessels were placed back into the incubator. An hour later, the valve was opened, and a 20 mL gas sample was extracted using a syringe. Post collection, the vessels were briefly left open to enable the exchange of fresh air [49].
Gas samples were obtained from Day 1 to Day 154, with specific collections on Days 1, 3, 7, 14, 21, 28, 35, 42, 49, 56, 70, 84, 98, and 154. The levels of CO2, CH4, and N2O were determined utilizing an Agilent 7890A chromatograph (Agilent, Santa Clara, CA, USA). The emission rates for these gasses were derived following the methodology outlined by [56], while the cumulative releases were computed based on the procedures described by [50]. After the 154-day incubation period, the soil’s physical and chemical characteristics, including pH and ammonium nitrogen (NH4+-N), along with the prevalence of various microbial functional genes (bacteria, fungi, mcrA, pmoA, nirK, nirS, nifH), were assessed.

2.4. Soil Variable Analysis

SOC and DOC contents were determined using an N/C 3100 analyzer (Analytik Jena, Jena, Germany), while the TN and TP contents were determined using an SAN++ continuous flow analyzer (Skalar Analytical, Breda, The Netherlands) after digestion of the soil by concentrated sulfuric acid under the presence of a catalyst at a high temperature [50]. The soil pH was determined using a PHSJ-3F pH meter (INESA Instrument Co., Shanghai, China), with the soil-to-water ratio standardized at 1:10 [48]. For the quantification of ammonium nitrogen (NH4+-N) in the soil, a continuous flow analyzer was employed (Skalar, Breda, The Netherlands).

2.5. Soil Microbial Abundance Measurement

After a 154-day incubation period, the levels of microbial functional genes (bacteria, fungi, mcrA, pmoA, nirK, nirS, nifH) were assessed quantitatively via qPCR on an ABI StepOne system (Applied Biosystems, San Francisco, CA, USA). The total genomic DNA obtained from the soil samples, each weighing 0.5 g, was isolated using the E.Z.N.A.® Soil DNA Kit following the protocol provided by the manufacturer (Omega Bio-Tek, Norcross, GA, USA) [57]. The integrity and concentration of the extracted DNA were ascertained via 1.0% agarose gel electrophoresis and by performing measurements with a NanoDrop® ND-2000 spectrophotometer (Thermo Scientific Inc., Waltham, MA, USA). Subsequently, the DNA samples were stored at −80 °C for future analysis.
Quantitative PCR was employed to measure the levels of specific microbial genes, including bacterial 16S rRNA, fungal ITS, mcrA, pmoA, nirK, nirS, and nifH. The PCR reaction mixture comprised 4 μL of 5× Fast Pfu buffer, 2 μL of 2.5 mM dNTPs, 0.8 μL of each 5 μM primer, 0.4 μL of Fast Pfu polymerase, 10 ng of template DNA, and ddH2O to reach a total volume of 20 μL [58]. The thermal profile used for PCR amplification was initiated with a denaturation step at 95 °C for 3 min, and then continued with 27 cycles of 95 °C for 30 s, 55 °C for 30 s, and 72 °C for 45 s, concluding with a final extension at 72 °C for 10 min and holding at 4 °C. Each sample was processed in triplicate. The amplified PCR products were visualized and isolated from a 2% agarose gel, purified using the AxyPrep DNA Gel Extraction Kit (Axygen Biosciences, Union City, CA, USA) as per the manufacturer’s guidelines, and quantified using a Quantus™ Fluorometer (Thermo, Waltham, MA, USA) [58]. The specific primers utilized for the amplification are detailed in Table 1.

2.6. Statistical Analysis

Statistical analyses were conducted using SPSS version 22.0. A one-way ANOVA was used to assess variations in the cumulative emissions of CO2, CH4, and N2O, as well as the soil microbial functional gene responses across various nitrogen amendment levels. The threshold for statistical significance was set at α = 0.05. Additionally, Spearman’s rank correlation analysis was employed to examine the relationships between the cumulative emissions of CO2, CH4, and N2O and the soil microbial gene abundances, including those for bacteria, fungi, mcrA, pmoA, nirK, nirS, and nifH. Prior to the ANOVA, all datasets were verified for normality, and it was confirmed that they adhered to a Gaussian distribution, as per the criteria of the Shapiro–Wilk (SW) test. Figures were created using Origin2016.

3. Results

3.1. Soil CO2, CH4, and N2O Emissions Under Different Nitrogen Treatments

During the 154-day incubation, the trends in soil CO2, CH4, and N2O emission rates under the nitrogen addition treatment were similar to those under the control treatment (Figure 2a,c,e). The incubation process was divided into three periods: 0–21 d was the early stage, 21–70 d was the middle stage, and 70–154 d was the late stage of incubation [65]. The soil CO2 emission rate generally ranged from 2.0 to 4.5 mg CO2-C kg−1·h−1 in the early and middle stages, with lower values (0.05–1.29 mg CO2-C kg−1·h−1) in the late stage (Figure 2a). The variation in the soil CH4 emission rate under the N0–N4 treatments ranged from 0.22 to 0.31 μg CH4-C kg−1·h−1 and from 0.15 to 0.21 μg CH4-C kg−1·h−1 (Figure 2c), respectively. The variation in the soil N2O emission rate under the N0–N4 treatments ranged from 0.82 to 1.25 μg N2O-N kg−1·h−1 and from 0.03 to 1.09 μg N2O-N kg−1·h−1, respectively (Figure 2e). Variance analysis of the soil CO2, CH4, and N2O emission rates was carried out under different nitrogen treatments during a 154-day laboratory incubation (Tables S1–S4).
The cumulative emissions of CO2, CH4, and N2O under the control treatment were 4400.77 mg CO2-C kg−1, 330.48 μg CH4-C kg−1, and 155.48 μg N2O-N kg−1, respectively (Figure 2b,d,f). Under the conditions of low and high nitrogen supplementation, there was a significant increase in the cumulative CO2 emissions, amounting to 45.50% and 90.42%, respectively (p < 0.05, Figure 2b). The CH4 emissions also showed significant increases with the application of low, medium, and high levels of nitrogen, representing 17.29%, 25.55%, and 21.77% (p < 0.05, Figure 2d). Meanwhile, the N2O emissions experienced a marked increase, with the addition of low, medium, and high levels of nitrogen leading to increases of approximately 2.97, 7.49, and 7.72 times, respectively (p < 0.01, Figure 2f). Variance analysis of the soil CO2, CH4, and N2O cumulative emissions under different nitrogen treatments was carried out during a 154-day laboratory incubation (Table S5). The addition of nitrogen promoted the emission of soil CO2, CH4, and N2O, and the cumulative emission of soil N2O increased with an increasing nitrogen gradient (Figure 2f).

3.2. Physical and Chemical Properties of Soil

The soil pH in the control group was an average of 5.37, with reductions of 2.48%, 4.35%, and 8.70% observed under the low, medium, and high nitrogen amendment treatments, respectively (p < 0.05, Figure 3). Concurrently, the soil ammonium nitrogen (NH4+-N) levels, which averaged 12.45 mg NH4+-N kg−1 in the control group, saw significant elevations of 19.38%, 101%, and 130% with the application of low, medium, and high levels of nitrogen, respectively (p < 0.05, Figure 3). The soil pH decreased as the nitrogen gradient increased, and the soil NH4+-N increased as the nitrogen gradient increased (Figure 3).

3.3. Soil Microbial Abundance

The average abundance of soil bacteria under the control treatment was 3.05 × 109 copies g−1, and the addition of high levels of nitrogen significantly increased this value 4.06-fold (p < 0.05, Figure 4). The average abundance of fungal genes under the control treatment was 1.30 × 105 copies g−1, with a significant increase of 2.93-fold and 1.78-fold with the addition of medium and high levels of nitrogen, respectively (p < 0.05, Figure 4). The average abundance of soil mcrA under the control treatment was 0.86 × 105 copies g−1, and different levels of nitrogen addition significantly increased this value 4.80-fold, 3.78-fold, and 3.93-fold, respectively (p < 0.01, Figure 4). The average abundance of soil pmoA under the control treatment was 2.21 × 105 copies g−1, and different levels of nitrogen addition increased this value 1.09-fold, 1.08-fold, and 1.73-fold, respectively (p > 0.05, Figure 4). The mean relative changes in pmoA/mcrA under the control, low, medium, and high nitrogen treatments were 2.58, 0.93, 1.12, and 1.43, respectively.
The average abundance of nirS under the control treatment was 0.31 × 107 copies g−1, and the addition of high levels of nitrogen significantly increased this value 8.63-fold (p < 0.05, Figure 5). The average abundance of soil nirK under the control treatment was 1.26 × 107 copies g−1, and the addition of medium and high levels of nitrogen significantly increased their abundance by 4.19-fold and 3.88-fold, respectively (p < 0.05, Figure 5). The average of abundance of nifH under the control treatment was 0.11 × 108 copies g−1, and the addition of low, medium, and high levels of nitrogen significantly increased this value 9.43-fold, 9.04-fold, and 8.42-fold, respectively (p < 0.01, Figure 5).

3.4. Relationship Between Greenhouse Gas Production and Microbial Functional Genes

The correlation analysis revealed that there was a significant inverse relationship between the soil pH and the cumulative emissions of CO2, CH4, and N2O. Specifically, the cumulative CH4 emissions exhibited a significant positive correlation with the soil NH4+-N (p < 0.05) and with the abundance of soil mcrA genes (p < 0.01, Figure 6). Furthermore, the cumulative N2O emissions were significantly and positively associated with the levels of soil nirS and nifH genes (p < 0.05), as well as NH4+-N and nirK gene abundances (p < 0.01, Figure 6).

4. Discussion

The greenhouse gas emission rates varied greatly in the early and middle stages, with lower values in the late stages of incubation. After each gas collection, the incubation bottle would be opened temporarily to allow the soil to fully interact with the external air. Therefore, oxygen was not a limiting factor for soil mineralization [66]. Due to the complex mechanisms of soil microorganisms and the changes in soil substrates in different incubation stages, the addition of nitrogen and water had a strong effect on the soil’s microbial activity in the early and middle incubation stages, and the labile organic matter in the soil provided sufficient substrates for soil microorganisms [67]. Towards the end of the incubation period, it is likely that the reduction in the greenhouse gas emission was caused by the depletion of readily available soil organic carbon pools [68].
We found that the addition of low and high levels of nitrogen significantly increased the cumulative emission of CO2 (Figure 2b). This finding was similar to results obtained in situ on the Sanjiang Plain of Northeast China and in a Moso bamboo forest [69,70]. Interestingly however, there was no significant difference in soil CO2 emissions when comparing the control treatment with the medium nitrogen addition treatment, despite increased soil CO2 emissions by only 2.35% in the latter treatment, which was lower than the emissions from the low nitrogen addition treatment. This may be explained by the relatively high moisture content throughout the incubation. Within certain limits, increased soil moisture content can stimulate microbial activity, thereby increasing CO2 emissions. However, when the moisture exceeds a certain threshold, it can lead to increased soil particle agglomeration, limiting microbial activity and consequently suppressing CO2 emissions [71,72]. Field-based experimental research indicates that the application of nitrogen can stimulate the proliferation and metabolic activity of soil microbes, consequently enhancing the release of CO2 from the soil [73]. The high abundance of bacterial functional genes can stimulate soil respiration [19]. Fungi play a crucial role in catalyzing essential processes during the breakdown of organic matter and participate in the nutrient cycling of nearly all elements necessary for plant growth [43]. The addition of nitrogen can reduce the soil pH, which is conducive to the growth of some bacterial species [74]. In this research, the abundance of soil bacterial and fungal functional genes largely increased with the addition of nitrogen. The addition of high levels of nitrogen significantly increased the abundance of soil bacterial functional genes, with a lower increase in fungi genes when high levels of nitrogen were added. This can be explained by the fact that, when a high level of nitrogen was added, the nitrogen levels may have exceeded the nitrogen demand of fungi and adversely affected the microbial activity [74].
This study found that the cumulative CO2 emissions significantly increased by 45.50% under 0.01 g kg−1 of nitrogen addition and by 90.42% under 0.04 g kg−1 of nitrogen addition, respectively. The cumulative CO2 emissions decreased by 3.4% under 0.1 g kg−1 of nitrogen addition and by 7.4% under 0.25 g kg−1 of nitrogen addition, respectively, in subtropical forests [65]. Although the total CO2 emissions varied between the two aforementioned incubation studies, there was a consistent trend: the ratio of fungal to bacterial biomass increased as the levels of nitrogen increased and when the incubation period exceeded 100 days. The ability of the addition of nitrogen to increase or decrease the accumulation of SOC mineralization could be explained by several factors, e.g., the soil water content, the organic carbon content, and the volume of N added [75]. The relatively high rates of CO2 production may also be attributed to the fact that permafrost peatland soils are more sensitive to nitrogen because microorganisms are largely limited by nitrogen during the process of organic matter decomposition in permafrost regions [76]. Consequently, the application of nitrogen has been shown to expedite the breakdown of organic matter in soil, leading to heightened CO2 emissions [77,78].
We found that the nitrogen addition treatments significantly increased the cumulative emissions of CH4 (Figure 2d). NH4+-N can inhibit the oxidation of CH4 by competing with methane monooxygenase [79,80,81]. An increase in available nitrogen can lead to elevated CH4 emissions, as it alleviates the nitrogen limitations that might have been restricting microbial activity [10]. NH4+-N can impede the process of methane oxidation by competing with the methane monooxygenase enzyme for substrate availability [82]. The addition of nitrogen can also inhibit the activity of methanotrophs by reducing the soil pH, resulting in a decrease in the oxidation of soil methane [83]. The overall CH4 emissions demonstrated a significant positive correlation with both soil ammonium nitrogen (NH4+-N) and the mcrA gene, which is associated with methanogenesis. Conversely, they showed a significant inverse relationship with the soil pH, thereby substantiating the preceding observations (Figure 6). Our results showed that the addition of nitrogen reduces the methane oxidation capacity of soil and promotes the emission of soil CH4 [29,84].
The emissions of soil N2O accumulated progressively in response to the increasing nitrogen gradient (Figure 2f). This pattern is in agreement with other ecosystems [68,85,86,87]. An increase in available nitrogen provides more substrates for nitrifying and denitrifying microorganisms (nirS- and nirK-type denitrifying bacterial communities), promoting nitrification and denitrification and increasing the emission of soil N2O [32,88]. In our research, the total N2O emissions exhibited a significant positive correlation with the levels of nirS, nirK, and NH4+-N in the soil, while an inverse relationship was observed with the soil pH. These results confirm that a lower soil pH can significantly increase the production of N2O through enhanced denitrification; this is because a low soil pH increases the number and activity of soil-denitrifying bacteria [89,90].
This study analyzed the effects of nitrogen addition at varying levels on greenhouse gas emissions and microbial mechanisms through indoor incubation, yet with some limitations. Specifically, as the incubation period was only 154 days, it could not fully represent field conditions in terms of temperature and moisture variations nor potential interactions among microbial species. Therefore, in order to simulate field conditions more accurately, experimental setups with diverse environmental conditions (e.g., temperature and humidity variations) should be established in outdoor settings, such as open-top chambers (OTCs), to observe greenhouse gas emission patterns. Additionally, high-throughput sequencing technology can be used to investigate the composition and functional diversity of soil microbial communities. Analysis of microbial interactions through this approach can reveal the specific paths of different microbes influencing greenhouse gas emissions [91].

5. Conclusions

The results showed that the addition of nitrogen promoted the emission of soil CO2, CH4, and N2O. The levels of key functional genes, including those implicated in the production of methane (mcrA) (nirS, nirK, and nifH) and nitrous oxide, were also found to rise significantly. There were significant relationships between the production of greenhouse gasses and the abundance of corresponding functional genes. The soil pH decreased as the nitrogen gradient increased, and the soil NH4+-N increased as the nitrogen gradient increased. These results indicate that the addition of nitrogen can promote the emission of greenhouse gasses from permafrost peatlands by increasing the abundance of soil microbial functional genes. It may further intensify global climate change. Overall, these findings suggest that increasing the rate of nitrogen deposition should be considered in the assessment of the greenhouse gasses emitted from permafrost peatlands in the future. Therefore, nitrogen fertilizer use in permafrost regions should be minimized to prevent increased available nitrogen and greenhouse gas emissions from the soil.

Supplementary Materials

The following supporting information can be downloaded at https://www.mdpi.com/article/10.3390/f15111985/s1. Table S1: Variance analysis of soil CO2, CH4, and N2O emission rates under different nitrogen treatments during the early stage of incubation; Table S2: Variance analysis of soil CO2, CH4, and N2O emission rates under different nitrogen treatments during the middle stage of incubation; Table S3: Variance analysis of soil CO2, CH4, and N2O emission rates under different nitrogen treatments during the late stage of incubation; Table S4: Variance analysis of soil CO2, CH4, and N2O emission rates under different nitrogen treatments during a 154-day laboratory incubation; Table S5: Variance analysis of soil CO2, CH4, and N2O cumulative emissions under different nitrogen treatments during a 154-day laboratory incubation.

Author Contributions

B.L.: Drafted the initial manuscript, analyzed data, and approved the final manuscript as submitted. X.W.: Reviewed and revised the manuscript and approved the final manuscript as submitted. L.S. (Liquan Song): Revised the manuscript and approved the final manuscript as submitted. L.S. (Li Sun): Performed the methodology and approved the final manuscript as submitted. R.X.: Performed the investigation and approved the final manuscript as submitted. S.Z.: Conceptualized and designed the study and approved the final manuscript as submitted. All authors have read and agreed to the published version of the manuscript.

Funding

This research is jointly supported by the National Natural Science Foundation of China (41971151, U20A2082, 42271135 and 41941015), the Science & Technology Fundamental Resources Investigation Program (2022FY100701), and Heilongjiang University of Science and Technology to introduce a high-level talent research start-up fund project (HKDQDJ202438).

Data Availability Statement

Data are contained within the article and Supplementary Materials.

Conflicts of Interest

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

References

  1. Obu, J.; Westermann, S.; Bartsch, A.; Berdnikov, N.; Christiansen, H.H.; Dashtseren, A.; Delaloye, R.; Elberling, B.; Etzelmüller, B.; Kholodov, A.; et al. Northern Hemisphere permafrost map based on TTOP modelling for 2000–2016 at 1 km2 scale. Earth-Sci. Rev. 2019, 193, 299–316. [Google Scholar] [CrossRef]
  2. Biskaborn, B.K.; Smith, S.L.; Noetzli, J.; Matthes, H.; Vieira, G.; Streletskiy, D.A.; Schoeneich, P.; Romanovsky, V.E.; Lewkowicz, A.G.; Abramov, A.; et al. Permafrost is warming at a global scale. Nat. Commun. 2019, 10, 264. [Google Scholar] [CrossRef] [PubMed]
  3. Zhao, L.; Wu, X.; Wang, Z.; Sheng, Y.; Fang, H.; Zhao, Y.; Hu, G.; Li, W.; Pang, Q.; Shi, J.; et al. Soil organic carbon and total nitrogen pools in permafrost zones of the Qinghai-Tibetan Plateau. Sci. Rep. 2018, 8, 3656. [Google Scholar] [CrossRef] [PubMed]
  4. Wang, G.; Peng, Y.; Chen, L.; Abbott, B.W.; Ciais, P.; Kang, L.; Liu, Y.; Li, Q.; Peñuelas, J.; Qin, S.; et al. Enhanced response of soil respiration to experimental warming upon thermokarst formation. Nat. Geosci. 2024, 17, 532–538. [Google Scholar] [CrossRef]
  5. Hebin, L.I.U.; Mei, M.U.; Cuicui, M.U.; Xiaodong, W.U. Interpretation of IPCC Sixth Assessment Report: Observations and projections of permafrost carbon in the Northern Hemisphere. J. Glaciol. Geocryol. 2023, 45, 318–326. [Google Scholar]
  6. Dong, X.; Liu, C.; Wu, X.; Man, H.; Wu, X.; Ma, D.; Li, M.; Zang, S. Linking soil organic carbon mineralization with soil variables and bacterial communities in a permafrost-affected tussock wetland during laboratory incubation. Catena 2023, 221, 106783. [Google Scholar] [CrossRef]
  7. Dong, X.; Man, H.; Liu, C.; Wu, X.; Zhu, J.; Zheng, Z.; Ma, D.; Li, M.; Zang, S. Changes in soil bacterial community along a gradient of permafrost degradation in Northeast China. Catena 2023, 222, 106870. [Google Scholar] [CrossRef]
  8. Hobbie, S.E.; Nadelhoffer, K.J.; Högberg, P. A synthesis: The role of nutrients as constraints on carbon balances in boreal and arctic regions. Plant Soil 2002, 242, 163–170. [Google Scholar] [CrossRef]
  9. Wang, M.; Murphy, M.T.; Moore, T.R. Nutrient resorption of two evergreen shrubs in response to long-term fertilization in a bog. Oecologia 2014, 174, 365–377. [Google Scholar] [CrossRef]
  10. Song, Y.; Liu, C.; Wang, X.; Ma, X.; Jiang, L.; Zhu, J.; Gao, J.; Song, C. Microbial abundance as an indicator of soil carbon and nitrogen nutrient in permafrost peatlands. Ecol. Indic. 2020, 115, 106362. [Google Scholar] [CrossRef]
  11. Wang, X.W.; Tan, W.W.; Song, C.C.; Du, Y.; Zhang, H.; Chen, N. Characteristics of soil properties and microbial respiration activities in riparian forest wetland in permafrost region of northern Greater Khingan Mountains, China. Chin. J. Appl. Ecol. 2021, 32, 4237–4246. [Google Scholar]
  12. Liang, Y.; Ganzhu, Z.B.; Cao, X.J.; Zhang, W.N.; Zhang, Y.; Li, W.H.; Gao, Q.Z.; Wan, Y.F.; Li, Y.E.; Danjiu, L.N.; et al. Effects of simulated nitrogen deposition on greenhouse gas emissions from alpine meadows in northern Tibet. Acta Ecol. Sin. 2017, 37, 485–494. [Google Scholar]
  13. Meng, H.N.; Song, C.C.; Miao, Y.Q.; Mao, R.; Wang, X.W. Response of CH4 emissions to moss removal and N addition in boreal peatland of northeast China. Biogeosciences 2014, 11, 4809–4816. [Google Scholar] [CrossRef]
  14. Zhao, C.; Peng, S.; Ruan, H.H.; Zhang, Y.K. Effects of nitrogen deposition on soil microbes. J. Nanjing Forest. Univ. (Nat. Sci. Ed.) 2015, 39, 149–155. [Google Scholar]
  15. Ramirez, K.S.; Craine, J.M.; Fierer, N. Consistent effects of nitrogen amendments on soil microbial communities and processes across biomes. Glob. Chang. Biol. 2012, 18, 1918–1927. [Google Scholar] [CrossRef]
  16. Wallenstein, M.D.; McNulty, S.; Fernandez, I.J.; Boggs, J.; Schlesinger, W.H. Nitrogen fertilization decreases forest soil fungal and bacterial biomass in three long-term experiments. For. Ecol. Manag. 2006, 222, 459–468. [Google Scholar] [CrossRef]
  17. Bragazza, L.; Freeman, C.; Jones, T.; Rydin, H.; Limpens, J.; Fenner, N.; Ellis, T.; Gerdol, R.; Hájek, M.; Hájek, T.; et al. Atmospheric nitrogen deposition promotes carbon loss from peat bogs. Proc. Natl. Acad. Sci. USA 2006, 103, 19386–19389. [Google Scholar] [CrossRef]
  18. LeBauer, D.S.; Treseder, K.K. Nitrogen limitation of net primary productivity in terrestrial ecosystems is globally distributed. Ecology 2008, 89, 371–379. [Google Scholar] [CrossRef]
  19. Briones, M.J.; McNamara, N.P.; Poskitt, J.; Crow, S.E.; Ostle, N.J. Interactive biotic and abiotic regulators of soil carbon cycling: Evidence from controlled climate experiments on peatland and boreal soils. Glob. Chang. Biol. 2014, 20, 2971–2982. [Google Scholar] [CrossRef]
  20. Liu, Y.; He, N.; Wen, X.; Yu, G.; Gao, Y.; Jia, Y. Patterns and regulating mechanisms of soil nitrogen mineralization and temperature sensitivity in Chinese terrestrial ecosystems. Agric. Ecosyst. Environ. 2016, 215, 40–46. [Google Scholar] [CrossRef]
  21. Sui, X.; Zhang, R.T.; Zhong, H.X.; Xu, N.; Wang, J.F.; Liu, Y.Z.; Yuan, H.F.; Ni, H.W. Study of soil bacterial diversity in the Little Leaf Zhang wetland in the Sanjiang Plain using high-throughput sequencing. Soil 2015, 47, 919–925. [Google Scholar]
  22. Godin, A.; McLaughlin, J.W.; Webster, K.L.; Packalen, M.; Basiliko, N. Methane and methanogen community dynamics across a boreal peatland nutrient gradient. Soil Boil. Biochem. 2012, 48, 96–105. [Google Scholar] [CrossRef]
  23. Zhang, J.C.; Xu, Y.Q.; Lu, Y.H. Microbial mechanisms of methane production and oxidation in terrestrial ecosystems. Acta Ecol. Sin. 2015, 35, 6592–6603. [Google Scholar]
  24. Liu, L.; Greaver, T.L. A review of nitrogen enrichment effects on three biogenic GHGs: The CO2 sink may be largely offset by stimulated N2O and CH4 emission. Ecol. Lett. 2009, 12, 1103–1117. [Google Scholar] [CrossRef]
  25. Bubier, J.L.; Moore, T.R.; Bledzki, L.A. Effects of nutrient addition on vegetation and carbon cycling in an ombrotrophic bog. Glob. Chang. Biol. 2007, 13, 1168–1186. [Google Scholar] [CrossRef]
  26. Lai, D.Y.F.; Moore, T.R.; Roulet, N.T. Spatial and temporal variations of methane flux measured by autochambers in a temperate ombrotrophic peatland. J. Geophys. Res. Biogeo. 2014, 119, 864–880. [Google Scholar] [CrossRef]
  27. Jiang, I.; Lee, S.; Hong, J.H.; Kang, H.J. Methane oxidation rates in forest soils and their controlling variables: A review and a case study in Korea. Ecol. Res. 2006, 21, 849–854. [Google Scholar] [CrossRef]
  28. Juutinen, S.; Moore, T.R.; Bubier, J.L.; Arnkil, S.; Humphreys, E.; Marincak, B.; Roy, C.; Larmola, T. Long-term nutrient addition increased CH4 emission from a bog through direct and indirect effects. Sci. Rep. 2018, 8, 3838. [Google Scholar] [CrossRef]
  29. Li, Q.; Peng, C.H.; Zhang, J.B.; Li, Y.F.; Song, X.Z. Nitrogen addition decreases methane uptake caused by methanotroph and methanogen imbalances in a Moso bamboo forest. Sci. Rep. 2021, 11, 1–14. [Google Scholar] [CrossRef]
  30. Lohila, A.; Aurela, M.; Hatakka, J.; Pihlatie, M.; Minkkinen, K.; Penttilä, T.; Laurila, T. Responses of N2O fluxes to temperature, water table and N deposition in a northern boreal fen. Eur. J. Soil Sci. 2010, 61, 651–661. [Google Scholar] [CrossRef]
  31. Marushchak, M.E.; Pitkämäki, A.; Koponen, H.; Biasi, C.; Seppälä, M.; Martikainen, P.J. Hot spots for nitrous oxide emissions found in different types of permafrost peatlands. Glob. Chang. Biol. 2011, 17, 2601–2614. [Google Scholar] [CrossRef]
  32. Morales, S.E.; Jha, N.; Saggar, S. Biogeography and biophysicochemical traits link N2O emissions, N2O emission potential and microbial communities across New Zealand pasture soils. Soil Biol. Biochem. 2015, 82, 87–98. [Google Scholar] [CrossRef]
  33. Voigt, C.; Marushchak, M.E.; Lamprecht, R.E.; Jackowicz-Korczyński, M.; Lindgren, A.; Mastepanov, M.; Granlund, L.; Christensen, T.R.; Tahvanainen, T.; Martikainen, P.J.; et al. Increased nitrous oxide emissions from Arctic peatlands after permafrost thaw. Proc. Natl. Acad. Sci. USA 2017, 114, 6238–6243. [Google Scholar] [CrossRef] [PubMed]
  34. Zhang, R.T.; Ni, H.W.; Liu, W.N.; Fu, X.Y.; Wang, J.B. Effects of apoplankton addition and removal treatments on greenhouse gas emissions in the growing season of Little Leaf Zhang wetland in the Sanjiang Plain. J. Environ. Sci. 2020, 40, 1467–1475. [Google Scholar]
  35. Zhou, Y.F.; Nie, J.W.; Wang, Y.J.; Liu, Z.Y.; Zhu, B. Effect of nitrogen application level on abundance and community structure of paddy soil bacteria under rice-rice-Chinese milk vetch (Astragalus sinicus L.) cropping system. J. Agr. Res. Environ. 2018, 35, 508–517. [Google Scholar]
  36. Song, Y.; Song, C.; Hou, A.; Sun, L.; Wang, X.; Ma, X.; Jiang, L.; Liu, C.; Gao, J. Temperature, soil moisture, and microbial controls on CO2 and CH4 emissions from a permafrost peatland. Environ. Prog. Sustain. Energy 2021, 40, e13693. [Google Scholar] [CrossRef]
  37. Jiang, L.; Song, Y.Y.; Sun, L.; Song, C.C.; Wang, X.W.; Ma, X.Y.; Liu, C.; Gao, J.L. Effects of warming on carbon emission and microbial abundances across different soil depths of a peatland in the permafrost region under anaerobic condition. Appl. Soil Ecol. 2020, 156, 103712. [Google Scholar] [CrossRef]
  38. Gao, S.Q.; Song, Y.Y.; Song, C.C.; Ma, X.Y.; Jiang, L. Effects of warming and exogenous carbon input on the abundance of key microbial functional genes of carbon-nitrogen cycle in peatland soil. Acta Ecol. Sin. 2020, 40, 4617–4627. [Google Scholar]
  39. Graham, D.W.; Trippett, C.; Dodds, W.K.; O’Brien, J.M.; Banner, E.B.; Head, I.M.; Smith, M.S.; Yang, R.Y.; Knapp, C.W. Correlations between in situ denitrification activity and nir-gene abundances in pristine and impacted prairie streams. Environ. Pollut. 2010, 158, 3225–3229. [Google Scholar] [CrossRef]
  40. Pajares, S.; Merino-Ibarra, M.; Macek, M.; Alcocer, J. Vertical and seasonal distribution of picoplankton and functional nitrogen genes in a high-altitude warm-monomictic tropical lake. Freshwater Biol. 2017, 62, 1180–1193. [Google Scholar] [CrossRef]
  41. Novak, M.; Gebauer, G.; Thoma, M.; Curik, J.; Stepanova, M.; Jackova, I.; Buzek, F.; Barta, J.; Santruckova, H.; Fottova, D.; et al. Denitrification at two nitrogen-polluted, ombrotrophic Sphagnum bogs in Central Europe: Insights from porewater N2O-isotope profiles. Soil Boil. Biochem. 2015, 81, 48–57. [Google Scholar] [CrossRef]
  42. Ma, X.Y.; Jiang, L.; Song, Y.Y.; Zhang, L.; Song, C.C.; Hou, A.X.; Goa, J.L.; Du, Y. Effects of temperature and moisture changes on functional gene abundance of soil nitrogen cycle in permafrost peatland. Acta Ecol. Sin. 2021, 41, 6707–6717. [Google Scholar]
  43. Song, Y.Y.; Liu, C.; Song, C.C.; Wang, X.W.; Ma, X.Y.; Gao, J.L.; Gao, S.Q.; Wang, L. Linking soil organic carbon mineralization with soil microbial and substrate properties under warming in permafrost peatlands of Northeastern China. Catena 2021, 203, 105348. [Google Scholar] [CrossRef]
  44. Alexandrov, G.A.; Brovkin, V.A.; Kleinen, T.; Yu, Z. The capacity of northern peatlands for long-term carbon sequestration. Biogeosciences 2020, 17, 47–54. [Google Scholar] [CrossRef]
  45. Hugelius, G.; Strauss, J.; Zubrzycki, S.; Harden, J.W.; Schuur, E.A.G.; Ping, C.L.; Schirrmeister, L.; Grosse, G.; Michaelson, G.J.; Koven, C.D.; et al. Estimated stocks of circumpolar permafrost carbon with quantified uncertainty ranges and identified data gaps. Biogeosciences 2014, 11, 6573–6593. [Google Scholar] [CrossRef]
  46. Mishra, U.; Hugelius, G.; Shelef, E.; Yang, Y.; Strauss, J.; Lupachev, A.; Harden, J.W.; Jastrow, J.D.; Ping, C.L.; Riley, W.J.; et al. Spatial heterogeneity and environmental predictors of permafrost region soil organic carbon stocks. Sci. Adv. 2021, 7, eaaz5236. [Google Scholar] [CrossRef]
  47. Ward, S.E.; Bardgett, R.D.; McNamara, N.P.; Adamson, J.K.; Ostle, N.J. Long-term consequences of grazing and burning on northern peatland carbon dynamics. Ecosystems 2007, 10, 1069–1083. [Google Scholar] [CrossRef]
  48. Song, Y.Y.; Song, C.C.; Li, Y.C.; Hou, C.C.; Yang, G.S.; Zhu, X.Y. Short-term effect of nitrogen addition on litter and soil properties in Calamagrostis angustifolia freshwater marshes of Northeast China. Wetlands 2013, 33, 505–513. [Google Scholar] [CrossRef]
  49. Dong, X.; Liu, C.; Ma, D.; Wu, Y.; Man, H.; Wu, X.; Li, M.; Zang, S. Organic carbon mineralization and bacterial community of active layer soils response to short-term warming in the Great Hing’an Mountains of northeast China. Front. Microbiol. 2021, 12, 802213. [Google Scholar] [CrossRef]
  50. Lu, B.Q.; Song, L.Q.; Zang, S.Y.; Wang, H.X. Warming promotes soil CO2 and CH4 emissions but decreasing moisture inhibits CH4 emissions in the permafrost peatland of the Great Xing’an Mountains. Sci. Total Environ. 2022, 829, 154725. [Google Scholar] [CrossRef]
  51. Song, L.Q.; Zang, S.Y.; Lin, L.; Lu, B.Q.; Sun, C.F.; Jiao, Y.Q.; Wang, H.X. Responses of nitrous oxide fluxes to autumn freeze–thaw cycles in permafrost peatlands of the Da Xing’an Mountains, Northeast China. Environ. Sci. Poll. R. 2022, 29, 31700–31712. [Google Scholar] [CrossRef] [PubMed]
  52. Wang, X.; Song, C.; Wang, J.; Miao, Y.; Mao, R.; Song, Y. Carbon release from Sphagnum peat during thawing in a montane area in China. Atmos. Environ. 2013, 75, 77–82. [Google Scholar] [CrossRef]
  53. Yu, G.R.; Jia, Y.L.; He, N.P.; Zhu, J.X.; Chen, Z.; Wang, Q.F.; Piao, S.L.; Liu, X.J.; He, H.L.; Guo, X.B.; et al. Stabilization of atmospheric nitrogen deposition in China over the past decade. Nat. Geosci. 2019, 12, 424–429. [Google Scholar] [CrossRef]
  54. Mo, J.M.; Zhang, W.; Zhu, W.X.; Gundersen, P.; Fang, Y.T.; Li, D.J.; Wang, H. Nitrogen addition reduces soil respiration in a mature tropical forest in southern China. Glob. Chang. Biol. 2008, 14, 403–412. [Google Scholar] [CrossRef]
  55. Wang, Q.F.; Ma, M.C.; Jiang, X.; Guan, D.W.; Wei, D.; Zhao, B.S.; Chen, S.F.; Cao, F.M.; Li, L.; Yang, X.H.; et al. Impact of 36 years of nitrogen fertilization on microbial community composition and soil carbon cycling-related enzyme activities in rhizospheres and bulk soils in northeast China. Appl. Soil Ecol. 2019, 136, 148–157. [Google Scholar] [CrossRef]
  56. Lang, M.; Cai, Z.; Chang, S.X. Effects of land use type and incubation temperature on greenhouse gas emissions from Chinese and Canadian soils. J. Soils Sediments. 2011, 11, 15–24. [Google Scholar] [CrossRef]
  57. Liu, C.S.; Zhao, D.F.; Ma, W.J.; Guo, Y.D.; Wang, A.J.; Wang, Q.L.; Lee, D.J. Denitrifying sulfide removal process on high-salinity wastewaters in the presence of Halomonas sp. Appl. Microbiol. Biot. 2016, 100, 1421–1426. [Google Scholar] [CrossRef]
  58. Ge, S.X.; Shi, F.M.; Pei, J.H.; Hou, Z.H.; Zong, S.X.; Ren, L.L. Gut Bacteria Associated with Monochamus saltuarius (Coleoptera: Cerambycidae) and Their Possible Roles in Host Plant Adaptations. Front. Microbiol. 2021, 12, 687211. [Google Scholar] [CrossRef]
  59. Wang, H.; Yang, J.P.; Yang, S.H.; Yang, Z.C.; Lv, Y.M. Effect of a 10 °C-elevated temperature under different water contents on the microbial community in a tea orchard soil. Eur. J. Soil. Biol. 2014, 62, 113–120. [Google Scholar] [CrossRef]
  60. Steinberg, L.M.; Regan, J.M. mcrA-targeted real-time quantitative PCR method to examine methanogen communities. Appl. Environ. Microbio. 2009, 75, 4435–4442. [Google Scholar] [CrossRef]
  61. Holmes, A.J.; Roslev, P.; McDonald, I.R.; Iversen, N.; Henriksen, K.A.J.; Murrell, J.C. Characterization of methanotrophic bacterial populations in soils showing atmospheric methane uptake. Appl. Environ. Microbio. 1999, 65, 3312–3318. [Google Scholar] [CrossRef] [PubMed]
  62. Petersen, D.G.; Blazewicz, S.J.; Firestone, M.; Herman, D.J.; Turetsky, M.; Waldrop, M. Abundance of microbial genes associated with nitrogen cycling as indices of biogeochemical process rates across a vegetation gradient in Alaska. Environ. Microbiol. 2012, 14, 993–1008. [Google Scholar] [CrossRef] [PubMed]
  63. Braker, G.; Fesefeldt, A.; Witzel, K.P. Development of PCR primer systems for amplification of nitrite reductase genes (nirK and nirS) to detect denitrifying bacteria in environmental samples. Appl. Environ. Microbio. 1998, 64, 3769–3775. [Google Scholar] [CrossRef] [PubMed]
  64. Meng, H.; Zhou, Z.C.; Wu, R.N.; Wang, Y.F.; Gu, J.D. Diazotrophic microbial community and abundance in acidic subtropical natural and re-vegetated forest soils revealed by high-throughput sequencing of nifH gene. Appl. Microbiol. Biot. 2019, 103, 995–1005. [Google Scholar] [CrossRef] [PubMed]
  65. Kan, J.B.; Li, L.N.; Qu, D.; Wang, B.L. Changes in bacterial abundance and community structure associated with flooding in paddy soil. Biodivers. Sci. 2014, 22, 508–515. [Google Scholar]
  66. Liu, X.; Li, Q.; Tan, S.; Wu, X.; Song, X.; Gao, H.; Han, Z.; Jia, A.; Liang, G.; Li, S. Evaluation of carbon mineralization and its temperature sensitivity in different soil aggregates and moisture regimes: A 21-year tillage experiment. Sci. Total Environ. 2022, 837, 155566. [Google Scholar] [CrossRef]
  67. Fissore, C.; Giardina, C.P.; Kolka, R.K. Reduced substrate supply limits the temperature response of soil organic carbon decomposition. Soil Biol. Biochem. 2013, 67, 306–311. [Google Scholar] [CrossRef]
  68. Fang, C.; Smith, P.; Moncrieff, J.B.; Smith, J.U. Similar response of labile and resistant soil organic matter pools to changes in temperature. Nature 2005, 433, 57–59. [Google Scholar] [CrossRef]
  69. Song, C.C.; Zhang, L.H.; Wang, Y.Y.; Zhao, Z.Y. Annual Dynamics of CO2, CH4, N2O Emissions from freshwater marshes and affected by nitrogen fertilization. Environ. Sci. 2006, 27, 2369–2375. [Google Scholar]
  70. Li, Q.; Song, X.Z.; Chang, S.X.; Peng, C.H.; Xiao, W.F.; Zhang, J.B.; Xiang, W.H.; Li, Y.; Wang, W. Nitrogen depositions increase soil respiration and decrease temperature sensitivity in a Moso bamboo forest. Agric. For. Meteorol. 2019, 268, 48–54. [Google Scholar] [CrossRef]
  71. Meng, W.; Wu, F.; Wang, Z. Controlling factors and critical conditions of carbon sequestration and carbon source processes in wetland ecosystems. Ecol. Environ. Sci. 2011, 20, 1359–1366. [Google Scholar]
  72. Gong, X.; Li, Y.; Wang, X.; Niu, Y.; Lian, J.; Luo, Y. Soil CO2 emission characteristics and hydrothermal factors analysis in growing season of sandy grassland. Ecol. Environ. Sci. 2018, 27, 634–642. [Google Scholar]
  73. Alm, J.; Schulman, L.; Walden, J.; Nykänen, H.; Martikainen, P.J.; Silvola, J. Carbon balance of a boreal bog during a year with an exceptionally dry summer. Ecology 1999, 80, 161–174. [Google Scholar] [CrossRef]
  74. Ballhausen, M.B.; Hewitt, R.; Rillig, M.C. Mimicking climate warming effects on Alaskan soil microbial communities via gradual temperature increase. Sci. Rep. 2020, 10, 8533. [Google Scholar] [CrossRef] [PubMed]
  75. Xiang, X.; Wang, H.; Gong, L.; Liu, Q. Vertical variations and associated ecological function of bacterial communities from Sphagnum to underlying sediments in Dajiuhu Peatland. Sci. China Earth Sci. 2014, 57, 1013–1020. [Google Scholar] [CrossRef]
  76. Song, Y.; Cheng, X.; Song, C.; Li, M.; Gao, S.; Liu, Z.; Gao, J.; Wang, X. Soil CO2 and N2O emissions and microbial abundances altered by temperature rise and nitrogen addition in active-layer soils of permafrost peatland. Front. Microbiol. 2022, 13, 1093487. [Google Scholar] [CrossRef]
  77. Hyvönen, R.; Ågren, G.I.; Linder, S.; Persson, T.; Cotrufo, M.F.; Ekblad, A.; Freeman, M.; Grelle, A.; Janssens, I.A.; Jarvis, P.G.; et al. The likely impact of elevated [CO2], nitrogen deposition, increased temperature and management on carbon sequestration in temperate and boreal forest ecosystems: A literature review. New Phytol. 2007, 173, 463–480. [Google Scholar] [CrossRef]
  78. Cusack, D.F.; Silver, W.L.; Torn, M.S.; McDowell, W.H. Effects of nitrogen additions on above- and belowground carbon dynamics in two tropical forests. Biogeochemistry 2011, 104, 203–225. [Google Scholar] [CrossRef]
  79. Jang, I.; Lee, S.; Zoh, K.-D.; Kang, H. Methane concentrations and methanotrophic community structure influence the response of soil methane oxidation to nitrogen content in a temperate forest. Soil Biol. Biochem. 2011, 43, 620–627. [Google Scholar] [CrossRef]
  80. Zhang, D.; Mo, L.; Chen, X.; Zhang, L.; Xu, X. Effects of nitrogen addition on soil methane uptake in global forest biomes. Acta Ecol. Sin. 2017, 37, 8254–8263. [Google Scholar]
  81. Leifeld, J.; Wüst-Galley, C.; Page, S. Intact and managed peatland soils as a source and sink of GHGs from 1850 to 2100. Nat. Clim. Chang. 2019, 9, 945–947. [Google Scholar] [CrossRef]
  82. Kuzyakov, Y.; Xu, X. Competition between roots and microorganisms for nitrogen: Mechanisms and ecological relevance. New Phytol. 2013, 198, 656–669. [Google Scholar] [CrossRef] [PubMed]
  83. Reay, D.S.; Nedwell, D.B. Methane oxidation in temperate soils: Effects of inorganic N. Soil Biol. Biochem. 2004, 36, 2059–2065. [Google Scholar] [CrossRef]
  84. Nykänen, H.; Vasander, H.; Huttunen, J.T.; Martikainen, P.J. Effect of experimental nitrogen load on methane and nitrous oxide fluxes on ombrotrophic boreal peatland. Plant Soil 2002, 242, 147–155. [Google Scholar] [CrossRef]
  85. Song, L.; Tian, P.; Zhang, J.B.; Jin, G.Z. Effects of three years of simulated nitrogen deposition on soil nitrogen dynamics and greenhouse gas emissions in a Korean pine plantation of northeast China. Sci. Total Environ. 2017, 609, 1303–1311. [Google Scholar] [CrossRef]
  86. Zhou, X.B.; Lv, X.F.; Tao, Y.; Wu, L.; Havrilla, C.A.; Zhang, Y.M. Divergent responses of nitrous oxide, methane, and carbon dioxide exchange to pulses of nitrogen addition in a desert in Central Asia. Catena 2019, 173, 29–37. [Google Scholar] [CrossRef]
  87. Chen, J.H.; Zhang, Y.J.; Yang, Y.; Tao, T.T.; Sun, X.; Guo, P. Effects of increasing organic nitrogen inputs on CO2, CH4, and N2O fluxes in a temperate grassland. Environ. Pollut. 2021, 268, 115822. [Google Scholar] [CrossRef]
  88. Fu, Z.; Niu, S.; Dukes, J.S. What have we learned from global change manipulative experiments in China? A meta-analysis. Sci. Rep. 2015, 5, 12344. [Google Scholar] [CrossRef]
  89. Cheng, Y.; Zhang, J.B.; Wang, J.; Cai, Z.C.; Wang, S.Q. Soil pH is a good predictor of the dominating N2O production processes under aerobic conditions. J. Plant Nutr. Soil Sci. 2015, 178, 370–373. [Google Scholar] [CrossRef]
  90. Tian, J.; Dungait, J.A.J.; Lu, X.; Yang, Y.; Hartley, I.P.; Zhang, W.; Mo, J.; Yu, G.; Zhou, J.; Kuzyakov, Y. Long-term nitrogen addition modifies microbial composition and functions for slow carbon cycling and increased sequestration in tropical forest soil. Glob. Chang. Biol. 2019, 25, 3267–3281. [Google Scholar] [CrossRef]
  91. Srinivasan, S.; Jnana, A.; Murali, T.S. Modeling Microbial Community Networks: Methods and Tools for Studying Microbial Interactions. Microb. Ecol. 2024, 87, 56. [Google Scholar] [CrossRef] [PubMed]
Figure 1. The experiment sites and Larix gmelini-Sphagnum peatland.
Figure 1. The experiment sites and Larix gmelini-Sphagnum peatland.
Forests 15 01985 g001
Figure 2. Soil CO2, CH4, and N2O average emission rates (a,c,e) and cumulative emissions (b,d,f) under different nitrogen treatments during a 154-day laboratory incubation experiment (the early, middle, and late stages of incubation). The error bars represent the mean ± SD (n = 3). N0, N1, N2, and N4 represent the control, low nitrogen, medium nitrogen, and high nitrogen addition treatments, respectively. Lowercase letters indicate significant differences (p < 0.05) among different nitrogen gradients.
Figure 2. Soil CO2, CH4, and N2O average emission rates (a,c,e) and cumulative emissions (b,d,f) under different nitrogen treatments during a 154-day laboratory incubation experiment (the early, middle, and late stages of incubation). The error bars represent the mean ± SD (n = 3). N0, N1, N2, and N4 represent the control, low nitrogen, medium nitrogen, and high nitrogen addition treatments, respectively. Lowercase letters indicate significant differences (p < 0.05) among different nitrogen gradients.
Forests 15 01985 g002
Figure 3. Soil pH (a) and NH4+-N content (b) under different nitrogen treatments after the 154-day laboratory incubation experiment. The error bars represent the mean ± SD (n = 3). N0, N1, N2, and N4 represent the control, low nitrogen, medium nitrogen, and high nitrogen addition treatments, respectively. Lowercase letters indicate differences between different nitrogen gradients.
Figure 3. Soil pH (a) and NH4+-N content (b) under different nitrogen treatments after the 154-day laboratory incubation experiment. The error bars represent the mean ± SD (n = 3). N0, N1, N2, and N4 represent the control, low nitrogen, medium nitrogen, and high nitrogen addition treatments, respectively. Lowercase letters indicate differences between different nitrogen gradients.
Forests 15 01985 g003
Figure 4. The abundance of microbial functional genes related to the emission of soil CO2 (bacteria (a), fungi (b)) and CH4 (mcrA (c), pmoA (d)) under different nitrogen treatments after the 154-day laboratory incubation experiment. The error bars represent the mean ± SD (n = 3). N0, N1, N2, and N4 represent the control, low nitrogen, medium nitrogen, and high nitrogen addition treatments, respectively. Lowercase letters indicate differences between different nitrogen gradients.
Figure 4. The abundance of microbial functional genes related to the emission of soil CO2 (bacteria (a), fungi (b)) and CH4 (mcrA (c), pmoA (d)) under different nitrogen treatments after the 154-day laboratory incubation experiment. The error bars represent the mean ± SD (n = 3). N0, N1, N2, and N4 represent the control, low nitrogen, medium nitrogen, and high nitrogen addition treatments, respectively. Lowercase letters indicate differences between different nitrogen gradients.
Forests 15 01985 g004
Figure 5. The abundance of microbial functional genes related to the emission of soil N2O (nirS (a), nirK (b) and nifH (c)) under different nitrogen treatments after the 154-day laboratory incubation experiment. The error bars represent the mean ± SD (n = 3). N0, N1, N2, and N4 represent the control, low nitrogen, medium nitrogen, and high nitrogen addition treatments, respectively. Lowercase letters indicate differences between different nitrogen gradients.
Figure 5. The abundance of microbial functional genes related to the emission of soil N2O (nirS (a), nirK (b) and nifH (c)) under different nitrogen treatments after the 154-day laboratory incubation experiment. The error bars represent the mean ± SD (n = 3). N0, N1, N2, and N4 represent the control, low nitrogen, medium nitrogen, and high nitrogen addition treatments, respectively. Lowercase letters indicate differences between different nitrogen gradients.
Forests 15 01985 g005
Figure 6. Spearman’s analysis of the correlation between the cumulative CO2, CH4, and N2O emissions and the abundance of microbial functional genes and substrate properties in the soil (n = 12).
Figure 6. Spearman’s analysis of the correlation between the cumulative CO2, CH4, and N2O emissions and the abundance of microbial functional genes and substrate properties in the soil (n = 12).
Forests 15 01985 g006
Table 1. Primers used for the soil microbiological functional genes.
Table 1. Primers used for the soil microbiological functional genes.
Target GenePrimerSequence (F–R)References
BacteriaEub338
Eub518
ACTCCTACGGGAGGCAGCAG
ATTACCGCGGCTGCTGG
[59]
FungiITS1F
AFP308
CTTGGTCATTTAGAGGAAGTAA
CTTGGTCATTTAGAGGAAGTAA
[43]
mcrAmerA-Mlas
merA-rev
GGTGGTGTMGGDTTCACMCARTA
CGTTCATBGCGTAGTTVGGRTAGT
[60]
pmoAA189F
Mb661R
GGNGACTGGGACTTCTGG
CCGGMGCAACGTCYTTACC
[61]
nirScd3AF
R3cd
GTSAACGTSAAGGARACSGG
GASTTCGGRTGSGTCTTGA
[62]
nirKFlaCu
R3Cu
ATCATGGTSCTGCCGCG
GCCTCGATCAGRTTGTGGTT
[63]
nifHnifH-F
nifH-R
AAAGGYGGWATCGGYAARTCCACCAC
TTGTTSGCSGCRTACATSGCCATCAT
[64]
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Lu, B.; Wu, X.; Song, L.; Sun, L.; Xie, R.; Zang, S. Nitrogen Addition Increased the Greenhouse Gas Emissions of Permafrost Peatland Due to the Abundance of Soil Microbial Functional Genes Increasing in the Great Khingan Mountains, Northeast China. Forests 2024, 15, 1985. https://doi.org/10.3390/f15111985

AMA Style

Lu B, Wu X, Song L, Sun L, Xie R, Zang S. Nitrogen Addition Increased the Greenhouse Gas Emissions of Permafrost Peatland Due to the Abundance of Soil Microbial Functional Genes Increasing in the Great Khingan Mountains, Northeast China. Forests. 2024; 15(11):1985. https://doi.org/10.3390/f15111985

Chicago/Turabian Style

Lu, Boquan, Xiaodong Wu, Liquan Song, Li Sun, Ruifeng Xie, and Shuying Zang. 2024. "Nitrogen Addition Increased the Greenhouse Gas Emissions of Permafrost Peatland Due to the Abundance of Soil Microbial Functional Genes Increasing in the Great Khingan Mountains, Northeast China" Forests 15, no. 11: 1985. https://doi.org/10.3390/f15111985

APA Style

Lu, B., Wu, X., Song, L., Sun, L., Xie, R., & Zang, S. (2024). Nitrogen Addition Increased the Greenhouse Gas Emissions of Permafrost Peatland Due to the Abundance of Soil Microbial Functional Genes Increasing in the Great Khingan Mountains, Northeast China. Forests, 15(11), 1985. https://doi.org/10.3390/f15111985

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop