Next Article in Journal
Determinants of Financial Viability of Forest Concession in Brazilian Amazon
Previous Article in Journal
Collaborative Governance of Stakeholders in the Payment for Forest Ecosystem Services: An SA-SNA-EGA Approach
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Transcriptomic and Proteomic Integration Reveals Key Tapping-Responsive Factors for Natural Rubber Biosynthesis in the Rubber Tree Hevea brasiliensis

1
Key Laboratory for Ecology of Tropical Islands, Ministry of Education, College of Life Sciences, Hainan Normal University, Haikou 571158, China
2
College of Agriculture and Forestry Ecology, Shaoyang University, Shaoyang 422000, China
3
Key Laboratory of Plant Resources Conservation and Germplasm Innovation in Mountainous Region, Ministry of Education, College of Life Sciences, Guizhou University, Guiyang 550025, China
*
Author to whom correspondence should be addressed.
Forests 2024, 15(10), 1807; https://doi.org/10.3390/f15101807
Submission received: 2 September 2024 / Revised: 11 October 2024 / Accepted: 13 October 2024 / Published: 16 October 2024
(This article belongs to the Section Genetics and Molecular Biology)

Abstract

Natural rubber is a crucial industrial material, and it is primarily harvested from the latex of the rubber tree Hevea brasiliensis by tapping the tree trunk. During the regular tapping process, mechanical damage seriously affects latex reproduction and rubber yield, but the molecular mechanisms on tapping stimulation remain unclear. In this study, we firstly determined the changed physiological markers on latex regeneration, overall latex yield, and latex flow time during the tapping process. Then, we combined proteomics and transcriptomics analyses of latex during tapping and identified 3940 differentially expressed genes (DEGs) and 193 differentially expressed proteins (DEPs). Among them, 773 DEGs and 120 DEPs displayed a persistent upregulation trend upon tapping. It is interesting that, in the detected transcription factors, basic helix-loop-helix (bHLH) family members occupied the highest proportion among all DEGs, and this trend was similarly observed in DEPs. Notably, 48 genes and 34 proteins related to natural rubber biosynthesis were identified, and most members of small rubber particle protein (SRPP) and rubber elongation factor (REF) showed a positive response to tapping stimulation. Among them, SRPP6 and REF5 showed significant and sustained upregulation at the gene and protein levels following tapping, indicating their pivotal roles for post-tapping rubber biosynthesis. Our results deepen the comprehension of the regulation mechanism underlying tapping and provide candidate genes and proteins for improving latex production in the Hevea rubber tree in future.

1. Introduction

The Hevea rubber tree (Hevea brasiliensis) is a tropical perennial plant species indigenous to the Amazon basin. It stands as the most economically significant tropical crop in many tropical countries, serving as the primary source of the world’s natural rubber supply [1]. Natural rubber (cis-1,4-polyisoprene) is an indispensable source for global industry due to its exceptional physical properties [2]. The production of natural rubber is only from the Hevea rubber latex, a complex fluid that is essentially the cytoplasm of laticifer cells, which contain 30–50% natural rubber by dry weight, and the latex is traditionally harvested through a sustainable cutting process of the trunk bark, known as tapping in rubber production [3]. Tapping involves making incisions into the laticiferous vessels in a manner that does not permanently impair the tree, thus allowing for continuous latex outflow over an extended period [4,5]. The tapping process is typically conducted every 2–3 days, which results in extensive mechanical wounding and triggers the release of the cytoplasm from the laticifer cells due to the high turgor pressure within these cells [6]. The subsequent flow of latex ceases naturally after a period of time ranging from several minutes to a few hours post-tapping, because of the formation of a plug at the wounded site of the laticifer [7]. Various biotic and abiotic stresses, including drought, salinity, temperature fluctuations, tapping, and pathogen attacks, significantly influence latex production. Among these, mechanical wounding that is incurred during the tapping process is a pivotal factor affecting the yield of latex [3]. After tapping, rRNA and proteins are expelled from the laticifer cells, necessitating their re-synthesis prior to the subsequent tapping cycle to ensure the ongoing production of latex [6]. Latex regeneration is a sophisticated molecular reconstruction process that is initiated by the latex flow and involves not only the de novo synthesis of proteins but also the reconstitution of lost organelles, such as rubber particles, lutoids, and ribosomes [8]. Available data indicate that several genes implicated in rubber biosynthesis and transcriptional complex genes exhibited significant fluctuations during the latex flow [9]. After tapping, the Hevea rubber tree triggers a series of complex biological responses in many metabolic pathways to counteract the mechanical damage and restores its normal metabolic functions [10]. Following the physical injury inflicted by tapping, the rubber tree activates its defense mechanisms, including the production of defense-related genes and enzymes, as well as many compounds, such as phenolic compounds, lignin, and other secondary metabolites [11]. It also engages stress-related signaling pathways, and some of them are mediated by plant hormones like jasmonic acid (JA) and ethylene [12]. Tapping was found to stimulate the expression of genes and proteins associated with the natural rubber biosynthesis (NRB) pathway. Studies have indicated that tapping can enhance the expression of key enzymes in the mevalonate (MVA) and 2-C-methyl-D-erythritol 4-phosphate (MEP) pathways, thereby augmenting the production of isoprenoid precursors [13]. Furthermore, tapping can also activate genes directly involved in rubber biosynthesis, such as rubber elongation factor (REF) and small rubber particle protein (SRPP) [3]. Following tapping, energy metabolism pathways, including glycolysis, the tricarboxylic acid (TCA) cycle, and oxidative phosphorylation, are also upregulated to support wound repair and rubber biosynthesis [14,15].
Natural rubber, the isoprenoid family of plant natural products, can be synthesized through the cytosolic MVA pathway and the chloroplast MEP pathway in rubber-producing plants [13,16,17]. These pathways involve a multitude of enzymes and proteins that catalyze the sequential steps leading to the production of the basic carbon skeleton of isoprenoids, isopentenyl diphosphate (IPP) [18]. The NRB pathway can be delineated into three principal stages. Initially, IPP are synthesized via the MVA and MEP pathways, respectively. Subsequently, IPP undergoes sequential condensation reactions to produce geranyl diphosphate (GPP), farnesyl diphosphate (FPP), and geranylgeranyl pyrophosphate (GGPP) [19]. During the terminal phases of NRB, IPP molecules are elongated through a cis-polymerization reaction, resulting in the formation of high molecular weight rubber hydrocarbons [20]. The enzyme cis-prenyl transferase (CPT) plays pivotal roles in the biosynthesis of cis-1,4-polyisoprene, catalyzing the cis-1,4-condensation of IPP with FPP and its elongating prenyl chains [21]. In addition, this process is significantly facilitated by the action of REF, in collaboration with SRPP [22,23]. In the Hevea rubber tree, SRPP and REF are two proteins closely related to rubber biosynthesis. They play a crucial role in the synthesis and stabilization of rubber particles, and showed a direct connection to the physiological responses after tapping [24]. During tapping, latex flows out from the laticifer cells of the Hevea rubber tree, containing various proteins, including SRPP and REF. Studies have shown that the expression levels of genes related to rubber biosynthesis, such as HbREFs and HbSRPPs, can be induced after tapping [15]. The increased expression of these genes is accompanied by enhanced protein synthesis efficiency and increased latex metabolic activity [10]. Exogenously applied ethylene and JA treatments can also promote rubber production in the Hevea rubber trees, which may be closely related to the upregulation of the expression of the rubber particle proteins REF and SRPP associated with rubber biosynthesis [3,12]. Furthermore, the REF/SRPP gene family in rubber trees has undergone significant evolutionary expansion, forming large gene clusters, and has differentiated members whose expression is significantly induced by tapping stress [25]. These abundant members are specifically expressed in the latex of laticifer cells, and their expression is positively correlated with rubber production capacity [3]. These results demonstrated that the emergence of the REF/SRPP gene cluster and the functional differentiation specific to laticifers are key driving forces in the evolution of rubber-producing traits in plants [25].
Tapping is intricately connected to the dynamics of latex regeneration, overall latex yield, and the temporal variations in latex flow in the Hevea rubber tree. A comprehensive examination of the transcriptomic and proteomic profiles of genes and proteins relevant to latex metabolism at different stages of latex flowing may reveal novel regulatory mechanisms underlying latex regeneration. Therefore, we conducted a comprehensive analysis by integrating high-throughput transcriptomics and proteomics methods for the latex after tapping of the Hevea rubber tree. A targeted assessment was conducted on the genes and proteins involved in NRB throughout the latex flow interval post-harvest. Our findings in this study may provide more detailed insights into the transcriptomic and proteomic landscape of latex metabolism, offering a deeper understanding of the underlying mechanisms of latex regeneration and latex flow in the Hevea rubber tree.

2. Materials and Methods

2.1. Plant Material Collection

Hevea brasiliensis clone Reyan 7-33-97 was grown at the experimental farm in Tunchang county (Hainan, China). The virgin trees were planted for ten years and were first subjected to tapping. Thirty trees were selected from a stand that were never tapped for latex collection. First, these plants were tapped to collect latex for a negative control. According to S/2 d3 (tapping half of the spiral once in three days frequency) harvesting system for the rubber tree and our previous report [26], the other latex samples were collected after 1, 3, and 5 days later. The latex samples collected from the plants at days 0, 1, 3, and 5 were termed T1, T2, T3, and T4, respectively. These trees were tapped for latex collection using a half spiral pattern (S/2). After tapping, the first 10 drops were discarded. Subsequent latex drops were collected in ice-chilled glass beakers and stored at −80 °C for transcriptome and proteome analyses. The latex of every five trees was pooled as one biological replicate, and three biological replicates for each time point were prepared.

2.2. Determination of Latex Physiological Parameters

After S/2 tapping, the latex flow time for each rubber tree was subsequently recorded; latex was collected from the first droplet that emerged, with a timer initiated at that moment. The flow of latex was deemed to have ceased when no droplets were observed for a duration of 10 s. Concurrently, all the collected latex from each tree was poured into a measuring cylinder to determine the volume of latex discharged, representing the total latex yield. The freshly collected latex was weighed to obtain its fresh weight (FW). Then, the latex was placed in an oven set at 60 °C for drying until a constant weight was achieved, which typically took approximately 72 h. Dry weight (DW) at this stage was recorded. Dry rubber content (DRC) was then calculated using the following formula: DRC = (DW/FW) × 100% [26].

2.3. cDNA Library Construction and Transcriptomic Data Analysis

Total RNA was extracted from rubber tree latex using the RNAprep Pure Plant Plus Kit (Tiangen Biotech, Beijing, China), following the manufacturer’s instructions. Subsequently, the quality of the RNA was assessed using the Nanodrop one (Thermo Scientific, Waltham, MA, USA) and the Agilent Bioanalyzer 2100 system (Palo Alto, CA, USA). Only with high-quality nucleic acid samples that met the following criteria were used for constructing the RNA-Seq library: OD260/280 = 1.8–2.2, OD260/230 ≥ 2.0, RIN ≥ 6.5, 28S:18S ≥ 1.0. Subsequently, the high-quality RNA was employed in the construction of cDNA libraries, which were sequenced on an Illumina NovaSeq Platform (Benagen, Wuhan, China). Then, the raw reads were subjected to processing and evaluation. The resulting high-quality clean reads were obtained by filtering the raw data through the fastp software (version 0.21.0). A genome index was constructed, and the filtered reads were aligned against the Hevea rubber tree genome (https://www.ncbi.nlm.nih.gov/datasets/genome/GCA_010458925.1/ accessed on 16 April 2022) using Star (version 2.7.9a) [27]. To ensure an accurate representation of the expression levels of each gene, the read counts were converted to Fragments Per Kilobase of transcript per Million mapped reads (FPKM). Identification of differentially expressed genes (DEGs) was conducted using DESeq2 (1.26.0) between each pair of groups and the resulting p values were adjusted by controlling for the false discovery rate (FDR). Genes with the criterion fold change >2 or <0.5 (q < 0.05) were considered as DEGs.

2.4. Protein Extraction, Protein Digestion, and Data Analysis

The extraction of proteins was conducted in accordance with our previously described protocol [28]. In short, the fresh latex was homogenized in the extraction buffer (100 mM EDTA, 100 mM Tris (pH 8.0), 50 mM Borax, 50 mM Vitamin C, 1% PVPP (w/v), 1% Triton X-100 (v/v), 2% β-mercaptoethanol (v/v), and 30% sucrose (w/v)) in a ratio of 1:1. Then, these mixtures were vortexed vigorously for 10 min at room temperature. Subsequently, equal volumes of Tris-saturated phenol (pH 8.0) were added into the mixtures and centrifuged at 12,000× g for 20 min with 4 °C. The phenol-based upper phase was transferred to a new centrifuge tube. Proteins were precipitated by adding 5 volumes of ammonium sulfate saturated-methanol, and incubating at −20 °C over-night. The protein pellet was rinsed with ice-cold methanol followed by ice-cold acetone twice, and spun down at 12,000× g for 20 min at 4 °C after each washing. Finally, the washed pellet was air-dried and recovered with Lysis buffer (7 M urea, 2 M thiourea, 2% CHAPS, 13 mM DTT, 1% IPG buffer). Total protein concentration was determined using Bradford assay. An equal quantity of protein from each sample (approximately 300 μg) was subjected to tryptic digestion. Following digestion, peptides were desalted using C18 columns, and the desalted peptides were dried with a vacuum concentrator. Then, the samples were analyzed using the Thermo Scientific Orbitrap Exploris 480 (Thermo Scientific, Waltham, MA, USA). Subsequently, the raw data were processed using the Proteome Discoverer 2.4 software. Trypsin was selected as the enzyme for specific cleavage, with the capacity for up to two absent cleavages. Mass errors for precursor ions and fragment ions were set at 10 ppm and 0.02 Da, respectively. In terms of protein quantification, a protein was required to include at least two unique peptides. Identification of differentially expressed proteins (DEPs) was conducted using the Student’s t-test between each pair of groups and the resulting p values were adjusted by controlling for the FDR. Proteins with a fold change >1.5 or <0.67 (q < 0.05) were considered DEPs.

2.5. Bioinformatic and Statistical Analysis

Trend analysis allows for the categorization of genes and proteins that exhibit similar patterns of variation. In this study, we utilized the OmicShare platform’s analytical tools (https://www.omicshare.com/tools/home/report/reporttrend.html accessed on 24 March 2024) to conduct the trend analysis. Statistical significance was determined at a threshold of p < 0.05. The decision to select 20 trends was made for the analysis.
DEGs and DEPs were annotated using the Gene Ontology (GO, http://www.geneontology.org/ accessed on 10 March 2024) and Kyoto Encyclopedia of Genes and Genomes (KEGG, http://www.genome.jp/kegg accessed on 12 March 2024) databases. Moreover, hypergeometric tests were employed to assess the GO and KEGG enrichment analysis of DEGs/DEPs. Ultimately, the calculated p-values were adjusted using FDR, with a threshold set at q-value ≤ 0.05. Pathways that fulfilled this criterion were designated as significantly enriched in DEGs/DEPs.
The gene/protein expression fold changes of the T2/T1, T3/T1, and T4/T1 values were transformed into log2 format. Then, the relationships between the proteins and genes detected under tapping treatment were constructed using the OmicShare tool (https://www.omicshare.com/tools/home/report/reportjxx.html accessed on 24 March 2024) with the screening criteria q < 0.05 which has adjusted by controlling for the FDR.

2.6. Quantitative Real-Time PCR (qRT-PCR) Verification

Total RNA was extracted from each sample and then subjected to qRT-PCR for validation purposes. Nine DEGs were selected based on careful considerations of their statistical significance and biological relevance within NRB. To ascertain the relative expression levels, the 2−ΔΔCt method was utilized. Actin was employed as a control (forward primer: GATTCCGTTGCCCAGAAGTC; reverse primer: CACCACTCAGCACAATGTTACC). The experiment was conducted in triplicate for each gene.

3. Results

3.1. Physiological and Biochemical Responses under Tapping Stimulation

Latex physiological parameters serve as indicators of the metabolic state of the rubber latex system. We collected latex samples after varying tapping frequencies to analyze their physiological parameters, including fresh latex yield, latex flow time, dry rubber content, and dry rubber matter (Figure 1). Initially, at baseline (T1), the fresh latex yield per plant was only 5.8 ± 1.5 mL. Subsequent tapping at T2, T3, and T4 resulted in yield of 31.2 ± 10.5, 50.9 ± 14.6, and 70.5 ± 22.2 mL per plant, respectively (Figure 1B). These results proved that tapping stimulation can significantly enhance latex regeneration and elevate latex production. Furthermore, as tapping frequency increased, the latex flow time significantly prolonged. The average flow time per plant was 31.3 ± 9.6 min at the first tapping (T1), rising to 75.9 ± 14.1 min at the second tapping (T2), 104.6 ± 20.3 min at the third tapping (T3), and 92.5 ± 13.9 min at the fourth tapping (T4). Intriguingly, a decrease in flow time was observed at the fourth tapping compared to the third, likely attributable to cumulative tapping-induced injury (Figure 1C). A declining trend in dry rubber content was evident with increasing tapping frequency (Figure 1D). In general, tapping injury not only augmented latex flow but also led to an elevation in water content within the latex, signifying that tapping stimulation can boost rubber latex regeneration and enhance water absorption concurrently. As illustrated in Figure 1E, the average dry rubber yield per plant was 3.0 ± 0.8 g after the initial tapping. Subsequent tapping at the second, third, and fourth instances resulted in average dry rubber yields of 15.4 ± 5.2, 25.6 ± 7.3, and 35.6 ± 11.2 g per plant, respectively (Figure 1E). Evidently, tapping-induced injury significantly elevated the dry rubber yield in the latex. In short, a significant increase in latex yield and dry rubber matter with an increase in tapping frequency is necessary. Those results demonstrated tapping promoted latex flowing time and regeneration process.

3.2. Transcriptome Analysis

To investigate the rubber production mechanism stimulated after tapping and explore crucial genes associated with rubber biosynthesis, we conducted a transcriptomic analysis for the collected latex samples post-tapping injury. The experiment included biological replicates to reduce variation in gene expression among samples. Similarity analysis of the 12 samples is depicted by principal coordinates analysis (PCoA), and the results revealed distinct differences between treatment groups T1, T2, T3, and T4, with high consistency observed within the three biological replicates for each treatment (Figure 2A). Based on our filtering criteria, a large amount of DEGs following tapping injury (T2/T1, T3/T1, and T4/T1) were identified (Figure 2B and Table S1). Following the initial tapping, the second tapping event (T2/T1) resulted in 6288 DEGs, including 3051 upregulated and 3237 downregulated genes. In the third tapping (T3/T1) latex, 8095 DEGs were identified, with 4046 upregulated genes and 4049 downregulated ones. After the fourth tapping (T4/T1), 8705 DEGs were discovered, comprising 4274 upregulated and 4431 downregulated genes. The increased number of DEGs with tapping frequency escalation suggested a series of transcriptional regulatory responses in rubber trees post-tapping, leading to gene expression alterations. Notably, 3940 DEGs were found consistently across all three post-tapping injury groups, indicating their role as essential genes in rubber tree responses to tapping stimulation. Subsequently, utilizing T1 as the control, genes exhibiting similar expression patterns based on relative expression abundances in T2/T1, T3/T1, and T4/T1 were identified through trend analysis, which categorized gene expression trends into 20 clusters, with each showing different stage-specific patterns (Figure 2C and Table S1). The largest one is cluster 2 with 3289 genes, which exhibited a significant decrease only at the T2 stage, but remained stable at T3 and T4. Cluster 19, with 773 genes, displayed consistent upregulation with increasing tapping frequency, indicating a sustained response to tapping stimulation, while cluster 0 (comprising 2751 genes) exhibited a sustained negative feedback response to tapping.
Transcription factors (TF) play a pivotal role in gene expression regulation within cells, crucial for maintaining cellular functions and normal physiological activities. In this study, all identified DEGs were subjected to TF prediction using the PlantTFDB database, with a statistical analysis of TF family proportions conducted (Figure 2D and Table S1). A total of 5103 TFs distributed across 56 TF families were identified in the transcriptomic data. The most abundant family was bHLH, comprising 481 genes (9%), followed by NAC (349, 7%) and MYB-related (347, 7%) families. Other prominent families included C2H2, AP2/ERF, and C3H, with 304 (6%), 278 (5%), and 254 (5%) genes, respectively.

3.3. Proteome Analysis

PCoA was conducted on the proteomic data that enabled dimensionality reduction for the protein profiles. Our PCoA results revealed distinct separations between samples from different treatments on the coordinate axes, while biological triplicates within each sample clustered closely together (Figure 3A). This clustering signifies the reliability of the protein data in this study, indicating its suitability for subsequent analyses. Based on the criteria for selecting differential proteins, 974 DEPs were identified in T2/T1 post-tapping, with 373 upregulated and 601 downregulated proteins. In T3/T1, 1040 DEPs were detected, with 521 upregulated and 519 downregulated ones. Furthermore, in T4/T1, 1314 DEPs were identified, comprising 427 upregulated and 887 downregulated proteins (Figure 3B and Table S2). The increasing number of identified DEPs with the frequency of tapping suggested a proportional rise, with more proteins exhibiting a negative feedback response compared to those showing a positive feedback response. Subsequently, taking T1 as the reference, proteins with similar expression patterns based on the relative expression abundances in T2/T1, T3/T1, and T4/T1 were identified through trend analysis, categorizing protein expression trends into 20 clusters, each demonstrating stage-specific patterns (Figure 3C and Table S2). The largest cluster, cluster 9, containing 301 proteins, maintained unchanged expression levels in T2 and T3 stages but significantly downregulated in T4. Cluster 19, comprising 120 proteins, displayed consistent upregulation with increasing tapping frequency, indicating a sustained response to tapping stimulation, while cluster 0 (comprising 222 proteins) exhibited a sustained negative feedback response to tapping.
TF prediction was further performed for all identified DEPs based on the statistical analysis of TF family proportions (Figure 3D and Table S2). A total of 797 TFs distributed across 50 TF families were identified in our latex proteomic data. The most abundant family was bHLH, consisting of 81 proteins (10%), followed by NAC (57, 7%) and AP2/ERF (56, 7%) families. Other notable families included MYB-related, FAR1, bZIP, and MYB, with 49 (6%), 43 (5%), 38 (5%), and 36 (5%) proteins, respectively.

3.4. GO and KEGG Enrichment Analysis of DEGs and DEPs

Through trend analysis, we discovered 773 DEGs and 120 DEPs with significant upregulation in expression after tapping, indicating a sustained response to tapping stimulation. This underscores the importance of these DEGs and DEPs in the rubber tree’s response to tapping. Subsequently, to investigate the specific functions of these DEGs and DEPs in the Hevea rubber tree’s response to tapping stimulation and the related biological processes, functional enrichment analysis was conducted on these DEGs and DEPs (Figure 4). GO enrichment revealed that among the top 20 significantly enriched terms for these DEGs all were related to the cellular component category. The most prominent enriched term was “cytoplasm”, with 153 DEGs, followed by “cytoplasmic part” and “intracellular”, with 123 and 228 DEGs, respectively (Figure 4A). In terms of the DEPs, GO enrichment analysis indicated that these proteins were primarily enriched in the biological process category, with 17 significantly enriched terms. The most notable enriched term was “cofactor metabolic process”, comprising 9 DEPs, followed by “coenzyme metabolic process” with 8 DEPs. In cellular component category, there were two significantly enriched terms, namely “cytoplasm” (21 DEPs) and “prefoldin complex” (2 DEPs). In the molecular function category, only one significantly term with 2 DEPs was enriched into triose-phosphate isomerase activity (Figure 4B).
KEGG analysis of these DEGs and DEPs enriched a large number of them into metabolic pathways. Functional modules of DEGs were associated with crucial biological functions such as intracellular protein degradation, lipid metabolism, and nucleic acid metabolism. The most significantly enriched pathway was “oxidative phosphorylation”, encompassing 15 DEGs, followed by “valine, leucine, and isoleucine degradation” with 7 DEGs (Figure 4C). Oxidative phosphorylation is a critical process in cellular respiration, in which energy released from the electron transport chain can be used to synthesize ATP. In NRB, the ATP generated through oxidative phosphorylation serves as the primary energy source for the synthesis of isoprene units, the building blocks of natural rubber. The upregulation of genes involved in NRB pathway suggests an increased energy demand during the rubber biosynthesis process, highlighting the importance of maintaining an efficient energy supply for optimal rubber production. Furthermore, the “valine, leucine, and isoleucine degradation” pathway is involved in the catabolism of branched-chain amino acids, which are known to be precursors for the synthesis of isoprenoids. The degradation of these amino acids generates intermediates that can be channeled into the isoprenoid biosynthetic pathway, thus contributing to the supply of precursors for rubber production. The enrichment of DEGs in this pathway indicates a potential upregulation of isoprenoid biosynthesis, further supporting the role of these amino acids in rubber biosynthesis. The top 20 pathways enriched in these DEPs mainly involved the synthesis and degradation of carbohydrates, amino acids, fatty acids, and secondary metabolites. The most significant pathways included “pyruvate metabolism” and “carbon metabolism” with 6 and 9 DEPs, respectively, and then followed by “tryptophan metabolism” (4 DEPs), “arachidonic acid metabolism” (2 DEPs), “lysine degradation” (3 DEPs), and “glyoxylate and dicarboxylate metabolism” (4 DEPs) (Figure 4D). These enriched functional outcomes provide important clues for further exploring the specific functions of these differential genes and proteins in the Hevea rubber tree’s response to tapping stimulation.

3.5. Genes and Proteins Involved in NRB

In our transcriptomic and proteomic data of the rubber latex, 48 genes and 34 proteins related to NRB were detected, including 29 DEGs and 32 DEPs that respond to tapping injury. The heatmaps were used to compare the patterns of change in these genes and proteins (Figure 5 and Table S3). Within the transcriptome and proteome profiles of this study, MVA pathway was found to contain nine genes (four of which were DEGs) and eight proteins (all of which were DEPs). Among them, ACAT3, HMGR3, HMGR4, and MVK2 responded to tapping stimulation at the gene level, with only MVK2 showing a sustained increase in gene expression post-tapping injury, while the others exhibited a downward trend. ACAT1, ACAT5, HMGS1, and MVD1 only responded to tapping stimulation at the protein level, with their protein expression levels showing an upward trend post-tapping injury. ACAT3 exhibited negative feedback to tapping stimulation at both the gene and protein levels. Overall, members of the MVA pathway primarily exhibited negative feedback to tapping stimulation at the gene level and positive feedback at the protein level. In the MEP pathway, 11 genes were detected, including 10 DEGs, of which five genes (DXS3, CMS2, CMK1, MCS1, MCS2) showed positive feedback to tapping stimulation, while HDS2 and HDR1 exhibited sustained downregulation in expression after multiple tapping sessions. Only five corresponding proteins were obtained from the proteomic data, namely CMS2, MCS2, HDS1, HDR1, and HDR2, with all differential proteins showing positive feedback to tapping stimulation except HDS1, whose protein levels remained unchanged post-tapping injury. CMS2 exhibited positive feedback to tapping stimulation at both the gene and protein levels. Overall, members of the MEP pathway primarily exhibited positive feedback to tapping stimulation at the protein level.
Among these DEPs, four key enzymes, named geranyl pyrophosphate synthase (GPS), geranylgeranyl pyrophosphate synthase (GGPS), farnesyl diphosphate synthase (FPS), and isopentenyl-diphosphate delta-isomerase (IPPI), play crucial roles in the formation of IPP and subsequent rubber molecule polymerization. Apart from FPS1 with a significant upregulation at T3/T1, the other GPSs, GGPSs, FPSs, and IPPIs did not show significant changes in gene expression post-tapping injury. Following tapping, IPPI1 and GGPS1 exhibited sustained upregulation in protein expression levels, while GGPS3 showed sustained downregulation.
IPP molecules extend through a cis-polymerization reaction to form large polymer rubber molecules, requiring four key enzymes. In this study, besides HRT1-REF bridging protein (HRBP), three key enzymes, named SRPP, REF, and CPT, were identified. Ten SRPP genes (seven of which were DEGs) were identified, with SRPP1 and SRPP8 showing sustained significant downregulation post-tapping, while SRPP5 and SRPP6 exhibited sustained response and significant upregulation post-tapping. Eight SRPP proteins (seven of which were DEPs) were identified, with most members showing a strong response post-tapping, and SRPP3, SRPP6, and SRPP10 displaying sustained increase in protein expression levels after tapping, whereas SRPP2, SRPP4, and SRPP9 showed sustained decrease. Six REF genes (four of which were DEGs) were identified, with only REF3 showing significant upregulation at T3/T1, while the rest displayed sustained significant upregulation post-tapping. Five REF proteins (all were DEPs) were identified, with REF1, REF2, and REF5 showing significant upregulation in protein expression post-tapping. Four CPT genes (two of which were DEGs) and two CPT proteins (both DEPs) were identified, with CPT4 showing significant upregulation post-tapping, while CPT9 downregulated post-tapping. CPT7 exhibited upregulation in protein expression post-tapping.

3.6. qRT-PCR Verification

Nine DEGs were chosen with particular attention to their biological roles in the NRB pathway for further validation of their expression patterns by using qRT-PCR (Figure 6). Each gene was evaluated for its known involvement in key processes related to NRB pathway, thus allowing us to gain insightful perspectives on the regulatory mechanisms. Our results indicated that ACAT3, HMGR3, and SRPP8 exhibit negative feedback in response to tapping injury. Moreover, MVK2, SRPP5, SRPP6, REF5, REF6, and REF7 show positive feedback in response to tapping injury, with gene expression levels continuing to increase with the number of tapping sessions. These findings underscored the potentially significant roles these genes play in NRB pathway, particularly in the regulatory processes in response to tapping stimulation.

4. Discussion

4.1. Both MEP and MVA Pathways Are Important for NRB

Latex in the Hevea rubber tree is essentially the cytoplasm of laticifer cells; hence, the metabolic activity and regenerative capacity of rubber tree latex are essential factors determining rubber yield [29,30]. In rubber production, continuous tapping significantly enhances rubber latex yield [31,32]. Many published results indicated that tapping-induced injuries can induce changes in the expression of many genes and proteins in laticifer cells of the Hevea rubber tree [4]. Tapping can be perceived as a form of stress that triggers a complex wound response, leading to the upregulation of genes and proteins related to latex metabolism [10]. On the one hand, the injury caused by tapping can act as a signal for the tree to increase its production of latex. This is achieved through the upregulation of genes and proteins that enhance the biosynthetic pathways leading to rubber production [31]. For instance, the expression of key enzymes in MVA and MEP pathways, which are responsible for the production of isoprenoid precursors, is often increased [13]. Additionally, the upregulation of genes such as REF and SRPP, which are involved in rubber particle formation, can directly contribute to increased latex synthesis [32]. On the other hand, the stress caused by tapping can also lead to a decline in tree health if the injury response is not properly regulated [33]. This can result from the upregulation of genes associated with stress responses, such as those involved in the production of reactive oxygen species (ROS). Excessive ROS can cause oxidative damage to cellular components, including proteins, lipids, and DNA, leading to a decline in overall tree health [15]. Furthermore, the prolonged upregulation of stress-responsive genes can divert resources away from other essential processes, potentially impacting the tree’s growth and development [34]. In plants, terpenoids are crucial secondary metabolites with significant biological functions in plant growth and development [35]. IPP is a key substrate in the biosynthesis of various terpenes, including natural rubber, produced in plants through the MVA pathway in the cytoplasm and the MEP pathway in plastids [13]. MVA pathway primarily provides substrates for the synthesis of sesquiterpenes, triterpenes, and diterpenes, while the MEP pathway is more active in the synthesis of monoterpenes, diterpenes and tetraterpenes [4,36]. Early studies have shown MVA pathway as the route for IPP biosynthesis in natural rubber production, but with advancements in rubber tree genomics and transcriptomics, the MEP pathway has also been considered a potential route for IPP synthesis. However, comparative analysis of the enzyme transcription levels in these two pathways indicates that the MVA pathway is the primary contributor to this rubber precursor [37]. The MVA pathway predominantly occurs in cytosol, which is the primary site for rubber biosynthesis in the laticifer cells of Hevea rubber tree. This spatial proximity allows for efficient utilization of the pathway’s products for rubber synthesis [13]. Although both our transcriptomic and proteomic data in this study demonstrated that the MEP pathway can also contribute to isoprenoid synthesis for NRB, it is traditionally localized in the plastids and is more associated with the production of isoprenoids for photosynthesis and other plastid-related processes [4]. In the laticifer cells of Hevea rubber tree, the MVA pathway is a major supplier of isoprenoid precursors due to its localization and regulatory features [37]. In this study, nine genes (including four DEGs) and eight proteins (all differential proteins) were detected in the MVA pathway, while 11 genes (ten DEGs) and five proteins (four DEPs) were detected as the members for the MEP pathway. Compared to MVA pathway members, the detected members in the MEP pathway exhibited faster and more significant regulatory responses at the gene level to tapping stimulation, suggesting that the MEP pathway may elicit a more sensitive reaction to tapping stimulation. Both MVA and MEP pathway members exhibit a feedback response at the protein level to tapping stimulation, with the members in MEP pathway showing a positive feedback response at the protein level. This indicates the significant roles played by both pathways in response to tapping stimulation in the rubber tree.

4.2. SRPPs and REFs Play Key Roles for NRB

The key enzymes or protein factors involved in rubber biosynthesis are the membrane proteins constituting rubber particles, among which CPT, REF, and SRPP are currently known as the predominant rubber particle proteins, playing crucial roles in the development of rubber particles and rubber biosynthesis [38,39]. They are essential rubber particle proteins determining rubber latex yield and quality [40,41,42]. The rubber particle proteins REF, SRPP, and CPT play significant roles in rubber biosynthesis, not only influencing rubber biosynthetic activity but also closely correlating with latex yield and rubber quality [16,41,42]. Thus, changes in the gene expression of REF, SRPP, and CPT undoubtedly have a significant impact on rubber particles for rubber biosynthetic activity and rubber yield. REF is a tightly bound rubber particle protein that primarily participates in the elongation process of rubber molecules, promoting a cis configuration in the rubber molecule structure [1,26,43], being the most abundantly expressed protein in rubber particles (up to around 60%). SRPP, with abundance second only to REF among rubber particle proteins, is expressed at high levels in latex, located in the same locus on the genome as REF gene [22,44]. In vitro rubber synthesis experiments have shown that SRPP can enhance rubber biosynthesis, potentially interacting with rubber particle proteins such as REF and CPT in a complex [45].
Rubber latex metabolism and regeneration in the laticifer cells of the Hevea rubber tree are the combined result of gene expression, with changes in the expression of rubber biosynthesis-related rubber particle proteins REF and SRPP undoubtedly having a significant impact on rubber biosynthetic activity and latex yield [25,46]. This study observed that, following the stimulation of tapping, the majority of SRPP and REF genes and proteins exhibited significant responses at both the gene and protein levels, indicating their potential regulatory roles in modulating rubber synthesis. SRPP and REF are integral to the stability of rubber particles and the elongation of rubber molecular chains [3]. Their expression is modulated by a variety of internal and external factors, including hormonal influences, environmental stressors (such as temperature and salinity), and nutritional conditions [4,12]. In non-rubber-producing plants, SRPP and REF proteins are associated with stress resilience, which suggests that these proteins may play a pivotal role in enabling plants to adapt to environmental challenges [15]. This research elucidated the essential functions of SRPP and REF in rubber biosynthesis and identified SRPP6 and REF5 as promising candidates potentially linked to rubber yield. These candidates demonstrated sustained and significant upregulation at both gene and protein levels in response to tapping stimulation. Elevating the expression levels of these proteins in rubber trees through genetic engineering presents a promising avenue for enhancing rubber production. Previous study has shown that EuREF1 could influence the expression of genes associated with rubber synthesis, with its expression level affecting chain elongation, particle development, and rubber content in Eucommia ulmoides [41]. Continued exploration of the functions and regulatory mechanisms of HbSRPP6 and HbREF5 could substantially enrich our understanding of their roles in the rubber biosynthetic pathway, thereby offering novel strategies for the enhancement of rubber production.

4.3. TFs Regulatory Genes and Proteins

Plants have a highly developed sensory system that detects and responds to various environmental stresses. By sensing changes in the external environment, plants activate a series of molecular signaling pathways involving a variety of signaling molecules such as phytohormones, reactive oxygen species (ROS) and desiccation signals [47,48]. They activate defense mechanisms through complex signaling pathways to enhance autoimmunity. TFs are known as key regulators in these processes by sensing stress signals and controlling the expression of downstream defense genes to enhance plant defense [12]. TFs play a central role in plant defense mechanisms and can activate or repress the expression of defense-related genes in response to stress signals [34]. For example, WRKY family play an important role in the plant response to pathogens, while MYB family is involved in the regulation of plant secondary metabolism. In the Hevea rubber tree, overexpression of HbMADS4 repressed the activity of the HbSRPP promoter, suggesting that it may play a negative regulatory role in rubber biosynthesis [49]. HbWRKY1 may act as a negative regulator of HbSRPP and influence rubber biosynthesis [28]. In Taraxacum brevicorniculatum, the TbbZIP.1 gene was expressed in latex and its activity was regulated by the concentration of abscisic acid (ABA), suggesting a dual role in rubber biosynthesis and stress adaptation [50]. Environmental stress has an important effect on rubber biosynthesis, and in the Hevea rubber tree, rubber biosynthesis is faster in tissues induced by low temperature, and some DEGs are homologous to DNA-binding proteins or TFs, suggesting that they may be involved in cold-induced rubber biosynthesis [51]. In the Hevea rubber tree, the biosynthesis of latex is typically stimulated by tapping and wounding techniques employed in rubber production, potentially elicited by a multitude of stress signals [52]. HbNAC1, a NAC family transcription factor involved in latex biosynthesis and drought tolerance, binds directly to the CACG motif in the SRPP promoter to regulate gene expression [52]. In this study, we identified four major TF families, named bHLH, NAC, MYB and AP2/ERF, that respond to rubber tree cuttings at the transcriptional and post-transcriptional levels after tapping stimulation. These TF families play a crucial role in regulating the production of secondary metabolites to counteract the effects of stress. Although studies have revealed the role of TFs in plant defense mechanisms, the regulatory role of TFs in secondary metabolism remains complex and incompletely understood. Future studies need to investigate in detail how these transcription factors interact with each other and how they respond to different environmental stresses to gain a more comprehensive understanding of plant defense mechanisms.

5. Conclusions

This study provided a detailed analysis of the transcriptomic and proteomic responses of the latex in the Hevea rubber tree following tapping, and offered valuable insights into the mechanisms of latex regeneration, total latex yield, and latex flow duration. Tapping stimulation resulted in the identification of 3939 DEGs and 193 DEPs, with 773 DEGs and 120 DEPs demonstrating a sustained upregulation trend. Meanwhile, we identified 48 genes and 34 proteins associated with NRB. After tapping, the majority of genes and proteins involved in NRB exhibited significant responses at both the gene and protein levels, notably members of the SRPPs and REFs. Among these, SRPP6 and REF5 displayed significant and sustained upregulation at the gene and protein levels post-tapping, indicating their pivotal roles in NRB after tapping. Our transcriptomic and proteomic integration provided potential target genes and proteins for molecular breeding programs to enhance the latex production through the selection of the Hevea rubber tree. Furthermore, this study identified four major TF families, including bHLH, NAC, MYB, and AP2/ERF families, that respond to tapping stimulation at both transcriptional and post-transcriptional levels. These TFs are crucial for modulating the production of secondary metabolites to combat stress influences. However, this study also has obvious limitations, including the potential influence of environmental factors for the gene and protein expression. Additionally, our analysis primarily focused on specific time points post-tapping, a more comprehensive temporal study could yield deeper insights into the dynamics of latex metabolism. Future studies should include the exploration of the functional roles of the identified DEGs and DEPs through gene-editing technology or overexpression of target genes into the Hevea rubber tree to confirm their roles in latex regeneration and rubber yield. Overall, this study deepens our understanding of latex regeneration mechanisms in the latex of Hevea rubber tree and sets the groundwork for future research aimed at improving rubber yield through informed breeding and tapping strategies.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/f15101807/s1, Table S1: Overview of transcriptome data analysis; Table S2: Overview of proteome data analysis; Table S3: Genes and proteins involved in natural rubber biosynthesis.

Author Contributions

Conceptualization, X.W. and L.H.; methodology, L.H. and J.C.; software, Y.Y.; validation, L.H., J.M. and B.Y.; formal analysis, L.H. and M.W.; investigation, J.M.; resources, X.W.; data curation, F.F., A.L. and L.H.; writing—original draft preparation, L.H.; writing—review and editing, X.W., J.W. and S.H.; visualization, L.H.; supervision, X.W.; project administration, X.W. and L.H.; funding acquisition, X.W. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by the National Key Research and Development Program of China (No. 2021YFA1300401), the Innovation Center for Academicians of Hainan Province and the Specific Research Fund of the Innovation Platform for Academicians of Hainan Province (No. YSPTZX202309) and the Special Fund of Guizhou University (LJ2023-03).

Data Availability Statement

The transcriptome data have been submitted to the China National GeneBank DataBase (CNGBdb) under the accession number CNP0006009, while the proteome data were uploaded to iProX with Project ID IPX0007976002.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Doungmusik, A.; Sdoodee, S. Enhancing the latex productivity of Hevea brasiliensis clone RRIM 600 using ethylene stimulation. J. Agric. Technol. 2012, 8, 2033–2042. [Google Scholar]
  2. Yamashita, S.; Takahashi, S. Molecular mechanisms of natural rubber biosynthesis. Ann. Rev. Biochem. 2022, 89, 821–851. [Google Scholar] [CrossRef] [PubMed]
  3. Chao, J.; Wu, S.; Shi, M.; Xu, X.; Gao, Q.; Du, H.; Gao, B.; Guo, D.; Yang, S.; Zhang, S.; et al. Genomic insight into domestication of rubber tree. Nat. Commun. 2023, 14, 4651–4663. [Google Scholar] [CrossRef] [PubMed]
  4. Long, X.; Fang, Y.; Qin, Y.; Yang, J.; Xiao, X. Latex-specific transcriptome analysis reveals mechanisms for latex metabolism and natural rubber biosynthesis in laticifers of Hevea brasiliensis. Ind. Crops Prod. 2021, 171, 113835. [Google Scholar] [CrossRef]
  5. Shearman, J.R.; Sangsrakru, D.; Ruang-Areerate, P.; Sonthirod, C.; Uthaipaisanwong, P.; Yoocha, T.; Poopear, S.; Theerawattanasuk, K.; Tragoonrung, S.; Tangphatsornruang, S. Assembly and analysis of a male sterile rubber tree mitochondrial genome reveals DNA rearrangement events and a novel transcript. BMC Plant Biol. 2014, 14, 45. [Google Scholar] [CrossRef]
  6. Chen, X.; Deng, Z.; Yu, D.; Zhang, X.; An, Z.; Wu, W.; Liang, Q.; Huang, X.; Huang, H.; Cheng, H. Genome-wide identification and analysis of small nucleolar RNAs and their roles in regulating latex regeneration in the rubber tree (Hevea brasiliensis). Front. Plant Sci. 2021, 12, 731484. [Google Scholar] [CrossRef]
  7. Jaspers, P.; Kangasjarvi, J. Reactive oxygen species in abiotic stress signaling. Physiol. Plant. 2010, 138, 405–413. [Google Scholar] [CrossRef]
  8. Wang, X.C.; Shi, M.J.; Wang, D.; Chen, Y.; Cai, F.; Zhang, S.; Wang, L.; Tong, Z.; Tian, W.M. Comparative proteomics of primary and secondary lutoids reveals that chitinase and glucanase play a crucial combined role in rubber particle aggregation in Hevea brasiliensis. J. Proteome Res. 2013, 12, 5146–5159. [Google Scholar] [CrossRef]
  9. Chow, K.S.; Bahari, A.; Taylor, M.A.; Marshall, D.F. Genomics of rubber biosynthesis in Hevea brasiliensis. In The Rubber Tree Genome; Springer: Cham, Switzerland, 2020; pp. 93–115. [Google Scholar]
  10. Fan, Y.J.; Qi, J.Y.; Xiao, X.H.; Li, H.P.; Lan, J.X.; Huang, Y.C.; Yang, J.H.; Zhang, Y.; Zhang, S.M.; Tao, J.; et al. Transcript and protein profiling provides insights into the molecular mechanisms of harvesting-induced latex production in rubber tree. Front. Genet. 2022, 13, 756270–756284. [Google Scholar] [CrossRef]
  11. Freitas, C.D.T.; Demarco, D.; Oliveira, J.S.; Ramos, M.V. Review: Laticifer as a plant defense mechanism. Plant Sci. 2024, 346, 112136. [Google Scholar] [CrossRef]
  12. Nazri, A.Z.; Ghaffar, M.A.A. Response of the clone RRIM 3001 (Hevea brasiliensis) to three ethephon stimulation treatments and the identification of differentially expressed transcription factors for a water-based stimulant. J. Rubber Res. 2024, 27, 103–114. [Google Scholar] [CrossRef]
  13. Rahman, S.N.A.; Abu Bakar, M.F.; Singham, G.V.; Othman, A.S. Single-nucleotide polymorphism markers within MVA and MEP pathways among Hevea brasiliensis clones through transcriptomic analysis. 3 Biotech 2019, 9, 388. [Google Scholar]
  14. Duangngam, O.; Desalme, D.; Thaler, P.; Kasemsap, P.; Sathornkich, J.; Satakhun, D.; Satakhun, D.; Chayawat, C.; Angeli, N.; Chantuma, P.; et al. In situ 13CO2 labelling of rubber trees reveals a seasonal shift in the contribution of the carbon sources involved in latex regeneration. J. Exp. Bot. 2020, 71, 2028–2039. [Google Scholar] [CrossRef] [PubMed]
  15. Qin, Y.X.; Wang, J.; Fang, Y.J.; Lu, J.L.; Shi, X.Y.; Yang, J.H.; Xiao, X.H.; Luo, X.H.; Long, X.Y. Anaerobic metabolism in Hevea brasiliensis laticifers is relevant to rubber synthesis when tapping is initiated. Ind. Crops Prod. 2022, 178, 114663. [Google Scholar] [CrossRef]
  16. Yamashita, S.; Yamaguchi, H.; Waki, T.; Aoki, Y.; Mizuno, M.; Yanbe, F.; Ishii, T.; Funaki, A.; Tozawa, Y.; Miyagi Inoue, Y.; et al. Identification and reconstitution of the rubber biosynthetic machinery on rubber particles from Hevea brasiliensis. eLife 2016, 5, e19022. [Google Scholar] [CrossRef]
  17. La, V.N.T.; Tran, H.T.D.; Nguyen, C.H.; Nguyen, T.T.H. RNA-seq derived identification of coronatine-regulated genes putatively involved in terpenoid biosynthetic pathway in the rubber tree Hevea brasiliensis. IOP Conf. Ser. Earth Environ. Sci. 2021, 749, 012033. [Google Scholar] [CrossRef]
  18. Li, D.; Wu, S.; Dai, L. Current progress in transcriptomics and proteomics of latex physiology and metabolism in the Hevea brasiliensis rubber tree. In The Rubber Tree Genome; Springer: Cham, Switzerland, 2020; pp. 117–135. [Google Scholar]
  19. Nie, Z.; Kang, G.; Yan, D.; Qin, H.; Yang, L.; Zeng, R. Downregulation of HbFPS1 affects rubber biosynthesis of Hevea brasiliensis suffering from tapping panel dryness. Plant J. 2023, 113, 504–520. [Google Scholar] [CrossRef]
  20. Lakusta, A.M.; Kwon, M.; Kwon, E.G.; Sonebloom, S.; Scheller, H.V.; Ro, D. Molecular studies of the protein complexes involving cis-prenyl transferase in guayule Parthenium argentatum, an alternative rubber-producing plant. Front. Plant Sci. 2019, 10, 165. [Google Scholar] [CrossRef]
  21. Kuroiwa, F.; Nishino, A.; Mandal, Y.; Honzawa, M.; Suenaga Hiromori, M.; Suzuki, K.; Takani, Y.; Miyagi Inoue, Y.; Yamaguchi, H.; Yamashita, S.; et al. Reconstitution of prenyltransferase activity on nanodiscs by components of the rubber synthesis machinery of the para rubber tree and guayule. Sci. Rep. 2022, 12, 3734–3747. [Google Scholar] [CrossRef]
  22. Chen, L.T.; Guo, D.; Zhu, J.H.; Wang, Y.; Li, H.L.; An, F.; Tang, Y.Q.; Peng, S.Q. Functional analysis of the HbREF1 promoter from Hevea brasiliensis and its response to phytohormones. Forests 2024, 15, 276. [Google Scholar] [CrossRef]
  23. Wang, D.; Xie, Q.L.; Sun, Y.; Tong, Z.; Chang, L.L.; Yu, L.; Zhang, X.Y.; Yuan, B.X.; He, P.; Jin, X.; et al. Proteomic landscape has revealed small rubber particles are crucial rubber biosynthetic machines for ethylene-stimulation in natural rubber production. Int. J. Mol. Sci. 2019, 20, 5082–5099. [Google Scholar] [CrossRef] [PubMed]
  24. Liu, J.; Shi, C.; Shi, C.C.; Li, W.D.; Zhang, Q.J.; Zhang, Y.; Li, K.; Lu, H.F.; Shi, C.; Zhu, S.T.; et al. The chromosome-based rubber tree genome provides new insights into spurge genome evolution and rubber biosynthesis. Mol. Plant 2020, 13, 336–350. [Google Scholar] [CrossRef] [PubMed]
  25. Fang, Y.J.; Xiao, X.H.; Lin, J.S.; Lin, Q.; Wang, J.; Liu, K.; Li, Z.H.; Xing, J.F.; Liu, Z.L.; Wang, B.Y.; et al. Pan-genome and phylogenomic analyses highlight Hevea species delineation and rubber trait evolution. Nat. Commun. 2024, 15, 7232. [Google Scholar] [CrossRef] [PubMed]
  26. Wang, X.C.; Wang, D.; Sun, Y.; Yang, Q.; Chang, L.L.; Wang, L.M.; Meng, X.R.; Huang, Q.X.; Jin, X.; Tong, Z. Comprehensive proteomics analysis of laticifer latex reveals new insights into ethylene stimulation of natural rubber production. Sci. Rep. 2015, 5, 13778–13796. [Google Scholar] [CrossRef]
  27. Feng, L.Y.; Liu, J.; Gao, C.W.; Wu, H.B.; Li, G.H.; Gao, L.Z. Higher genomic variation in wild than cultivated rubber trees, Hevea brasiliensis, revealed by comparative analyses of chloroplast genomes. Front Ecol. Evol. 2020, 8, 237. [Google Scholar] [CrossRef]
  28. Wang, X.C.; Shi, M.J.; Lu, X.L.; Ma, R.F.; Wu, C.G.; Guo, A.P.; Peng, M.; Tian, W.M. A method for protein extraction from different subcellular fractions of laticifer latex in Hevea brasiliensis compatible with 2-DE and MS. Proteome Sci. 2010, 8, 10–35. [Google Scholar] [CrossRef]
  29. Cheng, H.; Song, X.; Hu, Y.; Wu, T.; Yang, Q.; An, Z.; Feng, S.; Deng, Z.; Wu, W.; Zeng, X.; et al. Chromosome-level wild Hevea brasiliensis genome provides new tools for genomic-assisted breeding and valuable loci to elevate rubber yield. Plant Biotechnol. J. 2023, 21, 1058–1072. [Google Scholar] [CrossRef]
  30. Fang, P.C.; Long, X.Y.; Fang, Y.J.; Chen, H.; Yu, M. A predominant isoform of fructokinase, HbfFRK2, is involved in Hevea brasiliensis (para rubber tree) latex yield and regeneration. Plant Physiol. Bioch. 2021, 162, 211–220. [Google Scholar] [CrossRef]
  31. Irulappan, G.B.; Natesan, G.; Padikasan, I.A. Molecular investigation on expression analysis of tappinganel dryness (TPD) syndrome associated genes in rubber tree (Hevea brasiliensis Muell. Arg.). Int. J. Plant Environ. 2023, 9, 7–14. [Google Scholar] [CrossRef]
  32. Budiasih, R.; Salim, M.A.; Apriani, I.; Hasani, S.; Subandi, M. Effect of stimulant (ethephon) application and tapping frequency on latex production of rubber tree (Hevea brasiliensis Muell. Arg.). Bulg. J. Agric. Sci. 2020, 26, 793–799. [Google Scholar]
  33. Yue, Y.F.; Wang, X.C.; Xia, Z.H.; Deng, Z.; Wang, D.F.; Li, Y.; Yin, H.; Li, D.J. Bark transcriptome analyses reveals molecular mechanisms involved in tapping panel dryness occurrence and development in rubber tree (Hevea brasiliensis). Gene 2024, 892, 147894. [Google Scholar] [CrossRef] [PubMed]
  34. Bakar, M.F.A.; Othman, A.S. Comparative transcriptome analysis identifies potentially relevant genes in rubber clones with a high latex yield (Hevea brasiliensis). J. Agrobiotechnol. 2022, 13, 61–76. [Google Scholar] [CrossRef]
  35. Lau, N.S.; Makita, Y.; Kawashima, M.; Taylor, T.D.; Kondo, S.; Othman, A.S.; Shu-Chien, A.C.; Matsui, M. The rubber tree genome shows expansion of gene family associated with rubber biosynthesis. Sci. Rep. 2016, 6, 28594–28607. [Google Scholar] [CrossRef] [PubMed]
  36. Leclercq, J.; Wu, S.Y.; Farinas, B.; Pointet, S.; Favreau, B.; Vignes, H.; Kuswanhadi, K.; Ortega-Abboud, E.; Dufayard, J.F.; Gao, S.H.; et al. Post-transcriptional regulation of several biological processes involved in latex production in Hevea brasiliensis. PeerJ 2020, 8, e8932. [Google Scholar] [CrossRef]
  37. Tang, C.R.; Yang, M.; Fang, Y.J.; Luo, Y.F.; Gao, S.H.; Xiao, X.H.; An, Z.w.; Zhou, B.H.; Zhang, B.; Tan, X.Y.; et al. The rubber tree genome reveals new insights into rubber production and species adaptation. Nat. Plants 2016, 6, 16073–16082. [Google Scholar] [CrossRef]
  38. Brown, D.; Feeney, M.; Ahmadi, M.; Lonoce, C.; Sajari, R.; Di Cola, A.; Frigerio, L. Subcellular localization and interactions among rubber particle proteins from Hevea brasiliensis. J. Exp. Bot. 2017, 68, 45–55. [Google Scholar] [CrossRef]
  39. Amerik, A.Y.; Martirosyan, Y.T.; Gachok, I.V. Regulation of natural rubber biosynthesis by proteins associated with rubber particles. Russ. J. Bioorg. Chem. 2018, 44, 40–49. [Google Scholar] [CrossRef]
  40. Dong, G.Q.; Fan, M.W.; Wang, H.N.; Leng, Y.D.; Sun, J.T.; Huang, J.; Zhang, H.; Yan, J. Functional characterization of TkSRPP promoter in response to hormones and wounding stress in transgenic tobacco. Plants 2023, 12, 252. [Google Scholar] [CrossRef]
  41. Ran, X.; Liu, Y.; Zhao, D.G. The relationship between EuSRPP1 gene expression and rubber biosynthesis in Eucommia ulmoides oliver (du-zhong). Ind. Crops Prod. 2022, 175, 114246. [Google Scholar] [CrossRef]
  42. Wadeesirisak, K.; Castano, S.; Vaysse, L.; Bonfils, F.; Peruch, F.; Rattanaporn, K.; Liengprayoon, S.; Lecomte, S.; Bottier, C. Interactions of REF1 and SRPP1 rubber particle proteins from Hevea brasiliensis with synthetic phospholipids: Effect of charge and size of lipid headgroup. Biochem. Bioph. Res. Co. 2023, 679, 205–214. [Google Scholar] [CrossRef]
  43. Nakano, Y.; Mitsuda, N.; Ide, K.; Mori, T.; Mira, F.R.; Rosmalawati, S.; Watanabe, N.; Suzuki, K. Transcriptome analysis of Para rubber tree (H. Brasiliensis) seedlings under ethylene stimulation. BMC Plant Biol. 2021, 21, 420–436. [Google Scholar] [CrossRef] [PubMed]
  44. Habib, M.A.H.; Ismail, M.N. Hevea brasiliensis latex proteomics: A review of analytical methods and the way forward. J. Plant Res. 2021, 134, 43–53. [Google Scholar] [CrossRef] [PubMed]
  45. Ganesh, I.; Choi, S.C.; Bae, S.W.; Park, J.C.; Ryu, S.B. Heterologous activation of the Hevea PEP16 promoter in the rubber-producing laticiferous tissues of Taraxacum kok-saghyz. Sci. Rep. 2020, 10, 10844–10853. [Google Scholar] [CrossRef]
  46. Priyadarshan, P.M. Molecular markers to devise predictive models for juvenile selection in Hevea rubber. Plant Breed. 2022, 141, 159–183. [Google Scholar] [CrossRef]
  47. Montoro, P.; Wu, S.Y.; Favreau, B.; Herlinawati, E.; Labrune, C.; Martin-Magniette, M.L.; Pointet, S.; Rio, M.; Leclercq, J.; Ismawanto, S.; et al. Transcriptome analysis in Hevea brasiliensis latex revealed changes in hormone signalling pathways during ethephon stimulation and consequent Tapping Panel Dryness. Sci. Rep. 2018, 8, 8483–8494. [Google Scholar] [CrossRef]
  48. Buakong, W.; Suwanmanee, P.; Vasinayanuwatana, T.; Ruttajorn, K.; Assawatreeratanakul, K.; Leake, J.E. Characterization and expression analysis of HbC3H66: Implications for transcriptional regulation in rubber biosynthesis and abiotic stress responses in Hevea brasiliensis. Trends Sci. 2023, 20, 6835. [Google Scholar] [CrossRef]
  49. Li, H.L.; Wei, L.R.; Guo, D.; Wang, Y.; Zhu, J.H.; Chen, X.T.; Peng, S.Q. HbMADS4, a MADS-box transcription factor from Hevea brasiliensis, negatively regulates HbSRPP. Front. Plant Sci. 2016, 7, 1709. [Google Scholar] [CrossRef]
  50. Cherian, S.; Ryu, S.B.; Cornish, K. Natural rubber biosynthesis in plants, the rubber transferase complex, and metabolic engineering progress and prospects. Plant Biotechnol. J. 2019, 17, 2041–2061. [Google Scholar] [CrossRef]
  51. Stonebloom, S.H.; Scheller, H.V. Transcriptome analysis of rubber biosynthesis in guayule (Parthenium argentatum Gray). BMC Plant Biol. 2019, 19, 71. [Google Scholar] [CrossRef]
  52. Meraj, T.A.; Fu, J.Y.; Raza, M.A.; Zhu, C.Y.; Shen, Q.Q.; Xu, D.B.; Wang, Q. Transcriptional factors regulate plant stress responses through mediating secondary metabolism. Genes 2020, 11, 346. [Google Scholar] [CrossRef]
Figure 1. Changes of latex physiological parameters after tapping on the Hevea rubber tree. (A) The tapping process. (B) Fresh yield. (C) Flowing time. (D) Dry rubber content. (E) Dry matter. Values indicate mean ± SD from three replicates. One asterisk (*) and two asterisks (**) represent significant differences at p < 0.05 and p < 0.01 using the Student’s t test, respectively.
Figure 1. Changes of latex physiological parameters after tapping on the Hevea rubber tree. (A) The tapping process. (B) Fresh yield. (C) Flowing time. (D) Dry rubber content. (E) Dry matter. Values indicate mean ± SD from three replicates. One asterisk (*) and two asterisks (**) represent significant differences at p < 0.05 and p < 0.01 using the Student’s t test, respectively.
Forests 15 01807 g001
Figure 2. Overview of transcriptome in the latex after tapping. (A) PCoA of transcriptomic data. (B) Venn diagram of the shared and unique DEGs. (C) Trend analysis of the identified genes. The upper left corner number represents the clustering results (20 profiles were obtained), the lower left corner number represents the number of genes with the same trend, and the colored trend indicates a trend of significant enrichment. (D) TF prediction result of DEGs.
Figure 2. Overview of transcriptome in the latex after tapping. (A) PCoA of transcriptomic data. (B) Venn diagram of the shared and unique DEGs. (C) Trend analysis of the identified genes. The upper left corner number represents the clustering results (20 profiles were obtained), the lower left corner number represents the number of genes with the same trend, and the colored trend indicates a trend of significant enrichment. (D) TF prediction result of DEGs.
Forests 15 01807 g002
Figure 3. Proteomic analysis of the latex after tapping. (A) PCoA of proteomic data. (B) Venn diagram of the shared and unique DEPs. (C) Trend analysis of the identified proteins. The upper left corner number represents the clustering results (20 profiles were obtained), the lower left corner number represents the number of proteins with the same trend, and the colored trend indicates a trend of significant enrichment. (D) TF prediction result of DEPs.
Figure 3. Proteomic analysis of the latex after tapping. (A) PCoA of proteomic data. (B) Venn diagram of the shared and unique DEPs. (C) Trend analysis of the identified proteins. The upper left corner number represents the clustering results (20 profiles were obtained), the lower left corner number represents the number of proteins with the same trend, and the colored trend indicates a trend of significant enrichment. (D) TF prediction result of DEPs.
Forests 15 01807 g003
Figure 4. Enrichment analysis of DEGs and DEPs. GO enrichment of the identified DEGs (A) and DEPs (B). The top 20 abundant KEGG pathways in DEGs (C) and DEPs (D) were displayed.
Figure 4. Enrichment analysis of DEGs and DEPs. GO enrichment of the identified DEGs (A) and DEPs (B). The top 20 abundant KEGG pathways in DEGs (C) and DEPs (D) were displayed.
Forests 15 01807 g004
Figure 5. Expression of genes and proteins in nature rubber biosynthesis pathway.
Figure 5. Expression of genes and proteins in nature rubber biosynthesis pathway.
Forests 15 01807 g005
Figure 6. The qRT-PCR verification of the DEGs in NRB pathway. Different letters represent significant differences (p < 0.05).
Figure 6. The qRT-PCR verification of the DEGs in NRB pathway. Different letters represent significant differences (p < 0.05).
Forests 15 01807 g006
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

He, L.; Yang, Y.; Ma, J.; Yuan, B.; Fang, F.; Wang, J.; Wang, M.; Li, A.; Chen, J.; Hui, S.; et al. Transcriptomic and Proteomic Integration Reveals Key Tapping-Responsive Factors for Natural Rubber Biosynthesis in the Rubber Tree Hevea brasiliensis. Forests 2024, 15, 1807. https://doi.org/10.3390/f15101807

AMA Style

He L, Yang Y, Ma J, Yuan B, Fang F, Wang J, Wang M, Li A, Chen J, Hui S, et al. Transcriptomic and Proteomic Integration Reveals Key Tapping-Responsive Factors for Natural Rubber Biosynthesis in the Rubber Tree Hevea brasiliensis. Forests. 2024; 15(10):1807. https://doi.org/10.3390/f15101807

Chicago/Turabian Style

He, Lixia, Yang Yang, Junjun Ma, Boxuan Yuan, Fengyan Fang, Juanying Wang, Mei Wang, Aifang Li, Jinxian Chen, Shugang Hui, and et al. 2024. "Transcriptomic and Proteomic Integration Reveals Key Tapping-Responsive Factors for Natural Rubber Biosynthesis in the Rubber Tree Hevea brasiliensis" Forests 15, no. 10: 1807. https://doi.org/10.3390/f15101807

APA Style

He, L., Yang, Y., Ma, J., Yuan, B., Fang, F., Wang, J., Wang, M., Li, A., Chen, J., Hui, S., & Wang, X. (2024). Transcriptomic and Proteomic Integration Reveals Key Tapping-Responsive Factors for Natural Rubber Biosynthesis in the Rubber Tree Hevea brasiliensis. Forests, 15(10), 1807. https://doi.org/10.3390/f15101807

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop