Physiological and Gene Expression Response of Interspecific Hybrids of Fraxinus mandshurica × Fraxinus americana to MJ or SNP under Drought
Abstract
1. Introduction
2. Material and Methods
2.1. Plant Material and Water Stress Treatments
2.2. Exogenous Application of SNP and MJ
2.3. Determination of Photosynthesis Parameters
2.4. Determination of Peroxidation and Antioxidant Enzyme Activities
2.5. Determination of Phytohormones
2.6. Real-Time Quantitative RT-PCR
2.7. Data Processing and Statistics
3. Results
3.1. Effects of Exogenous SNP or MJ on Relative Growth of Hybrid F1 and Parents under Drought
3.2. Effects of Exogenous SNP or MJ on Photosynthesis of Hybrid F1 and Parents under Drought
3.3. Effects of Exogenous SNP or MJ on the Content of Peroxidation Levels and Antioxidant Enzyme Activities of Hybrid F1 and Parents under Drought
3.4. Effects of Exogenous SNP or MJ on the Gene Expression of Hybrid F1 and Parents under Drought
3.5. Effects of Exogenous SNP or MJ on Hormone Contents of Hybrid F1 and Parents under Drought
4. Discussion
5. Conclusions
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
Abbreviations
References
- Yi, X.M.; Zhang, Y.; Wang, Y.X.; Ji, L.Z.; Wu, P.L. Population structure of Fraxinus mandshurica on Changbai Mountain. Acta Ecol. Sin. 2015, 35, 91–97. [Google Scholar]
- Zhao, X.T.; Xia, D.A.; Zeng, F.S.; Yao, S.Z.; Shang, Y.L.; Zhang, G.Q.; Wang, Y.X.; Zhang, T.W.; Zhan, Y.G. Provenances by Sites Interaction of Growth Traits and Provenance Selection of Fraxinus mandshurica. Sci. Silvae Sin. 2015, 52, 140–147. [Google Scholar]
- Reddy, K.S.; Sekhar, K.M.; Reddy, A.R. Genotypic variation in tolerance to drought stress is highly coordinated with hydraulic conductivity–photosynthesis interplay and aquaporin expression in field-grown mulberry (Morus spp.). Tree Physiol. 2017, 37, 926–937. [Google Scholar] [CrossRef] [PubMed]
- Li, B.; Zhan, Y.G.; Xu, Y.G.; Zeng, F.S.; Zhang, G.Q. Photosynthetic Physiological Characteristics in F1 Progeny of Fraxinus mandshurica and Fraxinus americana under Drought Stress. Acta Bot. Boreal. Occident. Sin. 2021, 32, 2313–2320. [Google Scholar]
- Dong, J. Interspecific Heterosis and Molecular Mechanism of Drought Resistance in Ybrids from Fraxinus. Ph.D. Thesis, Northeast Forestry University, Harbin, China, 2012. [Google Scholar]
- He, Z.; Zhan, Y.; Zeng, F.; Zhao, X.; Wang, X. Drought physiology and gene expression characteristics of Fraxinus interspecific hybrids. Plant Growth Regul. 2015, 78, 179–193. [Google Scholar] [CrossRef]
- Zhao, Y.L.; Li, D.J.; Cui, X.S.; Zhang, J.Q.; Xie, C.; Cheng, P.; Wang, H.N. Physiological and biochemical responses of Forsythia suspense seedlings to exogenous methyl jasmonate under drought stress. J. Chin. Med. Mater. 2020, 43, 1832–1836. [Google Scholar]
- Gupta, K.J.; Kaladhar, V.C.; Fitzpatrick, T.B.; Fernie, A.R.; Møller, I.M.; Loake, G.J. Nitric oxide regulation of plant metabolism. Mol. Plant 2021, 15, 228–242. [Google Scholar] [CrossRef]
- Zhou, X.; Joshi, S.; Khare, T.; Patil, S.; Shang, J.; Kumar, V. Nitric oxide, crosstalk with stress regulators and plant abiotic stress tolerance. Plant Cell Rep. 2021, 40, 1395–1414. [Google Scholar] [CrossRef]
- Mishra, V.; Singh, P.; Tripathi, D.K.; Corpas, F.J.; Singh, V.P. Nitric oxide and hydrogen sulfide: An indispensable combination for plant functioning. Trends Plant Sci. 2021, 26, 1270–1285. [Google Scholar] [CrossRef]
- Fang, H.; Wang, C.L.; Liao, W.B.; Zhang, J.; Huo, J.Q.; Huang, D.J.; Niu, L.J.; Wang, B. NO is Involved in ABA-regulated Senescence of Cut Roses by Maintaining Water Content and Increasing Antioxidant Enzyme Activities. Acta Hortic. Sin. 2019, 46, 901–909. [Google Scholar]
- Chen, Y.Q.; Shen, Y.; Fan, J.L.; Chen, X.; Xu, X.Y.; Zhang, D.; Qian, G.; Chen, Y. The effects of methyl jasmonic acid on leaf antioxidative capacity of Ilex verticillata L. seedlings under drought and re-watering. J. Nanjing For. Univ. (Nat. Sci. Ed.) 2018, 42, 35–43. [Google Scholar]
- Mandal, S.; Mallick, N.; Mitra, A. Salicylic acid-induced resistance to Fusarium oxysporum f. sp. lycopersici in tomato. Plant Physiol. Biochem. 2009, 47, 642–649. [Google Scholar] [CrossRef]
- Wang, W.; Barnaby, J.Y.; Tada, Y.; Li, H.; Tör, M.; Caldelari, D.; Lee, D.-U.; Fu, X.-D.; Dong, X. Timing of plant immune responses by a central circadian regulator. Nature 2011, 470, 110–114. [Google Scholar] [CrossRef]
- Perfus-Barbeoch, L.; Leonhardt, N.; Vavasseur, A.; Forestier, C. Heavy metal toxicity: Cadmium permeates through calcium channels and disturbs the plant water status. Plant J. 2002, 32, 539–548. [Google Scholar] [CrossRef]
- Farquhar, G.D.; Sharkey, T.D. Stomatal conductance and photosynthesis. Annu. Rev. Plant Physiol. 1982, 33, 317–345. [Google Scholar] [CrossRef]
- Babenko, L.M.; Shcherbatiuk, M.M.; Skaterna, T.D.; Kosakivska, I.V. Lipoxygenases and their metabolites in formation of plant stress tolerance. Ukr. Biochem. J. 2017, 89, 5–21. [Google Scholar] [CrossRef]
- Abeed, A.H.A.; Eissa, M.A.; Wahab, D.A.A. Effect of exogenously applied jasmonic acid and kinetin on drought tolerance of wheat cultivars based on morpho-physiological evaluation. J. Soil Sci. Plant Nutr. 2021, 21, 131–144. [Google Scholar] [CrossRef]
- Duan, B.; Ma, Y.; Jiang, M.; Yang, F.; Ni, L.; Lu, W. Improvement of photosynthesis in rice (Oryza sativa L.) as a result of an increase in stomatal aperture and density by exogenous hydrogen sulfide treatment. Plant Growth Regul. 2014, 75, 33–44. [Google Scholar] [CrossRef]
- Liu, J.X.; Wang, J.C.; Wang, R.J.; Jia, H.Y. Effects of exogenous nitric oxide on photosynthetic and bioluminescent characteristics in ryegrass seedlings under osmotic stress. Acta Pratacult. Sin. 2013, 22, 210–216. [Google Scholar]
- Hasan, M.M.-U.; Ma, F.; Prodhan, Z.H.; Li, F.; Shen, H.; Chen, Y.; Wang, X. Molecular and Physio-Biochemical Characterization of Cotton Species for Assessing Drought Stress Tolerance. Int. J. Mol. Sci. 2018, 19, 2636. [Google Scholar] [CrossRef]
- Myers, R.J.; Fichman, Y.; Zandalinas, S.I.; Mittler, R. Jasmonic acid and salicylic acid modulate systemic reactive oxygen species signaling during stress responses. Plant Physiol. 2023, 191, 862–873. [Google Scholar] [CrossRef]
- Kumar, V.; Chaudhary, P.; Prasad, A.; Dogra, V.; Kumar, A. Jasmonic acid limits Rhizoctonia solani AG1–IA infection in rice by modulating reactive oxygen species homeostasis. Plant Physiol. Biochem. 2023, 196, 520–530. [Google Scholar] [CrossRef] [PubMed]
- Beniušytė, E.; Čėsnienė, I.; Sirgedaitė-Šėžienė, V.; Vaitiekūnaitė, D. Genotype-Dependent Jasmonic Acid Effect onPinus sylvestrisL. Growth and Induced Systemic Resistance Indicators. Plants 2023, 12, 255. [Google Scholar] [CrossRef] [PubMed]
- Zhang, H.; Xiang, Y.; He, N.; Liu, X.; Liu, H.; Fang, L.; Zhang, F.; Sun, X.; Zhang, D.; Li, X.; et al. Enhanced Vitamin C Production Mediated by an ABA-Induced PTP-like Nucleotidase Improves Plant Drought Tolerance in Arabidopsis and Maize. Mol. Plant 2020, 13, 760–776. [Google Scholar] [CrossRef] [PubMed]
- Ma, Y.; Cao, J.; He, J.; Chen, Q.; Li, X.; Yang, Y. Molecular Mechanism for the Regulation of ABA Homeostasis During Plant Development and Stress Responses. Int. J. Mol. Sci. 2018, 19, 3643. [Google Scholar] [CrossRef] [PubMed]
- Li, H.; Wang, B.; Zhang, Q.; Wang, J.; King, G.J.; Liu, K. Genome-wide analysis of the auxin/indoleacetic acid (Aux/IAA) gene family in allotetraploid rapeseed (Brassica napus L.). BMC Plant Biol. 2017, 17, 204. [Google Scholar] [CrossRef]
- Christine, Z.; Busov, V.; Zhang, J. Roles of Gibberellin Catabolism and Signaling in Growth and Physiological Response to Droughtand Short-Day Photoperiods in Populus Trees. PLoS ONE 2014, 9, e86217. [Google Scholar]
- Jaroslav, P.; Jan, N.; Vladěna, K.; Markéta, L.; Břetislav, B.; Martin, Č. Cytokinin at the Crossroads of Abiotic Stress Signalling Pathways. Int. J. Mol. Sci. 2018, 19, 2450. [Google Scholar]
- Ling, P.; Chen, M.; Wang, J.P.; Xiao, M.; Fan, X.M.; Yang, Z.F.; Zhou, M.; Zhang, X. Integrated omics data of two annual ryegrass (Lolium multiflorum L.) genotypes reveals core metabolicprocesses under drought stress. BMC Plant Biol. 2018, 18, 26. [Google Scholar]
- Xie, Y.F.; Yang, W.H.; Yang, Y.; Cai, X.L.; Zhou, J. Effects of exogenous nitric oxide on photosynthetic characteristic of Indocalamus barbatus under a simulated acid rain stress condition. Acta Ecol. Sin. 2007, 27, 5193–5201. [Google Scholar]
- Ren, T.H.; Chen, S.Y.; Luo, X.Y.; Zhou, Q.P.; Chen, Z.H.; Li, S.D. Effects of Exogenous Nitric Oxide on the Growth and Physiological Characteristics of Oat Seedlings under PEG Stress. Seed 2020, 039, 30–34. [Google Scholar]
- Schaller, A.; Stintzi, A. Enzymes in jasmonate biosynthesis—Structure, function, regulation. Phytochemistry 2009, 70, 1532–1538. [Google Scholar] [CrossRef]
- Zhao, H.; Xu, X.; Zhang, Y.; Korpelainen, H.; Li, C. Nitrogen deposition limits photosynthetic response to elevated CO2 differentially in a dioecious species. Oecologia 2011, 165, 41–54. [Google Scholar] [CrossRef]
- Yakir, E.; Hilman, D.; Harir, Y.; Green, R.M. Regulation of output from the plant circadian clock. FEBS J. 2006, 274, 335–345. [Google Scholar] [CrossRef]
- Gao, G.; Zhang, S.; Wang, C.; Yang, X.; Wang, Y.; Su, X.; Du, J.; Yang, C. Arabidopsis CPR5 Independently Regulates Seed Germination and Postgermination Arrest of Development through LOX Pathway and ABA Signaling. PLoS ONE 2011, 6, e19406. [Google Scholar] [CrossRef]
- Zhong, L.; Chen, D.; Min, D.; Li, W.; Xu, Z.; Zhou, Y.; Li, L.; Chen, M.; Ma, Y. AtTGA4, a bZIP transcription factor, confers drought resistance by enhancing nitrate transport and assimilation in Arabidopsis thaliana. Biochem. Biophys. Res. Commun. 2015, 457, 433–439. [Google Scholar] [CrossRef]
- Goel, P.; Singh, A.K. Abiotic Stresses Downregulate Key Genes Involved in Nitrogen Uptake and Assimilation in Brassica juncea L. PLoS ONE 2015, 10, e0143645. [Google Scholar] [CrossRef]






| Gene | Primer Name | Primer Sequence | |
|---|---|---|---|
| LHY | qPT–PCR | qLHY–F | AGAGGAGGAGCACAATAGGTTT |
| qLHY–R | TATGTCCTACTGGAACTCCTTTAAT | ||
| TOC1 | qPT–PCR | qTOC1–F | AAGTTGACCTTCCTATGTCTAAA |
| qTOC1–R | TTACAATGTCCTTCTCTGCTAGT | ||
| LOX NIR PYR1 PP2C1 | qPT–PCR qPT–PCR qPT–PCR qPT–PCR | qLOX–F qLOX–R qNIR–F qNIR–R qPYR1–F qPYR1–R qPP2C1–F qPP2C1–R | TGAGTGTGCTTCACCCAATA AAGTGCCTGCTCTGTAAAGTT CCAGTTGGGAACCCTATTG TCGTGGCAGGCATGTATG TGGTGGGGAGCATAGATTG CTTCACAACTGTATCGGCAA TGGCAGGCTTATTATCTCAA TGTTTCTTAGGTGGTGGTTG |
| TU | qPT–PCR | qTU–F | AGGACGCTGCCAACAACTTT |
| qTU–R | TTGAGGGGAAGGGTAAATAGTG | ||
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Cao, Y.; He, L.; Song, F.; Li, C.; Ji, Q.; Liu, J.; Peng, G.; Li, B.; Zeng, F.; Zhan, Y. Physiological and Gene Expression Response of Interspecific Hybrids of Fraxinus mandshurica × Fraxinus americana to MJ or SNP under Drought. Forests 2023, 14, 1277. https://doi.org/10.3390/f14061277
Cao Y, He L, Song F, Li C, Ji Q, Liu J, Peng G, Li B, Zeng F, Zhan Y. Physiological and Gene Expression Response of Interspecific Hybrids of Fraxinus mandshurica × Fraxinus americana to MJ or SNP under Drought. Forests. 2023; 14(6):1277. https://doi.org/10.3390/f14061277
Chicago/Turabian StyleCao, Yang, Liming He, Fei Song, Chuanzhou Li, Qitian Ji, Jianfei Liu, Guangzhou Peng, Boyao Li, Fansuo Zeng, and Yaguang Zhan. 2023. "Physiological and Gene Expression Response of Interspecific Hybrids of Fraxinus mandshurica × Fraxinus americana to MJ or SNP under Drought" Forests 14, no. 6: 1277. https://doi.org/10.3390/f14061277
APA StyleCao, Y., He, L., Song, F., Li, C., Ji, Q., Liu, J., Peng, G., Li, B., Zeng, F., & Zhan, Y. (2023). Physiological and Gene Expression Response of Interspecific Hybrids of Fraxinus mandshurica × Fraxinus americana to MJ or SNP under Drought. Forests, 14(6), 1277. https://doi.org/10.3390/f14061277

